Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl241o03.3                           20 END     2           3       10                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl241o03.3                           20 PI      79       1796     2136                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012838013 Xl3.1-IMAGE:6318773.5.5 - 51 ESTs
                                                                       .....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6318773.5.5                          GGGCCGCCTCCTTCCTGACATCATCAGCTGCTGCCCCCTCCCTGACATCATCAGCTGCTGCCCAAGTTCTACTCCGTGCAGCTGCAGCTACAGACAGGAATAAGTTCTTTTTTTTAAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTATGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTACACGGTGGCCTCTCCCCTGACATAAAAACTCTGGACCAGATAAGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTCGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTGATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTCACTGTGTGGTCAGCTCCCAACTATTGCTACCGTTGTGGCAACATCGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTAGAGCTGTTCCTGACTCTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTTCTCTGAAGTCCATTCACTTCTTGTGTTCTGTGCTGGGTCTTTTTTTCATTTTATTTTAAGCACTTTGCTGCTGAAATGCTGAATATTGCCTTTTTTTCTTTTGAATTCTAGAATATATATTCTGTTTATATCTCTGTTTCTTTGCTTAGGGGTTCTTTTTCTTTGTACTGACAAAGAAGATTAACAACAAAGATGAAAAAAATGATTCACACCACATCAGCCAGAGTTGTAGGAGGGGTTAAATATTTTTGCAGTAAAATTAGGAATCCTTTAAGATGGCCATACACAAGTAGATCTGCTTGTTTGGCGAGGTTGCCAAATGAGTTGATCTTTCCCTGAATACGTAGAGCAGGGCCAAATTGGGCTTGTCTGATTGTTGGTCCATAGGCCAAAGATCAGATCTTCATGCAGAACTAGGCACATAAGATGTTGACCCAATGTGTAGGGAACAAGTTGTCCTCTTTTATCAACCTGTGCATGGCAAGCTTTGGTTTATAGCATGGCAATAAAGTGTTTACTGTTGAACATAGATGGAATATAGAGGAAAATATCACATGGATTTTAAATCCCCCTAAATTGGATATTTTAAAGAATCCTGAAAGGTTTAACCTGGTTCCTAATGGTATTGTAAATGGCGAACCGTGTGACTAGAGACTTCGTATCTTGGAATACTAACTCTACCACAAAGTACAAACAACATTGTGTTTATATGTGTGGTGGCTGTGCTCTCTTGTTAGTGGGGCACCATAATAGTGCTCTGCTGCCCATCACAGACGTGCTGGAATTTCTGCCTCCACAAGGTTAGTTTAGACTTTAAAGTGAAGCTTTTATTAACATTAAGGCGAGTAGACCCTTCCCAAACCCCTTTGTGGAGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGGGCGTTTGGCTCTGCAATGCCCCCCCATAATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCACATAGAAGTTAAATATAATAGAAATAAAGAAAGTTAGTCTTTAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012721894                                CCTCCTTCCTGACATCATCAGCTGCTGCCCCCTCCCTGACATCATCAGCTGCTGCCCAAGTTCTACTCCGTGCAGCTGCAGCTACAGACAxxxxTxxxTxxTTTTTTTTAAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTACGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTGCACGGTGGxCTxTCCCCxGACATAAAAACTCTGGACCAGATAAGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTCGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTGATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTCACTGTGTGGTCAGCTCCCAACTATTGCTACCGTTGTGGCAACATCGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTAGAGCTGTTCCTGACTCTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTTCTCTGAAGTCCATTCACTTCTTGTGTTCTGTGCTGGGTCTTTTTTTCATTTTATTTTAAGCACTTTGCTGCTGAAATGCTGAATATTGCCTTTTTTTCTTTTGAATTATAGAATATATATTCTGTTTATATCTCTGTTTCTTTGCTTAGGGGTTCTTTTTCTTTGTACTGACAAAGAAGATTAACAACAAAGATGAAAAAAATGATTCACACCACATCAGCCAGAGTTGTAGGAGGGGTTAAATATTTTTGCAGTAAAATTAGGAATCCTTTAAGATGGCCATACACAAGTAGATCTGCTTGTTTGGCGAGGTTGCCAAATGAGTTGATCTTTCCCTGAATACGTAGAGCAGGGCCAAATTGGGCTTGTCTGATTGTTGGTCCATAGGCCAAAGATCAGATCTTCATGCAGAACTAGGCACATAAGATGTTGACCCAATGTGTAGGGAACAAGTTGTCCTCTTTTATCAACCTGTGCATGGCAAGCTTTGGTTTATAGCATGGCAATAAAGTGTTTACTGTTGAACATAGATGGAATATAGAGGAAAATATCACATGGATTTTAAATCCCCCTAAATTGGATATTTTAAAGAATCCTGAAAGGTTTAACCTGGTTCCTAATGGTATTGTAAATGGCGAACCGTGTGACTAGAGACTTCGTATCTTGGAATACTAACTCTACCACAAAGTACAAACAACATTGTGTTTATATGTGTGGTGGCTGTGCTCTCTTGTTAGTGGGGCACCATAATAGTGCTCTGCTGCCCATCACAGACGTGCTGGAATTTCTGCCTCCACAAGGTTAGTTTAGACTTTAAAGTGAAGCTTTTATTAACATTAAGGCGAGTAGACCCTTCCCAAACCCCTTTGTGGAGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGGGCGTTTGGCTCTGCAATGCCCCCCCATAATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCACATAGAAGTTAAATATAATAGAAATAAAGAAAGTTAGTCTTTAAAAAA
                                                      consensus depths                               2     4     3     5     3     6     3     6     3     7     3     8     3     9     3    11     3    11     7    11     7    11     7    11     8    12    10    14    10    14    10    14    10    16    10    16    10    16    10    16    10    17    10    17    11    19    14    19    20    22    15    21    20    21    21    21    21    21    21    21    21    21    22    22    21    22    21    22    21    22    21    22    21    22    21    22    20    21    20    21    20    21    19    21    20    21    18    20    19    20    20    21    18    21    18    20    18    20    16    19    15    18    16    18    15    17    14    17    14    18    14    18    10    18    15    18    15    19    15    19    15    19    16    22    16    21    17    22    17    22    15    21    15    20    14    20    11    17    12    17    12    16    12    16    12    16    12    15    12    14    12    13    12    13    10    13    10    13    10    13    10    13    10    13     9    12     9    11     9    11     9    11     9    11     9    11     8    10     8    10     8    10     8     9     8    10     9    10     9    10     9    10     8    10     8    10     9    10     8    10     8     9     6     9     4    10     4    10     4    10     6    11     6    10     5    10     5     9     3     7     3     7     3     7     2     7     2     7     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     5     4     6     4     5     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     2     2     3     3     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     7     8     7     8     7     8     6     7     6     7     8    10    10    10    10    10    10    10    11    11    11    11    12    12    12    12    12    12    13    14    13    14    12    14    12    14    13    14    13    14    13    14    11    14    13    14    12    14    12    14    11    14    11    14    11    13    11    12    11    12    10    12     9    11     7    11     5     7     5     7     5     5     2     3
