Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL507b06ex.5.5                       45 PI      86         57     1332                (no blast hit)

 This cluster: approximate FL confidence score = 83%

 1012838000 Xl3.1-XL460i05ex.5 - 43 ESTs
                                                                       ........-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL460i05ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATACAGTTGGATTTCAGTTCGAACTGGGCGGATACATGCGGCTTTTAGCGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTATTACCCTGTGAGAAGAAGCAGCAGGAAGAATAAAACAGAAATTGAGTCAGAGGAGAAGAAGAGAATAGATGAACTAATTCAGACTGGCAAAGAAGAAGGGATAAAGATGCACATGATTACTGCATGTCCATTGCGTGTAATTGCAAAACTCGGGGACTTCCAGCGAAGGATTGTTGTAGAATACCATGGAGATCTGATAGAGATCACGGATGCCAAAAGGAGAGAAGCATCATATGCACAGGATTCAGCTACTGGCTGCTATATGTACTATTTTCAGTATTTGAACACAAGCTACTGCATCGATGCCACAAGAGAGACTGGCCGTTTAGGGAGGCTGATCAACCACAGCAAGTCTGGAAACTGTCACACCAAACTGCACAACATCAACAATGTACCTCACCTTATACTTG------------TATCAACGTTGGAGAGGAANTGCTGTATGACTATGGTGATAGAAGAAAATCTTCCATTGATGCACATCCTTGGCTTAAAAACTGACCTGCAGATGGACATGGCTGANTTTACAATATGACTTTGTGATCTGC------------TTTTTTAATTCCCTTTTACATTTAATATGAGTATGATATGGNTTTAAATGCATTATGTCTTTACCAAAAGTTTTATACCTAGTT------------NTAGAGGTAATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTTTGGGGGGTTTTTTTTTTTTTTTTTTTTTAGTAATAAATATTTTTTTTTATTCCNCTTTTTTTTTTTTTTCAGTATAAAAAGATATATCATGATGTATTTTACACCTACTGCTTTAAAATTCTATAGCAATGATCTTACAGTAACAGCCAACATAAATTTGCAGCAAACCCATTGAGAATCCGTGCAGAGACAACATACATTTATTCTCATGTCAAGCCCTATTGTAAAATTTATACTAAAAAGGGGTCTGCCCATGTGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATTTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTATTTACACAATCATTTTTAAGTTCCTTTTCACATCTATCCCCTTCAAAACA
                                                  Xl3.1-CHK-1012722347                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGGATTTCAGTxxGAxxTGGGCGGATACATGCGGCTTTTAGCGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTATTACCCTGTGAGAAGAAGCAGCAGGAAGAATAAAACAGAAATTGAGTCAGAGGAGAAGAAGAGAATAGATGAACTAATTCAGACTGGCAAAGAAGAAGGGATAAAGATGCACATGAxTxxxxCATGTCxxxxxxGTGTAATTGCAAxxCxxGGGGACTTCCAGCGAxxGxTTGTTGTAGAATACCATGGAGATCTGATAGAGATCACGGATGCCAAAAGGAGAGAAGCATCATATGCACAGGATTCAGCTACTGGCTGCTATATGTACTATTTTCAGTATTTGAACACAAGCTACTGCATCGATGCCACAAGAGAGACTGGCCGTTTAGGGAGGCTGATCAACCACAGCAAGTCTGGAAACTGTCACACCAAACTGCACAACATCAACAATGTACCTCACCTTATACTTGTTGCATCGCGGGxxxxxAxxxTxGxxxxGxAATxxxxxxxxxxxxxxGxxxxxxxAxxAAAxxxTxCxxTxxxxxxxxxxCxTxGxxTxAAAAxxxxxCxxxxxxxxGxxxxxGxxxxATTTxxxAxxxxxxxTTxxxxxxxxxCTTCTGTTCTGGTTTTTTAATTCCCTTTTACATTTAATATGAGTATGATATGGATTTAAATGCATTATGTCTTTACCAAAAGTTTTATACCTAGTTTTTGTATGTTTGCxxxxxGxxAxTGTAGTGCTTCCAAAGCATGCTGGTTTTTCCCTCTTTTAAATGTGTATGCATAGGAGCAGGAGAAAACTGGTTACATAATGTGTTCTAAATGTCTGATTGCAGATGAGTGAAAGGCTAATTCTTAAGTAGAAGTACATTTGGAACACTCACTAATATAACCAAAGTAAATGTAGGCTTGGAATTTATTCCTTATACTTTTGTAAACAAAACATGAATTTCACGCAAGAAATTGAGCCAGTGTAAACCTTTAATTCTTGCTTTCTATATGTTTGCATCTGTTAGGGTTAAATAGTGTTCCCATCAGGGTGGTAACTACCTGCAACATGCGTTTGCCTTTACTATACACCAATCCTTGTTTGCACCCATGCTTCCCAACATTCCATTACAAAGACACAGGACAAACTTCACTTGTGGATATTCTGGGATTTATAGTTTAGCCATATTTGGGAGCCACAAGTAGAAGATATATTTTTATAAGTAGGTCTGTCATTTAGAGAGACTTTTTTTTTTATAATGNCTCTTGTTGTTAGGGGCAGTATATCAAGTGCTTTGTGATGG------------GGGGGGTTTTTTTTTTTTTTTTTTTTTAGTAATAAATATTTTTTTTTATTxxTxTTTTTTTTTTTTTTCAGTATAAAAAGATATATCATGATGTATTTTACACCTACTGCTTTAAAATTCTATAGCAATGATCTTACAGTAACAGCCAACATAAATTTGCAGCAAACCCATTGAGAATCCGTGCAGAGACAACATACATTTATTCTCATGTCAAGCCCTATTGTAAAATTTATACTAAAAAGGGGTCTGCCCATGTGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATTTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTATTTACACAATCATTTTTAAGTTCCTTTTCACATCTATCCCCTTCAAAACAGAGGAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            2     3     2     4     6    10    11    17    11    19    11    20    12    22    13    22    13    23    13    24    15    25    14    25    15    25    15    25    15    25    15    25    23    25    23    25    20    23    20    23    20    23    20    23    20    23    20    23    14    23    14    23    14    23    14    23    14    24    13    24    14    24    14    24    14    24    13    23    11    22    11    21    10    21    12    21    11    20    11    20    11    20    11    20    10    19     9    18     9    18     9    18     9    18     9    18     9    17     9    17    11    17     9    17    10    18     9    16    10    15    10    15     8    15     6    14     5    12     4    10     4    10     5     9     5     9     3     8     3     8     3     8     3     8     3     8     2     7     2     5     2     3     1     3     2     3     2     2     2     2     1     1     2     2     2     2     2     2     2     