Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4409099.3                      58 END     1           2        1                myosin heavy chain [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8531597.3.5                   612 PI      73        418     1458                (no blast hit)
     3   0.0    0Xl3.1-xlk117e20ex.3.5                     546 PI      73        418     1249                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:4409099.3                      58 PI      74        472     1142                myosin heavy chain [Xenopus tropicalis]
     5   0.0    0Xl3.1-IMAGE:8740747.5.5                    36 PI      75       1556     2238                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:8535495.5.5                    32 PI      73       1585     2238                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:6879751.3                      19 PI      73       1556     2273                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:6880452.3                      15 PI      81       1000     2289                (no blast hit)
     9   0.0    0Xl3.1-IMAGE:8741070.5                       9 PI      74       1621     2257                myosin, heavy polypeptide 13, skeletal muscle [Xenopus tropicalis]
    10   0.0    0Xl3.1-IMAGE:8742207.5                       7 PI      81       1555     1928                myosin heavy chain [Gallus gallus]
    11   0.0    0Xl3.1-IMAGE:8641590.3                       4 PI      76       1686     2238                (no blast hit)
    12   0.0    0Xl3.1-IMAGE:6876485.5                       3 PI      75        418      972                (no blast hit)
    13   0.0    0Xl3.1-IMAGE:8640405.3                       2 PI      79       1714     1976                myosin, heavy polypeptide 13, skeletal muscle [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012838042 Xl3.1-IMAGE:6879463.3.5 - 50 ESTs
                                                                       .-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6879463.3.5                                                                                                                          CTCAGAAGAGATCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCAGCCACACTCAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGCGAGCAAATAGATAATTTGCAGAGGGTTAAGCAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTAGCATCTAACATGGAACAAGTTGTTAAATCCAAGGTCAACCTTGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCCCATGGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAAAAGACAGAGACAGATTTGGCTCAGCTGCAGACAGAAGTGGAAGAAGCTGTTCAGGAATGTCGCAATGCAGAGGAGAAGGCCAAGAAGGCTATCACTGATGCTGCAATGATGGCAGAAGAGCTGAAAAAGGAGCAGGACACAAGTGCCCATCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACGTGACCATAAAATTCAGCA
                                                  Xl3.1-CHK-1012721449                                                                                                                                AGAGATCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCAGCCACACTCAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGCGAGCAAATAGATAATTTGCAGAGGGTTAAGCAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTAGCATCTAACATGGAACAAGTTGTTAAATCCAAGGTCAACCTTGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCCCATGGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAAAAGACAGAGACAGATTTGGCTCAGCTGCAGACAGAAGTGGAAGAAGCTGTTCAGGAATGTCGCAATGCAGAGGAGAAGGCCAAGAAGGCTATCACTGATGCTGCAATGATGGCAGAAGAGCTGAAAAAGGAGCAGGACACAAGTGCCCATCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACGTGACCATAAAATTCAGCACTGAAA
                                                      consensus depths                                                                                                                               3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     7     8     9    10     7     8     8     9     8     9     8     9     8     9     8     9     9    10    10    11    10    12     9    12    11    13    11    13    10    13    10    12     9    13    10    12     9    11     9    11     8    11     9    11     9    11     9    11    10    12    11    13    10    13    10    13    11    14    11    14    11    14    11    14    11    14    11    14    11    13    13    15    13    15    13    15    13    15    13    15    13    15    13    15    13    15    15    17    15    17    15    17    15    17    15    17    14    16    14    16    13    15    12    15    12    15    12    14    12    14    12    14    11    14    12    14    12    15    11    16    13    16    12    16    13    18    15    19    14    21    15    21    13    20    12    20    12    19    14    19    13    19    15    18    15    18    15    18    14    18    14    18    13    14    11    13    12    13    12    13    12    12    12    12    11    12    12    12    12    12    10    12    10    11    10    10    10    10    10    12     9    12    10    12    11    13    11    13    11    13    11    13    11    13    11    13    11    13    12    13    12    13    12    13    12    13     6     7     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     5     7     7    10    10    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    11    10    10     9    10    10    10    10    10