  5   1   2      ests                            Xl3.1-IMAGE:6318773.5                          GGGCCGCCTCCTTCCTGACATCATCAGCTGCTGCCCCCTCCCTGACATCATCAGCTGCTGCCCAAGTTCTACTCCGTGCAGCTGCAGCTACAGACAGGAATAAGTTCTTTTTTTTAAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTATGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTACACGGTGGCCTCTCCCCTGACATAAAAACTCTGGACCAGATAAGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTCGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTGATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTCACTGTGTGGTCAGCTCCCAACTATTGCTACCGTTGTGGCAACATCGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTAGAGCTGTTCCTGACTCTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTTCTCTGAAGTCCATTCACTTCTTGTGTTCTGTGCTGGGTCTTTTTTTCATTTTATTTTAAGCACTTTGCTGCTGAAATGCTGAATATTGCCTTTTTTT
  5   1   2      ests                                 Xl3.1-xl265d09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTTAAGCACTTTGCTGCTGAAATGCTGAATCTTGCCTTTTTTTCTTTTGAATTCTAGAATATATATTCTGTTTATATCTCTGTTTCTTTGCTTAGGGGTTCTTTTTCTTTGTACTGACAAAGAAGATTAACAACAAAGATGAAAAAAATGATTCACACCACATCAGCCAGAGTTGTAGGAGGGGTTAAATATTTTTGCAGTAAAATTAGGAATCCTTTAAGATGGCCATACACAAGTAGATCTGCTTGTTTGGCGAGGTTGCCAAATGAGTTGATCTTTCCCTGAATACGTAGAGCAGGGCCAAATTGGGCTTGTCTGATTGTTGGTCCATAGGCCAAAGATCAGATCTTCATGCAGAACTAGGCACATAAGATGTTGACCCAATGTGTAGGGAACAAGTTGTCCTCTTTTATCAACCTGTGCATGGCAAGCTTTGGTTTATAGCATGGCAATAAAGTGTTTACTGTTGAACATAGATGGAATATAGAGGAAAATATCACATGGATTTTAAATCCCCCTAAATTGGATATTTTAAAGAATCCTGAAAGGTTTAACCTGGTTCCTAATGGTATTGTAAATGGCGAACCGTGTGACTAGAGACTTCGTATCTTGGAATACTAACTCTACCACAAAGTACAAACAACATTGTGTTTATATGTGTGGTGGCTGTGCTCTCTTGTTAGTGGGGCACCATAATAGTGCTCTGCTGCCCATCACAGACGTGCTGGAATTTCTGCCTCCACAAGGTTAGTTTAGACTTTAAAGTGAAGCTTTTATTAACATTAAGGCGAGTAGACCCTTCCCAAACCCCTTTGTGGAGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGGGCGTTTGGCTCTGCAATGCCCCCCCATAATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCACATAGAAGTTAAATATAATAGAAATAAAGAAAGTTAGTCTTTAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                              GAGCCTGGAGGG
                                                                   VAR                                                                                                                          CTGCTCTTTTTT
                                                                   VAR                                                                                                                                      CCCAGCAGCCATCCTACTCGACCTGTGCCTTCTCTCTGGATTTTCTCCGATCCTCTGCAACCAGGGGATCGGCCGCCATTACGGAAGACCAGACTTACTGCAGCCTGCACAGCACTCTCGGTGTCTGTGACGTTGCAAGAGTAGGAGGGGCTGACTAGGGTCCCATCT
                                                                   SNP                                                                                                                                                                                                                                                                                                              ---CA-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                      -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                              -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                              --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----A-----C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C--C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                               BLH ATG     299    1527                          
                                               BLH MIN     260     318                          
                                               BLH MPR      53     318                          
                                               BLH OVR     299     394                          
                                               ORF LNG     299      26                          
  5   1   2      ests                            Xl3.1-IMAGE:6318773.5                          GGGCCGCCTCCTTCCTGACATCATCAGCTGCTGCCCCCTCCCTGACATCATCAGCTGCTGCCCAAGTTCTACTCCGTGCAGCTGCAGCTACAGACAGGAATAAGTTCTTTTTTTTAAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTATGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTACACGGTGGCCTCTCCCCTGACATAAAAACTCTGGACCAGATAAGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTCGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTGATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTCACTGTGTGGTCAGCTCCCAACTATTGCTACCGTTGTGGCAACATCGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTAGAGCTGTTCCTGACTCTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTTCTCTGAAGTCCATTCACTTCTTGTGTTCTGTGCTGGGTCTTTTTTTCATTTTATTTTAAGCACTTTGCTGCTGAAATGCTGAATATTGCCTTTTTTT
                                                  Xl3.1-CHK-1012687804                                CCTCCTTCCTGACATCATCAGCTGCTGCCCCCTCCCTGACATCATCAGCTGCTGCCCAAGTTCTACTCCGTGCAGCTGCAGCTACAGACAxxxxTxxxTxxTTTTTTTTAAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTACGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTGCACGGTGGxCTxTCCCCxGACATAAAAACTCTGGACCAGATAAGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTCGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTGATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTCACTGTGTGGTCAGCTCCCAACTATTGCTACCGTTGTGGCAACATCGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTAGAGCTGTTCCTGACTCTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTTCTCTGAAGTCCATTCACTTCTTGTGTTCTGTGCTGGGTCTTTTTTTCATTTTATTTTAAGCACTTTGCTGCTGAAATGCTGAATATTGCCT