2     2     2     1     1     2     2     1     1     2     2     2     2     2     2     2     2     2     2     3     3     3     3     0     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     3     3     3     3     3     3     1     1     3     3     3     3     3     3     0     1     1     1     0     1     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     1     0     1     1     4     3     4     4     7     3     8     3     8     7    10     9    10    10    10    10    12     9    12    11    12    10    12    10    12    11    12    11    12    12    12    11    12    11    12    12    12    10    12     9    12    10    12    11    12    11    12    11    12     9    12    10    12    10    12    10    12     9    11     8    11     9    11     7     9     3     4     3     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGGGAAGAGTTCTGCAGATTCTCTGTTGAAACACCCTTTTCGGCTGCCCATGATGCTGCCCTTACAGAATGTGCTGTAATTCCTGACTGCACCTCCTGATTTTGCTTTATGTATTTCTACTTTATACAAAGATATACATACG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGTCGGTGGGCTCATTAAATATCCTCTTGACTCCAGGCAGCCGCTGCTCCCATGGGATTCAGCAAGATCAGATAAGCTTTCTAGCTGCAACTATATCGCATGGCAGCGAAGCCCTTTTCCATCTCTCTGGGGACTTTTGTGTAATCCAGGGGGTGTTAGGGGTAACTATGCCTCTGATTCAGACACTCAATAGTCACAGCCTGATCTCCATCCCTACAAACTCTTACTTTGTTAATGCCCCCTGTCCAACCTCGGTACTGGGCTAATAATGATTTCTATGCCATGACATTAGCAGGGCTGCCTGGTTATTTCATGAAAGCTCCATAGATATATTAGTAAGCTCATGTATGAGCAGTAAACAAGTTTAGGAGTGCTACACTGTTGGCTTATGTTTTCGATCATGACCATAAAGTGCTATTAGCCCTGACTTATTCTCATCTAATAGTACTGGAATTGTACATGGTGCCAAGGTTCACGTGCAGGTAATTGACTAGTACACCTATCATTTTCTTTGT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----T------
                                               BLH ATG     182     194                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               BLH MIN     182     101                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               BLH OVR     182      59                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               EST CLI      13      35                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               ORF LNG     182       2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 8e-025     NP_001022796.1 SET (trithorax/polycomb) domain containing family member (set-1) [Caenorhabditis elegans] -----------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 2e-036     NP_731901.1 CG3307-PC [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 7e-041     XP_001204357.1 PREDICTED: similar to H4-K20-specific histone methyltransferase SET7 [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ag ---- 6e-040     XP_313242.4 AGAP012481-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dr ---- 1e-057     NP_001038814.1 PR/SET domain containing protein 8a [Danio rerio] ---------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Cf ---- 2e-080     XP_853243.1 PREDICTED: similar to SET domain-containing protein 8 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Bt ==== 5e-083     NP_001039795.1 SET domain containing (lysine methyltransferase) 8 [Bos taurus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 5e-083     NP_084517.2 SET domain-containing protein [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 4e-085     NP_065115.3 SET domain-containing protein 8; H4-K20-specific histone methyltransferase [Homosapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Gg ---- 5e-086     XP_415116.1 PREDICTED: similar to Histone-lysine N-methyltransferase, H4 lysine-20 specific (Histone H4-K20 methyltransferase) (H4-K20-HMTase) (SET domain-containing protein 8) (PR/SET domain-containing protein 07) (PR/SET07) (PR-Set7) [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 7e-156     Q0V9E9.1 Histone-lysine N-methyltransferase SETD8 (SET domain-containing protein 8) [Xenopus tropicalis]  ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Xl ==== 2e-177     NP_001121300.1 hypothetical protein LOC100158384 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL460i05ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG---------ATG---------------------------------TAG------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------ATG------------------------------ATG---ATG---------------TGA------------------------------TAA------------------ATG---ATG---------TAAATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAATAA---------------------------------------------------------------------------------------TAG---TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------ATG------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                           ...