  5   1   2      ests                            Xl3.1-IMAGE:6879463.3                                                                                                                          CTCAGAAGAGATCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCAGCCACACTCAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGCGAGCAAATAGATAATTTGCAGAGGGTTAAGCAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTAGCATCTAACATGGAACAAGTTGTTAAATCCAAGGTCAACCTTGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCCCATGGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAAT
  5   1   2      ests                            Xl3.1-IMAGE:6872017.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAAAAGACAGAGACAGATTTGGCTCAGCTGCAGACAGAAGTGGAAGAAGCTGTTCAGGGATGTCGCAATGCAGAGGAGAAGGCCAAGAAGGCTATCACTGATGCTGCAATGATGGCAGAAGAGCTGAAAAAGGAGCAGGACACAAGTGCCCATCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACGTGACCATAAAATTCAGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
  5   1   2      ests                            Xl3.1-IMAGE:6879463.3                                                                                                                          CTCAGAAGAGATCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCAGCCACACTCAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGCGAGCAAATAGATAATTTGCAGAGGGTTAAGCAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTAGCATCTAACATGGAACAAGTTGTTAAATCCAAGGTCAACCTTGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCCCATGGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAAT
                                                  Xl3.1-CHK-1012687334                                                                                                                                AGAGATCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCAGCCACACTCAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGCGAGCAAATAGATAATTTGCAGAGGGTTAAGCAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTAGCATCTAACATGGAACAAGTTGTTAAATCCAAGGTCAACCTTGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCCCATGGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTT
  5   1   2       bld Tad1                            IMAGE:6939887.5p GGAACTTCGCTCTGATTTGTCTCGGGAACTAGAAGAAATCAGTGAGCGGTTGGAAGAAGCTGGAGGAGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCTTGAAACTCAGAAGAGATCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCAGCCACACTCAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGCGAGCAAATAGATAATTTGCAGAGGGTTAAGCAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTAGCATCTAACATGGAACAAGTTGTTAAATCCAAGGTCAACCTTGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTTAGAAGACCTAAAGCGGACAGCTGGGAAGAGGGAAAGCAAGGCCTAAAAAATGCCTTTTGGGCCCCATGGGAATTGGCCAATTCAAGCCCCCGCCCCATGAAACTGGGTGAAACCCTTTCCTGGAAAGGGGGAAACCAAGGTTATTTGGAAAGGGAAAGAGAGGCCCACAGGAAAAAGCCCCCAAAAGGGGGCAAAGC
  5   1   2       bld He1       in                    IMAGE:4406938.5p                                                                                                                          CTCAGAAGAGATCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCAGCCACACTCAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGCGAGCAAATAGATAATTTGCAGAGGGTTAAGCAGAAGCTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTAGCATCTAACATGGAACAAGTTGTTAAATCCAAGGTCAACCTTGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCCCATGGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAAGCAGAAAGTGCAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGG
  5   1   2       bld He1       in                    IMAGE:4407421.5p                                                                                                                          CTCAGAAGAGATCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCAGCCACACTCAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGCGAGCAAATAGATAATTTGCAGAGGGTTAAGCAGAAGCTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTAGCATCTAACATGGAACAAGTTGTTAAATCCAAGGTCAACCTTGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGTCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGT
  5   1   2       bld He1       in                    IMAGE:4408307.5p                                                                                                                                                                      TGCAGCCACACTCAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGCGAGCAAATAGATAATTTGCAGAGGGTTAAGCAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTAGCATCTAACATGGAACAAGTTGTTAAATCCAAGGTCAACCTTGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGTTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACTTACTCTCAGTAGTTTAAAGACTTAAAGCTACAGCTT
  5   1   2       bld He1       in                    IMAGE:4408389.5p                                                                                                                                                                                                                                                      CAGAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTAGCAGATAACATGGAACAAGTTGTTAAATCCAAGGTCAACCTTGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAAGGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCCCATGGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGA
  5   1   2       bld He1       in                    IMAGE:4407730.5p                                                                                                                                                                                                                                                                            TGAATTCAAACTGGAGCTTGATGATGTAGCATCTAACATGGAACAAGTTGTTAAATCCAAGGTCAACCTTGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGAGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCCCATGGATTGCAATCA
  5   1   2       bld He1       in                    IMAGE:4408932.5p                                                                                                                                                                                                                                                                                                                                                 TGAGAAGCTGTGTCGCACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGA
  5   1   2       bld He1       in                    IMAGE:4407990.5p                                                                                                                                                                                                                                                                                                                                                                CACATTGGAAGACCAGATGAATGAACACCGCACCAAGTTTGAAGAGGCTCAGAGGACTCTGAATGACCTTTCTTCCCAAAAGGCAAAACTACAAACAGAGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCCCATGGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGAT
  5   1   2       bld He1       out                   IMAGE:4407295.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAATGGGGAGTTGACCAGAAGACTGGATGAAAAGGAGGCACTGGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCCCATGGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAAtgctgctgctgctgctCTAGACAAGAACAGA
  5   1   2       bld He1       in                    IMAGE:4409245.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCCCATGGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAAtgctgctgctgctgctCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAAC
  5   1   2       add Tad1      in                    IMAGE:6878255.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGACCTAAAGCGACAGCTAGAAGAGGAAAGCAAGGCTAAAAATGCTTTGGCTCATGGACTGCAATCAGCCCGCCATGACTGTGATCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCANATGNNCAGAAGNGNNNTAGCTCCCAATGGGAGGGACNNCAAGGTAANTGGGAAGAAANNNNCGGGNGnnnnnnngnnnnnnnnnnnnnnnnnnnngngggggggggggggggnggngngggggggggggggggggggggggggcggaagccactctctttttcnnnnacagccaagaaaaaagaaagngaaaaaagaaaagaagaaaagcaaaaaaaataaaaaaaaagttaaaaaaGAAGACAAATAAATTCGTCCCGATTCATCTTACTCCGCTCTGGTTCAAGTATATCGCCGAGATGCCTTTACCAGAATCGGCCGGGTACATATACCATCTTAAACGCTTGTTATCGCGCGGTCACACCGAAGAAACTCGAAATAAAGCGAGTACGCTCGGACATAAAGCATGCGAGGGAGGTTCGAATACAGTCACCAGCATCCGCCATACTAACCTCATTAGCAATTCCTATACCACTCTTAATTAAAGAAGAGAGCGAAACCAATTTAGGCTCATGATGAGCCGAATTACCTTCCCAACTTTGTCTAATCGCCCCATCCTATGCCACATCGCTTCGGCCTTGTATGTTGCCGCGATACACCATGTCCTAGCGCGCGAATATACACATATAGAATGTGTTAGTACCACTGTTACGGAGTATAACGACTATTGTTAACTATCTATCACCATTGCGGTCAGGGGCCACCGTTTTCTTNATTAACTACCCTAACCTAGATATCACCAAGCATTGAAGCGACCGACGTTGGTGATAACTCTATCGAGGGATGACTGCGAA