  5   1   2       bld Oo1  5g                         IMAGE:6641679.5p GCATGGGGAGGAGACTGAGGAGACGGGGCCGCCTCCTTCCTGACATCATCAGCTGCTGCCCCCTCCCTGACATCATCAGCTGCTGCCCAAGTTCTACTCCGTGCAGCTGCAGCTACAGACACTGCTCtttttttttttttAAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAAGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGCTGATACTTTGCTGCTCAAAATGGCACCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAANAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGGAACATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTACGATGAGTGCCAGACCAAATATGGGAATGCAAATGGCTTGGAGATACTGCACAAAGTTTTTTGATATGCTGACTGTAACAGCTTTTGATAGATGAACAAGATACTCTGTGGTACCCCGTTGGGTCTTTTCCCCAAGACCATAAAAACCTCTGGGACCCAGAATAAGGGACGAATTGGAACCGGGAATCCAGAAGAATTTCC
  5   1   2       bld Ga15      in                       XL410a15ex.5p  CAGGGGAGGAGACTGAGGAGACAGGGGCCGCCTCCTTCCTGACATCATCAGCTGCTGCCCCCTCCCTGACATCATCAGCTGCTGCCCAAGTTCTACTCCGTGCAGCTGCAGCTACAGACACTGCTCtttttttttttttAANC
  5   1   2       bld Ga15 5g                            XL442l04ex.5p           CCAAGCTCTGCTCCGTGCAGCTTGAACTACAGGCACAGCTCTATTGTTTTTAGCTACTAGGAGACGGGCTGAGGCGGGAGTGTCAGAAAGGGCGGGACAGAGCCTGGAGGGGGAATAAGTTCTCCCAGCAGCCATCCTACTCGACCTGTGCCTTCTCTCTGGATTTTCTCCGATCCTCTGCAACCAGGGGATCGGCCGCCATTACGGAAGACCAGACTTACTGCAGCCTGCACAGCACTCTCGGTGTCTGTGACGTTGCAAGAGTAGGAGGGGCTGACTAGGGTCCCATCTTAGCAGATACTTTGCTGCTCAAAATGGCGCCGCTGGACCTGGATAAATATGTGGAGATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGAGGCTATGTGATTATGTCTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCAGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTTAGAACTGGTGGGCAAGTTCCTGACACAAATTACATCTTCATGGGTGACTTTGTTGATACAGGATATTACAGTCTTGAGACATTCACCTTCCTTCTTGCCCTG
  5   1   2       bld Ov1  5g                         IMAGE:8331151.5p                  GGTTCNGCCCAAGTTGGTCTANNGGCNNGNTGNNCTGGGAATTGACCACACCCCCATCTACGAATCGTGCTAATAATGAACTCGTATCTAATTGAGGGGGACTCTGACGGTGGTTCTGCCAAACAAGGTCGTGACCACAAGTTCCATGCTATTCTACCTCTTCCTGTTAACGTTGTCAATACAATCAACGGCAATATGGGAGAAATCCTCATAAATGAACACATCAATACCATGATTTATACCATTACTGCGCGTGATGAAACAGACTGACTAGGGTCCCATCTTAGCAGATACTTTGCTGCTCAAAATGGCGCCGCTGGACCTGGATAAATATGTGGAGATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGAGGCTATGTGATTATGTCTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCAGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTTAGAACTGGTGGGCAAGTTCCTGACACAAATTACATCTTCATGGGTGACTTTGTTGATAGAGGATATTACAGTCTTGAGACATTCACCTTCCTTCTTGCCCTGAAAGCCAAATGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGACAGATTCACCAGGTGTATGGATTCTACGACCAGTGCCAGACAAAATATGGAAATGCCAATGCTTGGAGATACTGCACAAAGGTTTCCGATATGGCTGACTG
  5   1   2       bld Oo1  5g                         IMAGE:5078279.5p                               GCCTCCTTCCTGACATCATCAGCTGCTGCCCCCTCCCTGACATCATCAGCTGCTGCCCAAGTTCTACTCCGTGCAGCTGCAGCTACAGACACTGCTCtttttttttttttAAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAAGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGCTGATACTTTGCTGCTCAAAATGGCACCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGAT
  5   1   2       bld Tbd7 5g3  out                        XL074l08.5p                                       GNAGGCACAGCTCTATTGTTTTTAGCTACTAGGAGACGGGCTGAGGCGGGAGTGTCAGAAAGGGCGGGACAGAGCCTGGAGGGGGAATAAGTTCTCCCAGCAGCCATCCTACTCGACCTGTGCCTTCTCTCTGGATTTTCTCCGATCCTCTGCAACCAGGGGATCGGCCGCCATTACGGAAGACCAGACTTACTGCAGCCTGCACAGCACTCTCGGTGTCTGTGACGTTGCAAGAGTAGGAGGGGCTGACTAGGGTCCCATCTTAGCANATACTTTGCTGNTCAAAATGGCNCCGG
  5   1   2       bld Ooc1 5g                          Ooc1-db28e06.y1                                                                         GTGTCGACCCACGCGTCCGCAAGTTCTACTCCGTGCAGCTGCAGCTACAGACACTGCTCtttttttttAAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAGACTACATCTTCATGGGTGACTATGTTGATAGATGGTATTATAGT
  5   1   2       bld Ga18 5g                           xlk153p01ex.5p                                                                                CTGNGNNNGAGTGTCAGAAAGGGCGGGANAGAGCCTGGAGGGGGAATAAGTTCTCCCAGCAGCCATCCTACTCGACCTGTGCCTTCTCTCTGGATTTTCTCCGATCCTCTGCAACCAGGGGATCGGCCGCCATTACGGAAGACCAGACTTACTGCAGCCTGCACAGCACTCTCGGTGTCTGTGACGTTGCAAGAGTAGGAGGGGCTGACTAGGGTCCCATCTTAGCAGATACTTTGCTGCTCAAAATGGCGCCNNTGGACCTGGATAAATATGTGGAGATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGAGGCTATGTGATTATGTCTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCAGTATCTACGCCAGNAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTTAGAACTGGTGGGCAAGTTCCTGACACAAATTACATCTTCATGGGTGACTTTGTTGATAGAGGATATTACAGTCTTGAGACATTCACCTTCCTTCTTGCCCTGAAAGCCAAATGGNCTGACCGTATTACCTTGCTGCGAGGGANNCATGAAAGCAGACAGATCACACAGGNGTATGGNNTCTACGACGAGTGCCAGACAAAATATGGAAATGCCAATGCTTGGAGATACTGCACAAAGGTTTTCGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTGCNCGGTGGCCTCTCCCCTGACNNAAAAACTCTGGACCAG
  5   1   2       bld Gas4 5g3  in                    IMAGE:3421529.5p                                                                                       CCTGTGCAGTTCTACTCCGTGCAGCTGCAGCTACAGACACTGCTCtttttttttAAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGNTTTACGATCTATGTGAGCTCTTCAGAACTGGNGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGGCCTGGGACATTCACCTTCCTTTTTGCCCTAAAAGCCAAGTGG