  5   1   2       chi Li1                    IMAGE:3398613-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTGAATCTAAGCTTTGTGGCCCGCGGCAGATTGATCGCAAAAGCCCAGTCCCGATGTACAGAGACTTTTATAGCAGCTCCGTGTTCTTTGAGCAAACTCCTCCAAGTCAGCTGTCTCTGCCTCTCCACCCCTAGTCCCTTTAAAGATGGCGGCGCTGTGGCCTCAAGCTGTTGTCACAATGCGCTGAGACTTCCCACCTCAACCTACCCAAATAAACCAGGTCTTGTCTGTTTCCTAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGTCGGTGGGCTCATTAAATATCCTCTTGACTCCAGGCAGCCGCTGCTCCCATGGGATTCAGCAAGATCAGATAAGCTTTCTAGCTGCAACTATATCGCATGGCAGCGAAGCCCTTTTCCATCTCTCTGGGGACTTTTGTGTAATCCAGGGGGTGTTAGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCAAAG
  5   1   2       bld Ga15      in                       XL427p21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGTTCTGCAGATTCTCTGTTGAAACACCCTTTTCGGCTGCCCATGATGCTGCCCTTACAGAATGTGCTGTAATTCCTGACTGCACCTCCTGATTTTGCTTTATGTATTTCTACTTTATACAAAGATAGACATACGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL427p21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGTTCTGCAGATTCTCTGTTGAAACACCCTTTTCGGCTGCCCATGATGCTGCCCTTACAGAATGTGCTGTAATTCCTGACTGCACCTCCTGATTTTGCTTTATGTATTTCTACTTTATACAAAGATAGACATACGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAG
  5   1   2       bld Ga18                              xlk135j06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTAGAGAAGAGATGGGNGGATACATGCGGCTTTTAGNGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGAAGGNGNNNGNCNNCTCGGATACCGGCANAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGNNNNGGCCAAAATCTACTCNTNATATGAGCCCNACTAAATCTCCCAGNNCCCGCCCTCCCCTGCAANNAGNAAACTCTGTTACGCACCNTGNGAGCNAGNNTCTNGGGAAANCCNTCAACAGAGACTCGCAAAAAANNCNGAGGNTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAANCCAGTGAGCAAAGGGAGACTGAATGCNATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAANCTAGCATTGNCACCTGAAGACAAGCTGCAATCTCAAAAGANGGTTAAAAACAAACCTCTAAGAAAGAAGNCTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTNNTNCCCTGTGAGANNAGCAGCAGNNNANAAACAGANNNAGTCAGAGNGAGANA
  5   1   2       bld Emb1                            IMAGE:3402229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGAGATGGGCGGATACATGCGGCTTTTAGCGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAANCCTTATGCAGNCGGTGTACCTTCCTTTATATTCCNTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCCAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTA
  5   1   2       bld Emb1                            IMAGE:3402231.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGAGATGGGCGGATACATGCGGCTTTTAGCGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCCAAAACGAACGGGGAGGTGGTTCATTGTGGGCATGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCA
  5   1   2       bld Emb4                   IMAGE:5571836-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGAGATGGGCGGATACATGCGGCTTTTAGCGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTGGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGG
  5   1   2       bld Ov1                    IMAGE:6317540-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGAGATGGGCGGATACATGCGGCTTTTAGCGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTATTACCCCTGTGAGAAAAAGCAGCAGGAAGAATAA
  5   1   2       bld Ov1                             IMAGE:6317540.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGATGGGCGGATACATGCGGCTTTTAGCGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCCAAGGCAGAAATCTCCAAATAGAAAACTTACCTGATTATTACCCTGTGAGAAGAAGCAGCCGGAAGAATAAAACAGAATTGAGTCCGAGGAGAAGAAGAGAATAGATGGACCTATTTCACACTGGCCAAGAAGAAAGGAATAAGAATGCACATGATTACTGGGAAAGGGCCAGGTGTAATTGCAACTCCGGAACTTCCAGCGAGGAAAGTTTGTTGCAAAA