  5   1   2       bld He1       in                    IMAGE:4408672.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGATGAGGAAACAAAAGCTAAAAATGCTTTGGCCCATGGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAGACCAACACCGCTTGCAAATGAAATCGANGATCTAATGGTGGACCTAGAGAGATCAAATGCTGCTGCTGCTGGTCTAGACAAGAACAGAAGA
  5   1   2       bld He1       in                    IMAGE:4408877.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGATTGCAATCAGCCCGCCATGACTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAAtgctgctgctgctgctCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATA
  5   1   2       bld Lmb1                            IMAGE:8531487.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTGACCTTCTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAAtgctgctgctgctgctCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAA
  5   1   2       bld He1                             IMAGE:4408058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAAtgctgctgctgctgctCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAAGAG
  5   1   2       bld He1       in                    IMAGE:4407261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GNCGACCCACGCGNCCGCGNCCNGCGAGCNNNGGGACAGAANCCAACCCAAGCAGAAGNAGCNCAGGGGAGGACCAAGNACGAGACNGACGCCANACAGAGAACAGAGGAACNAGAAGAGGCCAAAAAGAAGNNGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGNCGAGGCTGNAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAAtgctgctgctgctgctCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCCTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAACTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAG
  5   1   2      seed Tad1      in                    IMAGE:6879463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGTTGCAAAGAGTACTGTCCAAGGCCAATGCAGAAGTAGCTCAGTGGAGGACCAAGTACGAGACTGACGCCATACAGAGAACAGAGGAACTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAGGCAGAGGAGGCTGTCGAGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAAtgctgctgctgctgctCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCCGCGCCTTGGTGAATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCCTAAGAAGTAA
  3   1   2       bld Tad1      in                    IMAGE:6878255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGAGAGAGGGATATTTTTTTCTATACCACCAACTACGTTTTTCTTTTTTTTTTTTTnTGGGGGGGAGCGGGACACCACACCAATTATTTTTTTTTAAGAGAGGTGGTCCTTCCCCCCCAACACCCCGAAAAGGGGTGGGGGCTCCTCCCCTCCACCCCAAAAAAAAAGAAGGAGGTGTTTTTGTTTCCCCCCCTCGGGGCCCCCCCCCCGTTTTTTTTTTTTTAAAGGTGGTGGAGAGAAAAAGCCCCTCTTTTGAGAAAAGTGTGTTTTTTTTTTTAAACACCCCCCGGGGGGGGGCCCTTTTTTATAAAGAGGGGGGAAAAACCCCAAAAATTTTTTTCTCAAGGGGGGGGAAATTTTTTCTTGCCCCCCTTTAAAAAAAGACCCCCTTTTTGGGGGAAGGGTGTGGGAAAAAAGGTTTCCCCCCGGGGTTTTAGGGAAAAGTTTTTCCCAAAACCCAGTTGTGGGCCCCAAGGAAAAAAATGGGGGTTTTCCCGGGCTCCCCTTGGGAAAGAAGGGCCTTCCCTTAGGCCCCTGAAGGGGGCCAAGGTTTTTTACGTTCCCCCGGTTGGATTTCAATTCCGCTAAAAGTTCGGAGAATTATTCGCCAAATTGCCAGGGGAAAGATGAAGAAATTGGCCCCAGTTAAAGGGAAACATTCAGCGGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGCCGTAACGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGGGATCTTAATGAGATGGAGATTCAGCTAAGCCAGGCCAACCGCTCAGCAGCTGAGGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTCAAGGACACCCAGATACAGCTTGATGATACTATAAGAGCCAATGATGATCTCAAAGAAAACTCTGCTATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAACTGCGCTCTATTTTAGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGCTGATTGAAACCAGGAGAGATCCAAACATTCATCCCAGATTCTATTTCTCACGGCGNGGGCTGTATTCCCGTCGCCCGCTCGCCCC
  5   1   2       bld He1       in                    IMAGE:4408043.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGCTGTAAATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAAtgctgctgctgctgctCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATG
  3   1   2       bld He1                             IMAGE:4408437.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGCCAAATGCTCATCCTTGGAAAAGACCAAACACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAAA
  5   1   2       bld He1       in                    IMAGE:4406885.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCGCTTGCAAAATGAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAAtgctgctgctgctgctCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCA
  5   1   2       bld He1       in                    IMAGE:4407382.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAATCGAGGATCTAATGGTGGACCTAGAGAGATCAAAtgctgctgctgctgctCTAGACAAGAAACAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCATACCTGACAGAGCACCTAGGATAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGATCAAGAGAAAATGGAGTTACATACTGCGCTGGAAGAAGCTGATGCTTCTCTAGAGCATGAGGAGGTTTTTATTGTACGTGCTCAGCTCCCATTTAACCAGCTGTAGTTAGATATTGATCGCAAAATATCAGACACAGATGAGGAAATGCATCAAGTAAAGAGAAACAATATGCACTTG
  3   1   2       bld He1                             IMAGE:4408501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAGGAATTTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAA
  3   1   2       bld He1       in                    IMAGE:4407730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCCCAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGCAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGT
  3   1   2       bld He1       in                    IMAGE:4408389.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGACAAGATTCTTTCTGAATGGAAGCAAAAGTTCGAAGAGTCACAGACAGAGCTGGAGTCCTCACTAAAAGAGTCTCGTTCCCTGAGCACCGAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAA
  5   1   2       bld He1       in                    IMAGE:4407829.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAAGACATCCAAATA
  5   1   2       bld He1       in                    IMAGE:4406872.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTTCAAGCTGAAGAATGCCTATGAGGAGTCACTTGAACATCTGGAGACATTTAAGAGAGAAAACAAAAACCTACAAGAGGAAATATCAGACCTGACAGAGCAGCTAGGAGAGGGTGGGAAGAGTATCCATGAGCTAGAAAAGATTCGAAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCGCTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAGGACATCCAAATACAGCTTG
  5   1   2       bld Ga15                               XL454i11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTATCCNTGAGTTAGAGAAGGTTCGCNAGCAGCTGGAGCNNGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCATCGCTAGAGCATGAAGAGGGCAAGATTCTACGTGCCCAGCTTGATTTCAATCAGCTAAAGTCAGAGATTGATCGCAAATTANCAGAGAAAGATGAANAAATGGACCNAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTANAGGCTGAGATCANGAGCCGTAACGAGGCCCTAANAGTaaaaaaaaaa
  3   1   2       bld Tad1      in                    IMAGE:6879463.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAAAGAAGGCGGAGGTTTTTTTAGAGCCCTTGGGAAGGGGCAAAATTTTTACGGTGGTTCAGGTTGAGTTTCAACCCCGCTTGAAGTCAGAGATTTGATCCCCAAATTAGCCGAGAAAGATGCGGAAATTGGAGCAAGTAAAGGGAAACAATTCGCGGTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGAGGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAAAAGACAGAGACAGATTTGGCTCAGCTGCAGACAGAAGTGGAAGAAGCTGTTCAGGAATGTCGCAATGCAGAGGAGAAGGCCAAGAAGGCTATCACTGATGCTGCAATGATGGCAGAAGAGCTGAAAAAGGAGCAGGACACAAGTGCCCATCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGACCGAGTCCG
  3   1   2       bld He1       in                    IMAGE:4409245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGTTGAGGCTTCTCTAGAGCATGAGGAGGGCAAGATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCA
  3   1   2       bld He1       in                    IMAGE:4406885.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTTTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCA
  3   1   2       bld He1       in                    IMAGE:4407990.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTTACGTGTTCAGCTTGAGTTCAACAAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATA
  3   1   2       bld He1       in                    IMAGE:4408307.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTACGTGCTCAGCTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATA
  3   1   2       bld He1       in                    IMAGE:4407382.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGAGTTCAACCAGCTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATA
  3   1   2       bld He1       in                    IMAGE:4407421.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAAATAGCAGAGAAAGATGAGGAAATGGAGCAAGTAAAGAGAAACAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAAAAAAAAAAAAAA
  3   1   2       bld He1       in                    IMAGE:4408932.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTGAAGTCAAGATGGATGCCAAAATAGCAGAGAAAATGAAGGAAATGAAGCAAGTAAAGAGAACCAATCAGCGCTTGGTGAATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGAGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCACAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTCTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCA
  3   1   2       bld He1       in                    IMAGE:4407829.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGCAAAGATTGATCGCCAAAAAGAAGAAAAGAGTGAGGGAATGGAGCAAGTAAGAGGAAACAATCGGGGCTTGGTGGATGCACTTAAAACCCAGTTAGAGGCTGAGATCAGAAGCCGTAATGGGGCCCTAAGAGTAAAAAAGAAGATGGAAGGTGATCTTAATGAGATGGAGATTCAGCTAAGTCAGGCCAACCGCTCAGCAGCTGAAGCTCGCAAACATCTGAAGGCAGCACATGGAAGTCTTAAGGACATCCAAATACAGCTTGATGATACTATGAGAGCTAATGATGATCTCAAAGAAAACTTTGCCATTGTGGAAAGGAGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGGCCAACTCCTTCACTCCCAGAACACAAGTCTTATA
  5   1   2       bld He1       in                    IMAGE:4408023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGAACATGTTGCTTCAAGCAGAGCTGGAGGAACTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATTGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGT
  5   1   2      ests                            Xl3.1-IMAGE:6872017.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAAAAGACAGAGACAGATTTGGCTCAGCTGCAGACAGAAGTGGAAGAAGCTGTTCAGGGATGTCGCAATGCAGAGGAGAAGGCCAAGAAGGCTATCACTGATGCTGCAATGATGGCAGAAGAGCTGAAAAAGGAGCAGGACACAAGTGCCCATCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACGTGACCATAAAATTCAGC
                                                  Xl3.1-CHK-1012693894                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAAAAGACAGAGACAGATTTGGCTCAGCTGCAGACAGAAGTGGAAGAAGCTGTTCAGGGATGTCGCAATGCAGAGGAGAAGGCCAAGAAGGCTATCACTGATGCTGCAATGATGGCAGAAGAGCTGAAAAAGGAGCAGGACACAAGTGCCCATCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACGTGACCATAAAATTCAGCACTGAA
  3   1   2       bld Tad2                            IMAGE:6872017.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCCCTCAGTGTTATGAGCTTTACAGGGATGTTTATGACAGACAGAGAGATCACGCAAACTTGCAGAACAAGAGTTGATGAAACCAGTGAGAGAGTCCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAAAAGACAGAGACAGATTTGGCTCAGCTGCAGACAGAAGTGGAAGAAGCTGTTCAGGGATGTCGCAATGCAGAGGAGAAGGCCAAGAAGGCTATCACTGATGCTGCAATGATGGCAGAAGAGCTGAAAAAGGAGCAGGACACAAGTGCCCATCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGAGCCTTA
  3   1   2       bld Tad1      ?                     IMAGE:6879746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAGAAAAATTTGGCCCTTGGGGGAAAGGGGGGAACAAGTTGGTTTAAGGCCGAGCCGGAGGAACTGCGTTGTTTTTTGGAACCGACCAGAGAGATCACGCAAACTTGCCGGACCAAGAATTGATTGAAACCAGTGAGAGAGTCCAACTCTTTCACTCCCAGAACTCAAGTCTTTTAAATCAAAAGAAAAAGACAGCGACAGATTTGGCTCAGATGCAGACAGAAGTGGAAGAAGCTGTTCAGGAATGTCGCAATGCAGAGGAGAAGGCCAAGAAGGCTATCACTGATGATGCAATGATGGCAGAAGAGCTGAAAAAGGAGCAGGACACAAGTGCCCATCTGGAAAGGATGAAGAAGAACTTGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGTTGAACAGAAGCGAAATGTTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCATAGTGATGAAGACAAGAAGAATATGGCACGCTTGCAAGACTTTGTAGACAAACTGCAGTTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCTGTAAAGTTCAGCACGAGCTGGATGAGGGTGAAGAAAGGGCAGATACTGTTGAGTCTCGAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCACAGAAGCACAACATGGATGCGGTAAATGCACATTA
  3   1   2      seed He1       in                    IMAGE:4408672.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCAGCGGCTTGATGAAGCTGAGCAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACATGACCATAAAATTCAGCACTGAA
  3   1   2       bld He1                             IMAGE:4408934.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGATGAAGCTGAGCAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACATGACCATAAAATTCAGCACTGA
  3   1   2       bld He1       in                    IMAGE:4406872.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACATGACCATAAAATTCAGCCCTGAAAAAAA
  3   1   2       bld He1       in                    IMAGE:4406938.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGATTGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCACAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACGTGACCATAAAATTCAGCACTG
  3   1   2       bld He1       in                    IMAGE:4408043.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACGTGACCATAAAATTCAGCACTGAAAAA
  3   1   2       bld He1       in                    IMAGE:4408023.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCATGAAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACATGACCATAAAATTCAGCACTG
  3   1   2       bld He1                             IMAGE:4406702.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGGTGGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCCACTGCAAATAAAACGTGACCATAAAATTCAGCACTG
  3   1   2       bld He1       in                    IMAGE:4407261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGAAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCACAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACGTGACCATAAAATTCAGCACTGAAAAAAAAAAAAAAA
  3   1   2       bld He1                             IMAGE:4408453.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGAAACAACTACAGAAGCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCGCAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACGTGACCATAAAATTCAGCACTGAAAA
  3   1   2       bld He1       in                    IMAGE:4408877.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTGGAGGGCCGAGTCCGAGAACTGGACAATGAACTGGAAGCTGAACAGAAGCGAAATGCTGAGTCAATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGCTTACCTACCAGACTGATGAAGACAAGAAGAATATGGCACGCCTGCAAGACCTTGTAGACAAACTGCAGCTTAAAGTAAAGGCTTACAAGCGACAGGCTGAGGAAGCTGAGGAACAAGCCAACTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCACGAGCTGGATGAGGCTGAAGAAAGGGCAGATATTGCTGAGTCCCAGGTCAACAAGATAAGAGCCAAAACCCGGGATGTGGGAGGCAAGAAGACACTCCATGAGGAAGAGTAGAAATCATAGACCCACAGAAGCACAACATGGATGCCTAAATTGTACATAACCTGTTAATCAGCATCAAATAAAACGTGACCATAAAATTCAGCACTGAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)