  5   1   2       chi Emb1 5x                         IMAGE:6865705.5p                                                                                                     CTCCGTGCAGCTGCAGCTACAGACACTGCTCtttttttttAAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGANAATGACCTGAAGCGGCTATGTGATTATGTTTGGGGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAAGGTATTATAGTCCTGAGAACTTCCACCTTTCCTCTTGGCCTAAAAACCCAAGTGGCCTGAACCGGATTTACCCTGGGTGCCAGGGGAACCCTGGAAAAGCGGGCCGATTCCACCCGGGGGGATGGGGATTCTAccaaaggaagtggcccaaccaaaaaatgggaaatggccaaatggttggggaaaaaaCTGGGCCCAAAGGGTTTTTTGGAAATGGCCGAACCGGTGTAACAAACttttttttttGGTGGGAAACCGTATTATCCTTTTGGGGTAACACgggggggggtttttttccccccaaaaaaataaaaaaaaaTCTTGTGGGGCCCCCAATATAAGGGGGGCCTATTTTTTGTCCGCCGAAAACCAAAGAGAAAATTTTCCCCCCCACAAAGAGGAGGACACttttttttGGGAGAACCCTCGGTGGGG
  5   1   2       bld Em10 5g                         IMAGE:7982414.5p                                                                                                              GCAGCTACAGACACTGCTCtttttttttttttAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTATGATGAGTGCCAGACAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAACACCTTTTATAGATAAACAGAACTTTGTGTACCCGGTGGTCTTTCCCCAAACATAAACTCTTGACCAATAAGGACATTGGACGGAATCAAGAAATTCA
  5   1   2       bld Oo1  5g3  in                    IMAGE:5078593.5p                                                                                                                              CTGCTCtttttttttAAGCTTGTGGGAGACTCGTGAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACA
  5   1   2       bld Ga12 5g3  in                         XL210b01.5p                                                                                                                                                                GAAGGGTGGGACAGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGCTGATACTTTGCTGCTCAAAATGGCACCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTACGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTACACGGTGGTCTTTCCCCAGACATAAAAACTCTGGA
  5   1   2       bld Ov1  5g                         IMAGE:6318773.5p                                                                                                                                                                            AGAGACTGTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTATGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTACACGGTGGTCTTTCCCCAGACATAAAAACTCTGGACCAGATAAGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTCGATACTTGGGCCATCAGCCCTCGAGGGCGCAGGGTGGTTGNTTTGGAGCCAAGGNTGACCAATGAGTTTTGTGCATAATCACAATCTGAAGCTAATTTTGCAGAGCGCACCACGTTAGTACATGAGGGGCTACAAAATCCATGTTTTGATTGAAAAGCTTGGTGGACTGTGGGTGGTCGGGCTCCCAACC
  5   1   2       bld DMZ  5g3  in                         xl265d09.5p                                                                                                                                                                                   GTTTAGATGCACTCCAGGAGCCCCTGACTTTGAACGAGGAGGAGGCTAAATTAACCACAAAGAACATAACCAGAAAGTGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTATGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTACACGGTGGTCTTTCCCCAG
  5   1   2       bld Te1  5g                         IMAGE:6928588.5p                                                                                                                                                                                                               GGCCATTACGGAAGACCAGACTTACTGCAGCCTGCACAGCACTCTCGGTGTCTGTGACGTTGCAAGAGTAGGAGGGGCTGACTAGGGTCCCATCTTAGCAGATACTTTGCTGCTCAAAATGGCGCCGCTGGACCTGGATAAATATGTGGAGATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGAGGCTATGTGATTATGTCTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCAGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTTAGAACTGGTGGGCAAGTTCCTGACACAAATTACATCTTCATGGGTGACTTTGTTGATAGAGGATATTACAGTCTTGAGACATTCACCTTCCTTCTTGCCCTGAAAGCCAAATGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGACAGATCACACAGGTGTATGGATTCTACGACGAGTGCCAGACAAAATATGGAAATGCCAATGCTTGGAGATACTGCCAAAAGGTTTTCGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTGCACGGTGGCCTCTCCCCTGACATAAAAACTCTGGACCAAATACGGACAATTTGAACGGAATTCAAAAAATTCCCCCCAAAGGGACCTTTTTTGGGATCTTGTTTGGGGCCGAACCCAA
  5   1   2       bld Neu7 5g3  in                         XL008g10.5p                                                                                                                                                                                                                 CATTACGGAAGACCAGNACTTACTGCAGCCTGCACAGCACTCTCGGTGTCTGTGACGTTGCAAGAGTAGGAGGGGCTGACTAGGGTCCCATCTTAGCAGATACTTTGCTGCTCAAAATGGCGCCGCTGGACCTGGATAAATATGTGGAGATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGAGGCTATGTGATTATGTCTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCAGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTTAGAACTGGTGGGCAAGTTCCTGACACAAATTACATCTTCATGGGTGACTTTGTTGATAGAGGATATTACAGTCTTGAGACATTCACCTTCCTTCTTGCCCTGAAAGCCAAATGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGACAGATCACACAGGTGTATGGATTCTACGACGAGTGCCAGACAAAATATGGAAATGCCAATGCTTGGAGATACTGCACAAAGGTTTTCGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTGCACG
  5   1   2       bld Tbd7 5g3  in                         XL079p14.5p                                                                                                                                                                                                                                                                 TGAGGAAGGCAAGGCATCTGAATATTTTGCCCTGTGCCTTCCTCCTAGCTGATACTTTGCTGCTCAAAATGGCACCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTACGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTACACGGTGGTCTTTCCC
  5   1   2       bld Tad1 5g                         IMAGE:6937461.5p                                                                                                                                                                                                                                                                                            GGCCTGTGCCTTCCATCCTAGTTGATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAAACATTCACCTTCCCTTCTTGCCCCAAAAAGCCCAAGTGGCCCTGACCGAAATAACCTTGCCTGCCAAGGGGAACCCATGAAAACCCGGGCCAAATTCCCCCCCGGGGGGAATGGGATTTTCCTTGAATgaaaagggcccaaaacaaaaaatttggaaaaaggcccaaatgcgtttgggaaaaaaaaccggccccaaaagggtttttttgaaaaaagcccccaacccgggtaacccacccttttttgttttaaaaGGGGGAAAACAGGATATCCCTCTCCCGTTGGTTAAACACCgggggggggggtttttttttCTCCCCC
  5   1   2       bld Ga12 5g                              XL156b20.5p                                                                                                                                                                                                                                                                                            GCTGACTGGGTCCCATCTTAGCAGATACTTTGCTGCTCAAAATGGCGCCGCTGGACCTGGATAAATATGTGGAGATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGAGGCTATGTGATTATGTCTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCAGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTTAGAACTGGTGGGCAAGTTCCTGACACAAATTACATCTTCATGGGTGACTTTGTTGATAGAGGATATTACAGTCTTGAGACATTCACCTTCCTTCTTGCCCTGAAAGCCAAATGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGACAGATCACACAGGTGTATGGATTCTACGACGAGTGCCAGACAAAATATGGAAATGCCAATGCTTGGAGATACTGCACAAAGGTTTTCGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTGCACGGTGGCCTCTCCCCTGACATAAAAACTCTGGAC
  5   1   2       bld Sp1  5g                         IMAGE:5506344.5p                                                                                                                                                                                                                                                                                                                   CCCACGCGTCCGCTCAAAATGGCGCCGCTGGACCTGGATAAATATGTGGAGATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGAGGCTATGTGATTATGTCTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCAGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTTAGAACTGGTGGGCAAGTTCCTGACACAAATTACATCTTCATGGGTGACTTTGTTGATAGAGGATATTACAGTCTTGAGACATTCACCTTCCTTCTTGCCCTGAAAGCCAAATGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGACAGATCACACAGGTGTATGGATTCTACGACGAGTGCCAGACAAAATATGGAAATGCCAATGCTTGGAGATACTGCACAAAGGTTTTCGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTGCACGGTGGCCTCTCCCCTGACATAAAAACTCTGGACCAGATACGGACAATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTGGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTGA
  5   1   2      seed Ga15 5g3  in                       XL517b12ex.5p                                                                                                                                                                                                                                                                                                                    ATACTTTGCTGCTCAAAATGGCGCCACTGGACCTGGATAAATATGTGGAAATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTACGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTACACGGTGGTCTTTCCCCAGACATAAAAACTCTGGACCAGATAAGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTCGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTAATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTGACTGTG
  5   1   2       bld Ga12 5g                              XL157b20.5p                                                                                                                                                                                                                                                                                                                     CTTTGCTGCTCAAAATGGCGCCGCTGGGACCTGGCATAAATATGTGGAGATTGCCCGGCAATGTAAATATCTTCCTGAAAATGACCTGAAGAGGCTATGTGATTATGTCTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCAGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTTAGAACTGGTGGGCAAGTTCCTGACACAAATTACATCTTCATGGGTGACTTTGTTGATAGAGGATATTACAGTCTTGAGACATTCACCTTCCTTCTTGCCCTGAAAGCCAAATGGCCTGACCGTATTACCTTGCTGC
  5   1   2       bld Emb1                            IMAGE:6635410.5p                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGCGGCTATGTGATTATGTTTGTGATCTGCTACTGGAGGAATCAAATGTGCAGCCGGTATCTACGCCAGTAACTGTTTGTGGAGATATACATGGACAGTTTTACGATCTATGTGAGCTCTTCAGAACTGGTGGGCAAGTTCCTGACACAAACTACATCTTCATGGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTATGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTACACGGTGGTCTTTCCCCAGACATAAAAACTCTGGACCAGATAAGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTCGATACTTGGGCCATCAGCCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGTTAATTTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACCAATTCATGTTTTGATGAAAAGCCTTGTGAACTGTGTGGGTCGGCTCCCAACTACTTGCTTACCGTTGGGGGGAAACATCCCCCCTCTATTAATGGGTTTTTTAAAGGGATAGTGAAACCACCCCACAAAGCCCAAAAAGGTTCCTTTTCCAAAGCCTGGTTTCCCTGAATTTCCTGAAAGCCCGCGCTTTAAATCCCCCTTCCCCCAGGAAAACCCAACCCAACGGCGCCGGAAAAAATTTTTTTCTA
  5   1   2       bld Spl                             IMAGE:8462961.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGTGACTTTGTTGATAGAGGGTATTATAGTCTTGAGACATTCACCTTCCTTCTTGCCCTAAAAGCCAAGTGGCCTGACCGTATTACCTTGCTGCGAGGGAACCATGAAAGCAGGCAGATCACACAGGTGTATGGATTCTATGATGAGTGCCAGACAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTACACGGTGGTCTTTCCCCAGACATAAAAACTCTGGACCAGATAAGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTCGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTAATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTGACTGTGTGGTCGGCTCCCAACTACTGCTACCGTTGTGGCAACATCGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTCGAGCTGTTCCTGATTCTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTTCTCTGAAGTACATCACTTTTTGTGACTGTGCTGGAttttttttttCATTTATTTTATGTAAGCACTTGCTGCTGAATGCTGAATCTGCCTTTTTTCTTGAAATCAGAAATATATCGTTAATCCCGTTTCTGCTAGGGGTCTTTCTGTACGACAGAGATACACAAA