  5   1   2       bld DMZ                                  xl251a12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGATGGGCGGATACATGCGGCTTTTAGCGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGTTATTTATACNGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCNCCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCANAGGTTGAGAAAAAGAAAATATTGTCNACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGANAGAAGACTCAAAGGCAGAAATCTCCAAATAGAANACTTACTGATTATTACCCTGTGAGA
  5   1   2      seed Ga15      in                       XL460i05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGGATACATGCGGCTTTTAGCGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTATTACCCTGTGAGAAGAAGCAGCAGGAAGAATAAAACAGAAATTGAGTCAGAGGAGAAGAAGAGAATAGATGAACTAATTCAGACTGGCAAAGAAGAAGGGATAAAGATGCACATGATTACTGGGAAAGGGCGAGGTGTAATTGCAACTCGGGGACTTCCA
  3   1   2       bld Ga18      in                       xlk59g06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGGATACATGCGGCTTTTAGCGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGTTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGNCCGNCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTNTCTGGGNACCNNCAA
  5   1   2       bld Ga18      in                       xlk59g06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGATACATGCGGCTTTTAGNGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGTTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGNAG
  3   1   2       bld Ga12      in                         XL165g03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGGAATTCGGCACGAGGCATGGGAAGAGTTCTGCAGATTCTCTGTTGAAACACCNTTTTCGGCTGCCCATGATGCTGCCCTTACAGAATGTGCTGTAATTCCTGACTGCACCTCCTGATTTTGCTTTATGTATTTCTACTTTATACAAAGATATACATACGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGTCGGTGGGCTCATTAAATATCCTCTTGACTCCAGGCAGCCGCTGCTCCCATGGGATTCAGCAAGATCAGATAAGCTTTCTAGCTGCAACTATATCGCATGGCAGCGAAGCCCTTTTCCATCTCTCTGGGGACTTTTGTGTAATCCAGGGGGTGTTAGGGGTAACTATGCCTCTGATTCAGACACTCAATAGTCACAGCCTGATCTCCATCCCTACAAACTCTTACTTTGTTAATGCCCCCTGTCCAACCTCGGTACTGGGCTAATAATGATTTCTATGCCATGACATTAGCAGGGCTGCCTGGTTATTTCATGAAAGCTCCATAGATATATTAGTAAGCTCATGTATGAGCAGTAAACAAGTTTAGGAGTGCTACACTGTTGGCTTATGTTTTCGATCATGACCATAAAGTGCTATTAGCCCTGACTTATTCTCATCTAATAGTACTGGAATTGTACATGGTGCCAAGGTTCACGTGCAGGTAATTGACTAGTACACCTATCATTTTCTTTGTCATGTCCATTGCTTCAAGGAAATAAAAA
  5   1   2       bld Ga18                               xlk55j17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATACATGCGGCTTTTAGNGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGNAAGNNG
  5   1   2       bld Ga12      in                         XL142f18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATACAACAAGGNCATCATGGGAAGAGTTCTGCAGATTCTCTGTTGAAACACCCTTTTCGGCTGCCCATGATGCTGCCCTTACAGAATGTGCTGTAATTCCTGACTGCACCTCCTGATTTTGCTTTATGTATTTCTACTTTATACAAAGATATACATACGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGTCGGTGGGCTCATTAAATATCCTCTTGACTCCAGGCAGCCGCTGCTCCCATGTGATTCAGCAAGATCAGATAAGCTTTCTAGCTGCAACTATATCGCATGGCAGCGAAGCCCTTTTCCATCTCTCTGGGGACTTTTGTGTTATCCAGGGGGTGTTAGGGGTAACTATGCCTCTGATTCAGACACTCAATAGTCACAGCCTGATCTCCATCCCTACAAACTCTTACTTTGTTAATGCCCCCTGTCCAACCTCAGTACTGGGCTAATAATGATTTCTATGACATTAGCAGGGCTGCCTGGTTATTTCATGAAAGCTCCATAGATATATTAGTAAGCTCATGTATGAGCAGTA
  5   1   2       bld Ga12      in                         XL197o13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGGCGGCTTTTAGCGTCTCTCTTTAAATGCGATTTGTAGGGCTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTATTACCCTGTGAGAAGAAGCAG
  3   1   2       bld Ga12                                 XL166g03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGCATGGNAAGAGTTCTGCAGATTCTCTGTTGAAACACCCTTTTCGGCTGCCCATGATGCTGCCCTTACAGAATGTGCTGTAATTCCTGACTGCACCTCCTGATTTTGCTTTATGTATTTCTACTTTATACAAAGATATACATACGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGTCGGTGGGCTCATTAAATATCCTCTTGACTCCAGGCAGCCGCTGCTCCCATGGGATTCAGCAAGATCAGATAAGCTTTCTAGCTGCAACTATATCGCATGGCAGCGAAGCCCTTTTCCATCTCTCTGGGGACTTTTGTGTAATCCAGGGGGTGTTAGGGGTAACTATGCCTCTGATTCAGACACTCAATAGTCACAGCCTGATCTCCATCCCTACAAACTCTTACTTTGTTAATGCCCCCTGTCCAACCTCGGTACTGGGCTAATAATGATTTCTATGCCATGACATTAGCAGGGCTGCCTGGTTATTTCATGAAAGCTCCATAGATATATTAGTAAGCTCATGTATGAGCAGTAAACAAGTTTAGGAGTGCTACACTGTTGGCTTATGTTTTCGATCATGACCATAAAGTGCTATTAGCCCTGACTTATTCTCATCTAATAGTACTGGAATTGTACATGGTGCCAAGGTTCACGTGCAGGTAATTGACTAGTACACCTATCATTTTCTTTGTCATGTCCATTGCTTCAAGGAAATAAAAAG