  3   1   2       bld Neu7                                 XL007g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGAAAGCAGACAGATCACACAGGTGTATGGATTCTACGACGAAGTGCCAGACAAAATATGGAAATGCCAATGCTTGGAGATACTGCACAAAGGTTTTCGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTGCACGGTGGCCTCTCCCCTGACATAAAAACTCTGGACCAGATACGGACAATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTGGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTGATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTCACTGTGTGGTCAGCTCCCAACTATTGCTACCGTTGTGGCAACATCGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTAGAGCTGTTCCTGACTCTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTTCTCTGAAGTCCATTAACTTCTTGTGTACTGTGCTGGGTCTTTTTTTCATTTTATTTTAAGCACTTTGCTGCTGAAATGCTGAATATTGCCTTTTTT
  5   1   2       bld Panc                            IMAGE:8736951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAATATGGAAATGCAAATGCTTGGAGATACTGCACAAAGGTTTTTGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTACACGGTGGTCTTTCCCCAGACATAAAAACTCTGGACCAGATAAGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTCGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTAATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTGACTGTGTGGTCGGCTCCCAACTACTGCTACCGTTGTGGCAACATCGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTCGAGCTGTTCCTGATTCTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTCTCTGAAGTACATTCACTTTTTGTGTACTGTGCTGGAtttttttttttcattttattttATGTTAAGCACTTTGCTGCTGAAATGCTGAATCTTGCCtttttttcttttGAATTCTAGAATATATATTCTGTTTATATCTCTGTTTCTTTGCTTAGGGTTCTTTTTCTTTGTACTGACAAGGAGGATTAACACAAAGATGAAAAATGATTCACCACCACATCAGCCAGGAGTTGTAGGAGGGTTAATATTTTTTGGCAGTAAATTAGGAATCTTTAGATGGCATACACAAGTAGATCTGCTTGTTGGCGAGGTTGCAATTGGTGATCTTTCCTGGAATACGTAAGGCAAGGCCAATTGGGCCCTGGTCCGGAAT
  3   1   2       bld Neu7 5g3  in                         XL008g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCACAAAGGTTTTCGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTGCACGGTGGCCTCTCCCCTGACATAAAAACTCTGGACCAGATACGGACAATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTGGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTGATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTCACTGTGTGGTCAGCTCCCAACTATTGCTACCGTTGTGGCAACATCGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTAGAGCTGTTCCTGACTCTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTTCTCTGAAGTCCATTAACTTCTTGTGTACTGTGCTGGGTCTTTTTTTCATTTTATTTTAAGCACTTTGCTGCTGAAATGCTGAATATTGCCTTTTTTTCTTTC
  5   1   2       bld Emb1                            IMAGE:6632614.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAAAGGTTTTCGATATGCTGACTGTAGCAGCTTTGATAGATGAACAGATACTCTGTGTGCACGGTGGCCTCTCCCCTGACATAAAAACTCTGGACCAGATACGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTGGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTGATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTCACTGTGTGGTCAGCTCCCAACTATTGCTACCGTTGTGGCAACATCGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTAGAGCTGTTCCTGACTCTGAGCGGGTTATCCCTCCCAGAAACACCACGCCGTACTTTCTCTGAAGTCCATTCACTTCTTGTGTTCTGTGCTGGGGCtttttttcattttattttAAGCACTTTGCTGCTGAAATGCTGAAAATTGCCttttttttCCTTCCAAATTATAGAAATAAATATTCCGGTTTAATATCCCCCAATGGGTTCCCTTTGGCTTTAAACAGGCCCCTTTGGCATTTAAACGGTCCCCCCAAAAggggggggaaaccccccctttttttttgggacctgggaaaaaaaaggggggggAAATTTTTAACCCAAACCC
  5   1   2       add Gas4      out                   IMAGE:3420769.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTACAATGCTGCCCAAGCTCTGCTCCGTGCAGCTTGAACTACAGGCACAGCTCTATTGTTTTTAGCTACTAGGAGACGGGCTGAGGCGGGAGTGTCAGAAAGGACAATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTGGATACTTGGTCTTTCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGCGACCAATGAGTTCGCCCATATCAACAATCTGAAGCTGATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTCACTGTGTGGTCAGCTCCCAACTATTGCTACCGTTGGGGCAACATCGCCCTTATTATGGGTNTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTAAAGCTGGTCCTGACTCTGAGCGGGTTATCCCTTCCAGGACCACCACGCCGGNCTTT
  5   1   2       bld Oo1                             IMAGE:5078824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCTTTGATAGATGAACAGATACTCTGTGTGCACGGTGGCCTCTCCCCTGACATAAAAACTCTGGACCAGATACGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTGGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATCTGAAGCTGATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTCACTGTGTGGTCAGCTCCCAACTATTGCTACCGTTGTGGCAACATCGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTAGAGCTGTTCCTGACTCTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTTCTCTGAAGTCCATTCACTTCTTGTGTTCTGTGCTGGGTCtttttttcattttattttAAGCACTTTGCTGCTGAAATGCTGAATATTGCCTTTTTTTCTTTCGAATTATAGAATATATATTCTGTTTATATCTCTATTGTTTCTTTGCTTAGCAGTCCTTGCATTACAGTCCCCAAAGGGGTAATCTCTTTTTTGTACTGACAAAGGGGATTACCAACAAAGATGAAAACCCAAATTAGCACCAACTTTCCATAGCTGGAAGTGGGGTTGGGGAATCTTTTTAACTTGGCATACACAAGTACATCTACTTGTTTTGGGGAGGTAAATCTTTGCCCTAAATTGGATGGCAAATGGGTCTAAACCTACACAAATCCTGGCCACTTTTTCTGGGGATCTGGAAGGGGGCCTATACCCGGTTTCTTAAAATGGTGGGTTCAGTCTGTAGGGGACCAAAATGTCCACTTTTTT
  3   1   2       bld Ga12 5g3  in                         XL210b01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTCCCCAGACATAAAAACTNTGGACCAGATAAGGACGATTGAACGGAATCAAGAGATTCCACACAAAGGAGCTTTTTGTGATCTTGTTTGGTCAGACCCAGAAGATGTCGATACTTGGGCCATCAGCCCTCGAGGCGCAGGGTGGTTGTTTGGAGCCAAGGTGACCAATGAGTTTGTGCATATCAACAATNTGAAGNTAATTTGCAGAGCGCACCAGTTAGTACATGAGGGCTACAAATTCATGTTTGATGAGAAGCTTGTGACTGTGTGGTCGGCTCCCAACTACTGCTACCGTTGTGGCAACATCGCCTNTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTCGAGCTGTTCCTGATTNTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTTCTNTGAAGTACATTCACTTTTTGTGTACTGTGCTGGATTTTTTTTTTCATTTTATTTTATGTTAAGCACTTTGCTGCTGAAATGCTGAATCTTGCCTTTTTT