  5   1   2       bld Ga12      in                         XL165g03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCATGGGAAGAGTTCTGCAGATTCTCTGTTGAAACACCCTTTTCGGCTGCCCATGATGCTGCCCTTACAGAATGTGCTGTAATTCCTGACTGCACCTCCTGATTTTGCTTTATGTATTTCTACTTTATACAAAGATATACATACGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGTCGGTGGGCTCATTAAATATCCTCTTGACTCCAGGCAGCCGCTGCTCCCATGGGATTCAGCAAGATCAGATAAGCTTTCTAGCTGCAACTATATCGCATGGCAGCGAAGCCCTTTTCCATCTCTCTGGGGACTTTTGTGTAATCCAGGGGGTGTTAGGGGTAACTATGCCTCTGATTCAGACACTCAATAGTCACAGCCTGATCTCCATCCCTACAAACTCTTACTTTGTTAATGCCCCCTGTCCAACCTCGGTACTGGGCTAATAATGATTTCTATGCCATGACATTAGCAGGGCTGCCTGGTTATTTCATGAAAGCTCCATAGATATATTAGTAAGCTCATGTATGAGCAGTAAACAAGTTTAGGAGTGCTACACTGTTGGCTTATGTTTTCGATCATGACCA
  5   1   2       bld Neu7      in                         XL026o03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCAGATTCTCTGTTGAAACACCCTTTTCGGNTGCCCATGATGCTGCCCTTACAGAATGTGCTGTAATTCCTGACTGCACCTCCTGATTTTGCTTTATGTATTTCTACTTTATACAAAGATATACATACGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCaaaaaaagcagaggttgagaaaaagaaaaTATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTATTACCCTGTGAGAAGAAGCAGCAGGA
  5   1   2       bld Emb1                            IMAGE:6863148.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCCAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTATTACCCTGTGAGAAGAAGCAGCAGGAAGAATAAAACAGAAATTGAGTCNGAGGAGAAGAAGAGAATAGATGAACTAATTCAGACTGGCAAAGAAGAAGGGATAAAGATGCACATGATTACTGGGGAAAAGGCGAGGGTGTAATTGCAACTCGGGGACTTCCAGCGAAGGAAGAGTTTTGTTGGTAGAATACCCATGGGAGA
  5   1   2       bld Egg1                               PBX0044E01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGAGGTTTAAACCTTATGCAGCGGTGTACTTCCTTTATATTCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGTCGGTGGGCTCATTAAATATCCTCTTGACTCCAGGCAGCCGCTGCTCCCATGGGATTCAGCAAGATCAGATAAGCTTTCTAGCTGCAACTATATCGCATGGCAGCGAAGCCCTTTTCCATCTCTCTGGGGACTTTTGTGTAATCCAGGGGGTGTTAGGGGTAACTATGCCTCTGATTCAGACACTCAATAGTCGCAGCCTGATCTCCATCCCTACAAACTCTTACTTTGTTAATGCCCCCTGTCCAACCTCGGTACTGGGCTAATAATGATTTCTATGCCATGACATTAGCAGGGCTGCCTGGTTATTTCATGAAAGCTCCATAGATATATTAGTAAGCTCATGTATGAG
  3   1   2       bld Ga12                                 XL167e01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCGGCTGGCCCATGATGCTGCCCTTACAGAATGTGCTGTAATTCNTGACTGCACCTCCGTGATTTTGCTTTANGTATTTCTACTTTATACAAAGATATACATACGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGTCGGTGGGCTCATTAAATATCCTCTTGACTCCAGGCAGCCGCTGCTCCCATGGGATTCAGCAAGATCAGATAAGCTTTCTAGCTGCAACTATATCGCATGGCAGCGAAGCCCTTTTCCATCTCTCTGGGGACTTTTGTGTAATCCAGGGGGTGTTAGGGGTAACTATGCCTCTGATTCAGACACTCAATAGTCACAGCNTGATCTCCATCCCTACAAACTCTTACTTTGTTAATGCCCCCTGTCCAACCTCGGTANTGGGNTAATAATGATTTNTATGCCATGACATTAG
  3   1   2       bld Ga12      in                         XL142f18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCATGATGCTGCCCTTACAGAATGTGCTGTAATTCCTGACTGCACCTCCTGATTTTGCTTTATGTATTTCTACTTTATACAAAGATATACATACGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGTCGGTGGGCTCATTAAATATCCTCTTGACTCCAGGCAGCCGCTGCTCCCATGTGATTCAGCAAGATCAGATAAGCTTTCTAGCTGCAACTATATCGCATGGCAGCGAAGCCCTTTTCCATCTCTCTGGGGACTTTTGTGTTATCCAGGGGGTGTTAGGGGTAACTATGCCTCTGATTCAGACACTCAATAGTCACAGCCTGATCTCCATCCCTACAAACTCTTACTTTGTTAATGCCCCCTGTCCAACCTCAGTACTGGGCTAATAATGATTTCTATGACATTAGCAGGGCTGCCTGGTTATTTCATGAAAGCTCCATAGATATATTAGTAAGCTCATGTATGAGCAGTAAACAAGTTTAGGAGTGCTACACTGTTGGCTTATGTTTTCGATCATGACCATAAAGTGCTATTAGCCCTGACTTATTCTCATCTAATAGTACTGGAATTGTACATGGTGCCAAGGTTCACGTGCAGGTAATTGACTAGTACACCTATCATTTTCTTTGTCATGTCCATTGCTTCAAGCAAATAAAAAGTCTCTTCATTCCACCC