  5   1   2       add Tbd7      in                         XL055g09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCAACATAGCCTCTATTATGGTTTTTAAGGATGTGAACACACGAGAGCCAAAGCTCTTTCGAGCTGTTCCTGATTCTGAGCGGGTTATCCCTCCCAGAACCACCACGCCGTACTTTCTCTGAAGTACATTCACTTTTTGTGTACTGTGCTGGAttttttttttttCATTTNATTTNATGTNAAGCACTTTGCTGCTGAAANGCTGAATCTTGCCTTTTTTTNTTTNGAATTCTANAATATATATTCTGTTNATATCTCTGTTTCTTTGCTTAGGGGTTCTTTTTNTTTGTNCTGNCAAAGAAGATTANCANCAAAGATGAAAAAAANGATTCACACCACATCAGCCANAGTTGTAGGAGGGGTTAAATATTTTTGCAGTAAAATTAGGAATCCTTTAANANGGCCATACNCAA
  5   1   2      ests                                 Xl3.1-xl265d09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTTAAGCACTTTGCTGCTGAAATGCTGAATCTTGCCTTTTTTTCTTTTGAATTCTAGAATATATATTCTGTTTATATCTCTGTTTCTTTGCTTAGGGGTTCTTTTTCTTTGTACTGACAAAGAAGATTAACAACAAAGATGAAAAAAATGATTCACACCACATCAGCCAGAGTTGTAGGAGGGGTTAAATATTTTTGCAGTAAAATTAGGAATCCTTTAAGATGGCCATACACAAGTAGATCTGCTTGTTTGGCGAGGTTGCCAAATGAGTTGATCTTTCCCTGAATACGTAGAGCAGGGCCAAATTGGGCTTGTCTGATTGTTGGTCCATAGGCCAAAGATCAGATCTTCATGCAGAACTAGGCACATAAGATGTTGACCCAATGTGTAGGGAACAAGTTGTCCTCTTTTATCAACCTGTGCATGGCAAGCTTTGGTTTATAGCATGGCAATAAAGTGTTTACTGTTGAACATAGATGGAATATAGAGGAAAATATCACATGGATTTTAAATCCCCCTAAATTGGATATTTTAAAGAATCCTGAAAGGTTTAACCTGGTTCCTAATGGTATTGTAAATGGCGAACCGTGTGACTAGAGACTTCGTATCTTGGAATACTAACTCTACCACAAAGTACAAACAACATTGTGTTTATATGTGTGGTGGCTGTGCTCTCTTGTTAGTGGGGCACCATAATAGTGCTCTGCTGCCCATCACAGACGTGCTGGAATTTCTGCCTCCACAAGGTTAGTTTAGACTTTAAAGTGAAGCTTTTATTAACATTAAGGCGAGTAGACCCTTCCCAAACCCCTTTGTGGAGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGGGCGTTTGGCTCTGCAATGCCCCCCCATAATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCACATAGAAGTTAAATATAATAGAAATAAAGAAAGTTAGTCTTTAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012690545                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACTTTGCTGCTGAAATGCTGAATCTTGCCTTTTTTTCTTTTGAATTCTAGAATATATATTCTGTTTATATCTCTGTTTCTTTGCTTAGGGGTTCTTTTTCTTTGTACTGACAAAGAAGATTAACAACAAAGATGAAAAAAATGATTCACACCACATCAGCCAGAGTTGTAGGAGGGGTTAAATATTTTTGCAGTAAAATTAGGAATCCTTTAAGATGGCCATACACAAGTAGATCTGCTTGTTTGGCGAGGTTGCCAAATGAGTTGATCTTTCCCTGAATACGTAGAGCAGGGCCAAATTGGGCTTGTCTGATTGTTGGTCCATAGGCCAAAGATCAGATCTTCATGCAGAACTAGGCACATAAGATGTTGACCCAATGTGTAGGGAACAAGTTGTCCTCTTTTATCAACCTGTGCATGGCAAGCTTTGGTTTATAGCATGGCAATAAAGTGTTTACTGTTGAACATAGATGGAATATAGAGGAAAATATCACATGGATTTTAAATCCCCCTAAATTGGATATTTTAAAGAATCCTGAAAGGTTTAACCTGGTTCCTAATGGTATTGTAAATGGCGAACCGTGTGACTAGAGACTTCGTATCTTGGAATACTAACTCTACCACAAAGTACAAACAACATTGTGTTTATATGTGTGGTGGCTGTGCTCTCTTGTTAGTGGGGCACCATAATAGTGCTCTGCTGCCCATCACAGACGTGCTGGAATTTCTGCCTCCACAAGGTTAGTTTAGACTTTAAAGTGAAGCTTTTATTAACATTAAGGCGAGTAGACCCTTCCCAAACCCCTTTGTGGAGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGGGCGTTTGGCTCTGCAATGCCCCCCCATAATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCACATAGAAGTTAAATATAATAGAAATAAAGAAAGTTAGTCTTTAAAAAAAAAA
  5   1   2       bld Ga12      in                         XL158g23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACTTTTTGTGTACTGTGCTGGAtttttttttttaattttattttATGTTAAGCACTTTGCTGCTGAAATGCTGAATCTTGCCtttttttcttttGAATTCTANAATATATATTCTGTTTATATCTCTGTTTCTTTGCTTAGGGGTTCTTTTTCTTTGTNCTGACAAAGAAGATTAACAACAAAGATGAAAAAAATGATTCACACCACATCAGCCAGAGTTGTAGGAGGGGTTAAATATTTTTGCAGTAAAATTAGGAATCCTTTAANATGGCCATACACAAGTAGATCTGCTTGTTTGGCGAGGTTGCCAAATGAGTTGATCTTTCCCTGAATACGTANAGCAGGGCCAAATTGGGCTTGTCTGATTGTTGGTCCATAGGCCAAAGATCANATCTTCATGCAGAACTAGGCACATAANATGTTGACCCAATGTGTAGGGAACAAGTTGTCCTNTTTTATCAACCTGTGCATGGCAAGCTTTGGTTTATAGCATGGCAATAAAGNGTTTACTGTTGAACATAGATGGAATA
  5   1   2       bld Egg1                               PBX0064D06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              cattttattttATGTTAAGCACTTTGCTGCTGAAATGCTGAATCTTGCCtttttttcttttGAATTCTAGAATATATATTCTGTTTATATCTCTGTTTCTTTGCTTAGGGGTTCTTTTTCTTTGTACTGACAAAGAAGATTAACAACAAAGATGAAAAAAATGATTCACACCACATCAGCCAGAGTTGTAGGAGGGGTTAAATATTTTTGCAGTAAAATTAGGAATCCTTTAAGATGGCCATACACAAGTAGATCTGCTTGTTTGGCGAGGTTGCCAAATGAGTTGATCTTTCCCTGAATACGTAGAGCAGGGCCAAATTGGGCTTGTCTGATTGTTGGTCCATAGGCCAAAGATCAGATCTTCATGCAGAACTAGGCACATAAGATGTTGACCCAATGTGTAGGGAACAAGTTGTCCTCTTTTATCAACCTGTGCATGGCAAGCTTTGGTTTATAGCATGGCAATAAAGTGTTTACTGTTGAACATAGATGGAATATAGAGGAAAATATCACATGGATTTTAAATCCCCCTAAATTGGATATTTTAAAGAATCCTGAA
  5   1   2       bld Gas6                            IMAGE:3438455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTAAGATGGCCATACACAAGTAGATCTGCTTGTTTGGCGAGGTTGCCAAATGAGTTGATCTTTCCCTGAATACGTAGAGCAGGGCCAAATTGGGCTTGTCTGATTGTTGGTCCATAGGCCAAAGATCAGATCTTCATGCAGAACTAGGCACATAAGATGTTGACCCAATGTGTAGGGAACAAGTTGTCCTCTTTTATCAACCTGTGCATGGCAAGCTTTGGTTTATAGCATGGCAATAAAGTGTTTACTGTTGAACATAGATGGAATATAGAGGAAAATATCACATGGATTNTAAATCCCCCTAAATTGGATATTTTAAAGAATCCTGAAAGGTTTAACCTGGTTCCTAATGGTATTGTAAATGGCGAACCGTGTGACTAGAGACTTCGTATCTTGGAATACTAACTCT
  5   1   2       bld Ga15      in                       XL489e11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATATAGAGGAAAATATCACATGGATTTTAAATCCCCCTAAATTGGATATTTTAAAGAATCCTGAAAGGTTTAACCTGGTTCCTAATGGTATTGTAAATGGCGAACCGTGTGACTAGAGACTTCGTATCTTGGAATACTAACTCTACCACAAAGTACAAACAACATTGTGTTTATATGTGTGGTGGCTGTGCTCTCTTGTTAGTGGGGCACCATAATAGTGCTCTGCTGCCCATCACAGACGTGCTGGAATTTCTGCCTCCACAAGGTTAGTTTAGACTTTAAAGTGAAGCTTTTATTAACATTAAGGCGAGTAGACCCTTCCCAAACCCCTTTGTGGAGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGG
  3   1   2      seed DMZ  5g3  in                         xl265d09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACATGGATTTTAAATCCCCCTAAATTGGATATTTTAAAGAATCCTGAAAGGTTTAACCTGGTTCCTAATGGTATTGTAAATGGCGAACCGTGTGACTAGAGACTTCGTATCTTGGAATACTAACTCTACCACAAAGTACAAACAACATTGTGTTTATATGTGTGGTGGCTGTGCTCTCTTGTTAGTGGGGCACCATAATAGTGCTCTGCTGCCCATCACAGACGTGCTGGAATTTCTGCCTCCACAAGGTTAGTTTAGACTTTAAAGTGAAGCTTTTATTAACATTAAGGCGAGTAGACCCTTCCCAAACACCTTTGTGGAGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGGGCGTTTGGCTCTGCAATGCCCCCCCATAATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATAT
  3   1   2       bld Tbd7 5g3  in                         XL079p14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCTTGGAATACTAACTCTACCACAAAAGTACAAACAACATTGTGTTTATATGTGTGGTGGCTGTGCTCTCTTGTTAGTGGGGCACCATAATAGTGCTCTGCTGCCCATCACAGACGTGCTGGAATTTCTGCCTCCACAAGGTTAGTTTAGACTTTAAAGTGAAGCTTTTATTAACATTAAGGCGAGTAGACCCTTCCCAAAACCCTTTGTGGAGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGGGCGTTTGGCTCTGCAATGCCCCCCCCAANATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAATGCAGCTTTTGAAAATGTATATTGATATAAAATGCACCAATGCTATGTGAGTT
  3   1   2       bld Ga12      in                         XL158g23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATCTTGGAATACTAACTCTACCACAAAGTACAAACAACATTGTGTTTATATGTGTGGTGGCTGTGCTCTCTTGTTAGTGGGGCACCATAATAGTGCTCTGCTGCCCATCACAGACGTGCTGGAATTTCTGCCTCCACAAGGTTAGTTTAGACTTTAAAGTGAAGCTTTTATTAACATTAAGGCGAGTAGACCCTTCCCAAACCCCTTTGTGGAGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGGGCGTTTGGCTCTGCAATGCCCCCCCATAATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCnTTTTTATTTTTATTACTANAGGNAAAAAATGCAGCTTTTGCAAAATGTATATTGANATAATTGTAC
  3   1   2       bld Tbd7      in                         XL055g09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAATACTAACTCTACCACAAAGTACAAACAACATTGTGTTTATATGTGTGGTGGCTGTGCTCTCTTGTTAGTGGGGCACCATAATAGTGCTCTGCTGCCCATCACAGACGTGCTGGAATTTCTGCCTCCACAAGGTTAGTTTAGACTTTAAAGTGAAGCTTTTATTAACATTAAGGCGAGTAGACCCTTCCCAAACCCCTTTGTGGAGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGGGCGTTTGGCTCTGCAATGCCCCCCCATTATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTATCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTTAGTCACATAGAAGTTAAATATAATAGAAATAAAGAAAG
  5   1   2       bld Neu7      out                        XL005f12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGCCCATCACAGNACGTGCTGGAATTTCTGCCTCCACAAGGTTAGTTTAGACTTTAAAGTGAAGCTTTTATTAACATTAAGGCGAGTAGACCCTTCCCAAACACCTTTGTGGAGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCggggggtgggggCGTTTGGCTCTGCAATGCCCCCCCATAATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTaaaaaaaaCATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGcttttttcaaaggctgcattttttgggggtattttcatttttatttttATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCACATAGAAGTTAAATATAATAGAAATAAAGAAAGTTAGTCTTTAATAATGCTCTTTTTTTCTTATTTAAAGCACAATAAATGGATAAAGTTGTTGCTCATGTAATTAATGGCCCAAAATATCTGTTTTATAttttttttAAAAATCTCCC
  3   1   2       bld Ov1                             IMAGE:4055932.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGTGGGAAAGTTGCACAGCTGAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGGGCGTTTGGCTCTGCAATGCCCCCCCATAATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCACATAGAAGTTAAATATAATAGAAATAAAGAAAGTTAGTCTTT
  3   1   2       bld Oo1  5g3  in                    IMAGE:5078593.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAATCTTTCACTTGCCTCTTTCCTATGCTGTTCGGGGGGTGGGGGCGTTTGGCTCTGCAATGCCCCCCCATAAATTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCACATAGAAGTTAAATATAATAGAAATAAAGAAAGTTAGTCTTTAAAA
  3   1   2       bld Ga15      in                       XL489e11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAANGCCCCCCCATAATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATGAGTCACATAGAAGTAAA
  3   1   2       bld Ga15 5g3  in                       XL517b12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAANGCCCCCCCATAATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCACATAGAAGTAAA
  3   1   2       bld Ga15      in                       XL410a15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCCCCATTATTTCCTGCTCTCTATCCAATATTTTTATTTGTAAGGAGAAGAAGATTTCAGCAGCAAAGCTATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTATCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATANTGAGTCACATAGAAGT
  3   1   2       bld DMZ                                 rxl262p06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAAGATTTCAGCAGCAAAGCTATCAAGGNCTGATTTGTAAATGCCTNGTGTTGTGCGTGTTAAAAAAAACATTNTTATCCACCATTTGTNTNAAAGCNGATCTGTNNNTGNGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTNTGGGGGTAGTTTCATTTTTATTNTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATANTCCNGTACTNTAATAAAGTATATTGAGTCACCATAGAAGNTAAATATAATNGAAATAAAGAAAGTT
  3   1   2       bld Gas4 5g3  in                    IMAGE:3421529.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATCAAGGACTGATTTGTAAATGCCTTGTGTTGTGCGTGTTAAAAAAAACATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGCTTTTTTCAAAGGCTGCATTTTTTGGGGGTATTTTCATTTTTATTTTTATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCCAAACAAAAAAAA
  5   1   2       bld Tbd2                   IMAGE:3200403-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTaaaaaaaaCATTTTTATCCACCATTTGTTTTAAAGCAGATCTGTAAATGAGAAAATAAAGcttttttcaaaggctgcattttttgggggtattttcatttttatttttATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCACATAGAAGTTAAATATAATAGAAATAAAGAAAGTTAGTCTTTaaaaaaaaaaaaaaaa
  5   1   2       bld Tbd2                            IMAGE:3200413.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTaaaaaaaaCATTTTTATCCACCATTTGTTTTTTAGCAGATCTGTAAATGAGAAAATAAAGcttttttcaaaggctgcattttttgggggtattttcatttttatttttATTACTAGAGGAAAAAAATGCAGCTTTTGAAAATGTATATTGATATAATTGTACCAATCTATGTGAGTTTTTTCCCTCCAAATATTCCTGTACTTTAATAAAGTATATTGAGTCACATAGAAGTTAAATATAATAGAAATAAAGAAAGTTAGTCTTTaaaaaaaaaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)