  5   1   2       bld Neu7                                 XL004c11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTTCTGCATTTTGCTATTTATACAGTTGGATTTCAGTTCGAACGGAGCTAATCATACAACAAGGCATCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTATTACCCTgtgagaagaagcagcaggaagaataaaacagaaattgagtcagaggagaagaagagaatagaTGAACTA
  3   1   2       bld Ga12                                 XL174l19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATGCTCCCATGGGATTCAGCAAGATCAGATAAGCTTTCTANNTGCAACATATATCGCATGCCATCGAAGCCCTTTTCCATCTCTCTGGGGACTTTTGTGTAATNCAGGGGGTGTTAGGGGTAANTATGCCTTTGATTCAGACACTCAATAGTCACAGCTTNATCTCCATCCCTACAAACTCTT
  3   1   2       bld Ga15                               XL509n04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAATCCAGGGGGTGTTAGGGGTAACTATGCCTCTGATTCAGACACTCAATAGTCACAGCCTGATCTCCATCCCTACAAACTCTTACTTTGTTAATGCCCCCTGTCCAACCTCAGTACTGGGCTAATAATGATTTCTATGCCATGACATTAGCAGGGCTGCCTGGTTATTTCATGAAAGCTCCATAGATATATTAGTAAGCTCATGTATGAGCAGTAAACAAGTTTAGGAGTGCTACACTGTTGGCTTATGTTTTCGATCATGACCATAAAGTGCTATTAGCCCTGACTTATTCTCATCTAATAGTACTGGAATTGTACATGGTGCCAAGGTTCACGTGCAGGTAATTGACTAGTACACCTATCATTTTCTTTGTCATGTCCATGCT
  5   1   2       bld Ga18      in                      xlk114k01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAAAAACAAACCTCTAAGAAAGAAGACTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTATTACCCTGTGAGAAGAAGCAGCAGGAAGAATAAAACAGAAATTGAGTCAGAGGAGAAGAAGAGAATAGATGAACTAATTCAGACTGGCAAAGAAGAAGGGATAAAGATGCACATGATTACTGGGAAAGGGCGAGGTGTAATTGCAACTCGGGACTTCCAGCGAGGAGAGTTTGTTGTAGAATACCATGGAGATCTGATAGAGATCACGGATGCCAAAAGGAGAGAAGCATCATATGCACAGGATTCAGCTACTGGCTGCTATATGTACTATTTTCAGTATTTGAACACAAGCTACTGCATCGATGCCACAAGAGAGACTGGCCGTTTAGGGAGGCTGATCAACCACAGCAAGTCTGGAAACTGTCACACCAAACTGCACAACATCAACAATGTACCTCACCTTATACTTGTTGCATNNNNGATATCAACGTTGGAGAGGAANTGCTGTATGACTATGGTGATAGAAGAAAATCTTCCATTGATGCACATCCTTGGCTTAAAAACTGACCTGCAGATGGACATGGCTGANTTTACAATATGACTTTGTGATCTGCTTCTGTNCTNGGTTTTTTAATTCCCTTTTACATTTAATATGAGTATGATATGGNTTTAAATGCATTATGTCTTTACCAAAAGTTTTATACCTAGTTTTGTATNTTTNNNTAGAGGTAATTNAGTGCTTNNAAAGCANGCT
  3   1   0       add Ga18      in                      xlk114k01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ANCAGCAGNNAGAATNAAACNNNNNTTGAGTNAGAGGNGAANANNNGNATAGNNGNNCTAATTCANNNTGGNNAAGAAGAAGGNNTAAAGATGCACATGATTNCTGGNAAAGGGCGANGTGTANTTGCAACTCGGGACTNNCAGCGNGGAGANNTGTTGTAGAATACCATGGAGATCTGATAGAGATCACGGATGCCAAAAGGAGAGAAGCNTCATATGCACAGGATTCAGCTACTGGCTGCTATATGTACTATTTTCAGTATTTGAACACAANNTACTGCATCGATGCCACAAGAGAGNCTGGCCGTTTAGGGAGGCTGATCAACCACAGCAAGTCTGGAAACTGTCACACCAAACTGCACAACATCAACAATGTACCTCACCTTATACTTGTTGCATCGCGGGATATCAACGTTGGAGAGGAATTGCTGTATGACTATGGTGATAGAAGAAAATCTTCCATTGATGCACATCCTTGGCTTAAAAACTGACCTGCAGATGGACATGGCTGATTTTACAATATGACTTTGTGATCTGCTTCTGTTCTGGTTTTTTAATTCCCTTTTACATTTAATATGAGTATGATATGGATTTAAATGCATTATGTCTTTACCAAAAGTTTTATACCTAGTTTTTGTATGTTTGCATAGAGGTAATTTAGTGCTTCCAAAGCATGCTGGTTTTTCCCTCTTTTAAATGTTTATGCATAGGAGCAGGAGAAAACTGGTTACATAATGTGTTCTAAATGTCTGATTGCAGATGAGTGAAAGGCTAATTCTTAAGTAGAAGTACATTTGGAACACTCACTAATATAACCAAAGTAAATGTAGGCTTGGAATTTANCCTTATACT
  5   1   0       add Ga12                                 XL207f20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCCAGCGCTAACATCAACAATGTACCTCACCTTATACTTGTTGCATCGCGGGATATCAACGTTGGAGAGGAATTGCTGTATGACTATGGTGATAGAAGAAAATCTTCCATTGATGCACATCCTTGGCTTAAAAACTGACCTGCAGATGGACATGGCTGATTTTACAATATGACTTTGTGATCTGCTTCTGTTCTGGTTTTTTAATTCCCTTTTACATTTAATATGAGTATGATATGGATTTAAATGCATTATGTCTTTACCAAAAGTTTTATACCTAGTTTTTGTATGTTTGCATAGAGGTAATGTAGTGCTTCCAAAGCATGCTGGTTTTTCCCTCTTTTAAATGTGTATGCATAGGAGCAGGAGAAAACTGGTTACATAATGTGTTCTAAATGTCTGATTGCAGATGAGTGAAAGGCTAATTCTTAAGTAGAAGTACATTTGGAACACTCACTAATATAACCAAAGTAAATGTAGGCTTGGAATTTATCCTTATACTTTTGTAAACAAAACATGAATTTCACGCAAGAAATTGAGCCAGTGTAAACCTTTAATTCTTGCTTTCTATATGTTTGCATCTGTTAGGGTTAAATAGTGTTCCCATCAGGGTGGTAACTACCTGCAGCATGCATTTGCCTTTACTATACACCAATCCTTGTTTGCA
  5   1   0       add Ga15      in                       XL429n14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAACTGACCTGCAGATGGACATGGCTGATTTTACAATATGACTTTGTGATCTGCTTCTGTTCTGGTTTTTTAATTCCCTTTTACATTTAATATGAGTATGATATGGATTTAAATGCATTATGTCTTTACCAAAAGTTTTATACCTAGTTTTTGTATGTTTGCATAGAGGTAATTTAGTGCTTCCAAAGCATGCTGGTTTTTCCCTCTTTTAAATGTGTATGCATAGGAGCAGGAGAAAACTGGTTACATAATGTGTTCTAAATGTCTGATTGCAGATGAGTGAAAGGCTAATTCTTAAGTAGAAGTACATTTGGAACACTCACTAATATAACCAAAGTAAATGTAGGCTTGAAATTTATCCTTATACTTTTGTAAACAAAACATGAATTTCACGCAAGAAATTGAGCCAGTGTAAACCTTTAATTCTTGCTTTCTATATGTTTGCATCTGTTAGGGTTAAATAGTGTTCCCATCAGGGTGGTAACTACCTGCAACATGCGTTTGCCTTTACTATACACCAATCCTTGTTTGCACCCATGCTTCCCAACATTCCATTACAAAGACACAGGACAAACTTCACTTGTGGATATTCTGGGATTTATAGTTTAGCCATATTTGGGAGCCACAAGTAGAAGATATATTTTTATAAGTAGGTCTGTCATTTAGAGAGACttttttttttATAATGNCTCTTGTTGTTAGGGGCAGTATATCAAGTGCTTTGTGATGGAAAT
  3   1   2       bld DMZ                                 rxl339m15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CNGNTTNNANTTNGNCCNGGGGGGGGGGGnnAAATTTTTGGGGGGTTTTTTTTTTTTTTTTTTTTTTTTTTCTAAAnAnTTTTTTTTATTCCnGTCTTTTTTTTTTTCAGTATAAAAAGATATATCATGATGTATTTTACACCTANTGCTTTAAAATTCTATAGCAATGATCTTACAGTAACAGCCAACATAAATTTGCAGCAAACCCATTGAGAATCCGTGCAGAGACAACATACATTTATTCTCATGTCAAGCCCTATTGTAAAATTTATNCTAAAAAGGGGTCTGCCCATGTGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATNTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTAGTTACACAATCATTTTTAAGTCCTTTC
  3   1   2       bld Ga15 5x3  out                      XL431a17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CNNNCCCCCCCNNTTTTTTTTTTTTTTTTTTTTTTTTTAGTAATAAAnATTTTTTTTTATTCCnCAGTCTTTTTTTTTTCAGTATAAAAAGATATATCATGATGTATTTTACACCTACTGCTTTAAAATTCTATAGCAATGATCTTACAGTAACAGCCAACATAAATTTGCAGCAAACCCATTGAGAATCCGTGCAGAGACAACATACATTTATTCTCATGTCAAGCCCTATTGTAAAATTTATACTAAATAGGGGTCTGCCCATGTGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATTTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTATTTACACAATCATTTTTAAGTTCCTTT
  3   1   2       bld Ga12      in                         XL197o13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GNCCCCCCCCCCCCCnnAAnTTTTTTTTTTTTCnTTTTTTCTTTTTTTTTAnTTTTTTTCTAGTCTTTTTTTTTTTCAGTATAAAAAGATATATCATGATGTATTTTACACCTACTGCTTTAAAATTCTATAGCAATGATCTTACAGTAACAGCCAACATAAATTTGCAGCAAACCCATTGAGAATCCGTGCAGAGACAACATACATTTATTCTCATGTCAAGCCCTATTGTAAAATTTATACTAAAAAGGGGTCTGCCCATGTGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATTTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTATTTACACAATCATTTTTAAGTTCCTTTTCACATCTATCCCCTTCAAAACAGAGGAGAGG
  3   1   2       bld Ga15                               XL430a17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGNCCCCCCCTTTTTTTTTTTTTTTTTTTTTTTTTAGTAATAAATATTTTTTTTTATTCCnCAGTCTTTTTTTTTTCAGTATAAAAAGATATATCATGATGTATTTTACACCTACTGCTTTAAAATTCTATAGCAATGATCTTACAGTAACAGCCAACATAAATTTGCAGCAAACCCATTGAGAATCCGTGCAGAGACAACATACATTTATTCTCATGTCAAGCCCTATTGTAAAATTTATACTAAATAGGGGTCTGCCCATGTGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATTTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTATTTACACAATCATTTTTAAGTTCCTTTTCACAT
  3   1   2       add DMZ                                 rxl334e16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGNTTTTTTTTTTTTTTnnGGGGGGGGCTTTTTnnCTTnTTTTTTTTTTTTTTTTTTTTTCAGCATAAAAAGATATATCATGATGTATTTTACACCTACTGCTNTAAAATTCTATAGCAATGATCTTACAGTAACAGNCAACATAAATTTGCAGCAAACCCATTGAGAATCCGTGCAGAGACAACATACATTNATTCTCATGTCAAGCCCTATTGTNAAATGTNTACTAAAAANGGGTCNGCCCATGTGNTACTGTTACTTNAGCACCAGCCCACAGAAGTTTATNATNTAGAAATGTGGCTTCAATAACTAAACCGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTATTTACACAATCATTTTTAAGTTCCTTTTCACA
  5  -1   2       bld Ga15                               XL424d02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ttttttttttagtaataaatatttttttttattccncagtcttttttttttCAGTATAAAAAGATATATCATGATGTATTTTACACCTACTGCTTTAAAATTCTATAGCAATGATCTTACAGTAACAGCCAACATAAATTTGCAGCAAACCCATTGAGAATCCGTGCAGAGACAACATACATTTATTCTCATGTCAAGCCCTATTGTAAAATTTATACTAAATAGGGGTCTGCCCATGTGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATTTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGG
  3   1   2      seed Ga15      in                       XL429n14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGNTTTNGNGGGTNGGGNGGCCCTGNGGCCNCCCCTTTTTTTTTTTTTTCAGTATAAAAAGATATATCATGATGTATTTTACACCTACTGCTTTAAAATTCTATAGCAATGATCTTACAGTAACAGCCAACATAAATTTGCAGCAAACCCATTGAGAATCCGTGCAGAGACAACATACATTTATTCTCATGTCAAGCCCTATTGTAAAATTTATACTAAAAAGGGGTCTGCCCATGTGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATTTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTATTTACACAATCATTTTTAAGTTCCTTTTCACATC
  3  -1   2       bld Li1                             IMAGE:3398613.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGTAATAAATATTTTTTTTTATTCCACAGTCTTTTTTTTTCAGTATAAAAAGATATATCATGATGTATTTTACACCTACTGCTTTAAAATTCTATAGCAATGATCTTACAGTAACAGCCAACATAAATTTGCAGCAAACCCATTGAGAATCCGTGCAGAGACAACATACATTTATTCTCATGTCAAGCCCTATTGTAAAATTTATACTAAAAAGGGGTCTGCCCATGTGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATTTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTATTTACACAATCATTTTTAAGTTCCTTTTCACATCTATCCCCTTCAAAACAGAGGAGAGGTCAGCTGCTGGTAAAAAAAAAAAAAAACACGATTTCCATCACAAAGCACTTGATATACTGCCCCTAACAACAAGAGACATTATAAAA
  3   1   2       bld DMZ                                 rxl331e16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTTTTTTTTTTTTTTTTTTTCAGNATAAAAAGATATATCATGATGTATNTTACACCTACTGCTNTAAAATTCTATAGCAATGATCTTACAGTAACAGNCAACATAAATTTGCAGCAAACCCATTGAGAATCCGNGCAGAGACAACATACATTTATTCTCATGTCAAGCCCTATTGTAAAATTTATACTAAAAAGGGGTCTGCCCATGTGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATTTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTATTTACACAATCATTT
  3   1   2       add DMZ                                 rxl314e16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTTTTTTTTTTTTTTTCAGCATAAAAAGATATATCATGATGTATNNTACACCTACTGCTGTAAAATTCTATAGCAATGATCNTNCAGTNACAGNCAACATNAATTNGCAGNNAACCCATTGNGAATCCGNGCAGAGACAACATACANTNATTCTCATGTCAAGCCCTATTGTNNAANGTNTACTANAAANGGGTCNGCCCATGTGNTACTGTTACTTNAGCACCAGCCCACAGAAGTTTATNATNTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTATTTACACAATCATTTTTAAGT
  3  -1   2       add Neu7      in                         XL026o03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGTATTTTACNCGCTACTGCTTTAAAATTCTATAGCAANGATGCTTACAGTAGNCAGCCAACATAAATTTGCNGCAAACCCATTGNGAATCCGNGCAGNGNCANCATACATTTATTCTCATGTCANGCCCTATTGTAAAATTTATACTAAAANGGGGTCTGCCCATGTGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATTTAAAATGNGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTNTATTTACACAATCATTTTTAAGTTCCTTTTCACATCTATCCCCTTCAAAACAGAGGANAGGTCAGCTGCTGGTAAAAAAAAAAAACNNTTTTTCCNTC
  3  -1   2       bld Ga15      in                       XL460i05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGTATTTTACACCTACTGCTTTAAAATTCTATAGCAATGATCTTACAGTAACAGCCAACATAAATTTGCAGCAAACCCATTGAGAATCCGTGCAGAGACAACATACATTTATTCTCATGTCAAGCCCTATTGTAAAATTTATACTAAAAAGGGGTCTGCCCATGTTACTGTTACTTAAGCACCAGCCCACAGAAGTTTATTATTTAAAATGTGGCTTCAATAACTAAACGTGGGGGAACAAATGGAAGCTTAATATGGCATTTTTCCTCTATTTACACAATCATTTTTAAGTTCCTTTTCACATCTATCCCCTTCAAAACAGAGGAGAGGTCAGCTGCTGGTAAAAAAAAAAAAACNCTNTTTCCNTCCCAANGCNCTNGATNTNCNGCCCCTANCAACAANANACTTTNTAAAAAAAAANGNNNCNCTAANGGNCNNNCCNNNTTNNAAAAANNTNNCTNCNNNTNGGGGCCCCCAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)