Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Feb 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8640998.3.5                    18 END     3           8       16                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6639168.5                      16 PI      94          8     1656                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:4056580-IMAGp.5                10 PI      93       2596     2893                (no blast hit)
     4   0.0    0Xl3.1-XL487d08ex.5                          3 PI      91       1722     1863                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012838044 Xl3.1-IMAGE:8071801.5.5 - 34 ESTs
                                                                       .......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8071801.5.5                                                          CACAAGCAACGACTGAGCCAGTGCAGCGAGCCTGGGGCGCCGCCTCGTCATCCGCGTTCTCGCTCCCCACCAGAGAGACGGCCACACCCACGGAGGCGCAGACGGAACGAGCCGTGTAATCGCCGCCGCAGCAGCTCCGGAGAAACTCTCCCCACCGCATTTAATAAAGCAAAACATGGCAGCGGCAGGAGCTGCGTCTAACCCCGGCGGGGGTCCGGAGATGGTGCGGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGGCTTATATCGGCGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATCTGGTCTGTTGGCTGCATTCTTGCTGAGATGCTTTCTAATAGACCCATATTTCCTGGGAAACATTATCTTGACCAGCTTAATCACATACTTGGTATTCTTGGATCTCCATCTCAAGAGGACCTAAACTGTATAATCAATTTAAAAGCTAGGAATTACTTGCTTTCCCTTCCTCACAAAAATAAGGTGCCATGGAACAGACTTTTCCCCAATGCAGATCCCAAAGCTCTAGACTTACTGGACAAGATGCTGACTTTCAACCCCCATAAAAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAGTATTATGACCCAAGTGATGAGCCTGTAGCTGAAGCTCCCTTTAAATTTGAAATGGAGCTTGATGATTTGCCCAAGGAGACTCTGAAGGAGCTAATTTTTGAAGAAACCGCTAGATTCCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTATGGAGGGCAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCGATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTATTATTTTTTTTTTTCTTTTTGTATTGTTTTATAAAGATGCAGTGAATTTCTTTCCATTTTTCTGGGTTTACAGCACTCGGACTTTCACCGGCCCTACACGCTGTATCAAACCACACATTCAAACACTGTGGTATTTGCCATTGTTTTGGGTTTTTTGTTTATTTTTCCCCTCCTTAGTTTTTACTTTTTTTTTTTTTATTTGGGAGAGTTTTTCTCTGGGCACTTTAAATCAATGTAAAGCCCTATTTACTTGCACATATCATTTTAAACAAATTGCAGTTGGAAGCATTGAAATTCTATGGAGCTTATCATATATATATATATAACGGTTACTAGCTTTCTCTAGCACTTAGCAGAACCGAGCAAACTATTTTAACCCTTTCCATGTTTAAGGTCGAAAAGATAATAATGCCCCCTAATAAAATGTGTGTGTACGTGCTTACAGAACTCAACCTCTCATTCTTTTAAGCTGCTGCAATATATTCAAACAGGGAAAAAAAACGGGAAAAACAATTGCCATGCACTGGCCTTCTCTGGTCTGGGTTTTTTTCATGCATGGAGAAATAGTAGTATGTTGAATTTTACATGAGTATAAAGCAAGTGAAACCAAAATCTCGTTACTGTTAGCTGAGGAAGTTTAGAATGAGACTGTGCATTATCACTGCAGAGGTGAAATGCATGCTGTCTGTACAAAGTAAGTGTGGTTAATTTCAGCATTGGAATGAGTGCTTTGATTATAATGCTAACCGAAAGAATCTGCATCTGTAGGTAACGGCGGGTTTTCTTGTCGAGAGAGGCTCTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTATATCTGCTTCATTGAGTCTGGTACCTACAGTTCTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTTGCCCAGCTTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTATTAACATTTCTTTGCAAGTATTTGTTCTTGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAATGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCAGAGTTTTAACAATTTGTCTGCACTGCCTGGAAACATGAACAAAAATTGCACTTGTAAATGAAATAAATTGAAATCTTCTCATTAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012721450                                                                CAACGACTGAGCCAGTGCAGCGAGCCTGGGGCGCCGCCTCGTCATCCGCGTTCTCGCTCCCCACCAGAGAGACGGCCACACCCACGGAGGCGCAGACGGAACGAGCCGTGTAATCGCCGCCGCAGCAGCTCCGGAGAAACTCTCCCCACCGCATTTAATAAAGCAAAACATGGCAGCGGCAGGAGCTGCGTCTAACCCCGGCGGGGGTCCGGAGATGGTGCGGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGGCTTATATCGGCGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATCTGGTCTGTTGGCTGCATTCTTGCTGAGATGCTTTCTAATAGACCCATATTTCCTGGGAAACATTATCTTGACCAGCTTAATCACATACTTGGTATTCTTGGATCTCCATCTCAAGAGGACCTAAACTGTATAATCAATTTAAAAGCTAGGAATTACTTGCTTTCCCTTCCTCACAAAAATAAGGTGCCATGGAACAGACTTTTCCCCAATGCAGATCCCAAAGCTCTAGACTTACTGGACAAGATGCTGACTTTCAACCCCCATAAAAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAGTATTATGACCCAAGTGATGAGCCTGTAGCTGAAGCTCCCTTTAAATTTGAAATGGAGCTTGATGATTTGCCCAAGGAGACTCTGAAGGAGCTAATTTTTGAAGAAACCGCTAGATTCCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTATGGAGGGCAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCGATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTATTATTTTTTTTTTTCTTTTTGTATTGTTTTATAAAGATGCAGTGAATTTCTTTCCATTTTTCTGGGTTTACAGCACTCGGACTTTCACCGGCCCTACACGCTGTATCAAACCACACATTCAAACACTGTGGTATTTGCCATTGTTTTGGGTTTTTTGTTTATTTTTCCCCTCCTTAGTTTTTACTTTTTTTTTTTTTATTTGGGAGAGTTTTTCTCTGGGCACTTTAAATCAATGTAAAGCCCTATTTACTTGCACATATCATTTTAAAxxAAxTGCAGTTGGAAGCATTGAAATTCTAxxGxxxxTxxxxxxxxxATATATATAACGGTTACTAGCTTTCTCTAGCACTTAGCAGAACCGAGCAAACTATTTTAAxxxxxxxxxxxxTTAAGGTCGAAAAGATAATAATGCCCCCTAATAAAATGTGTGTGTACGTGCTTACAGAACTCAACCTCTCATTCTTTTAAGCTGCTGCAATATATTCAAACAGGGAAAxAAxxxGGGAAAxAxxxTTGCCATGCACTGGCCTTCTCTGGTCTGGGTTTTTTTCATGCATGGAGAAATAGTAGTATGTTGAATTTTACATGAGTATAAAGCAAGTGAAACCAAAATCTCGTTACTGTTAGCTGAGGAAGTTTAGAATGAGACTGTGCATTATCACTGCAGAGGTGAAATGCATGCTGTCTGTACAAAGTAAGTGTGGTTAATTTCAGCATTGGAATGAGTGCTTTGATTATAATGCTAACCGAAAGAATCTGCATCTGTAGGTAACGGCGGGTTTTCTTGTCGAGAGAGGCTCTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTATATCTGCTTCATTGAGTCTGGTACCTACAGTTCTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTTGCCCAGCTTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTATTAACATTTCTTTGCAAGTATTTGTTCTTGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAATGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCAGAGTTTTAACAATTTGTCTGCACTGCCTGGAAACATGAACAAAAATTGCACTTGTAAATGAAATAAATTGAAATCTTCTCATTAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                               2     2     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     8     8     9     9     9     9     9    10     9    10     9    11     9    11    11    11    12    12    10    12    12    12    12    12    12    12    12    12    11    12    11    12    13    13    13    13    13    13    13    13    12    12    12    12    11    11    11    11    12    12    12    12    12    12    11    11    11    11    11    11    11    11    10    10     9     9     9     9     9     9     8     8     8     9     6     8     7     8     7     8     6     7     6     7     6     7     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     7     6     8     6     8     6     8     5     8     5     8     6     8     6     8     6     9     7     9     7     9     7     9     7     9     7     9     7    10     7     9     7     9     7     9     7     9     6     9     6     9     7     9     7     9     7     9     8    10     8    10     8    10     8     9     7     8     8     9     8     9     8     9     8     9     8     9     7     8     6     7     7     8     7     8     7     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     6     8     7     8     4     8     4     8     4     8     4     8     5     8     4     8     4     8     4     8     4     8     4     8     4     8     5     8     4     7     4     7     4     7     4     6     2     6     3     6     3     6     2     6     3     6     3     6     2     6     2     6     2     6     3     6     3     7     3     6     3     6     3     6     3     6     2     6     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     2     1     2     1     2     1     2     2     3     2     3     2     3     3     5     3     5     3     5     3     5     4     6     4     7     5     7     5     6     5     7     5     7     6     7     7     7     7     7     6     7     7     7     6     7     6     7     7     7     7     8     7     8     5     7     6     7     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     7     9     7     9     9     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     5     7     5     7     4     6     3     4     3     3     3     3     3     3     2     3
  5   1   2      ests                            Xl3.1-IMAGE:8071801.5                                                          CACAAGCAACGACTGAGCCAGTGCAGCGAGCCTGGGGCGCCGCCTCGTCATCCGCGTTCTCGCTCCCCACCAGAGAGACGGCCACACCCACGGAGGCGCAGACGGAACGAGCCGTGTAATCGCCGCCGCAGCAGCTCCGGAGAAACTCTCCCCACCGCATTTAATAAAGCAAAACATGGCAGCGGCAGGAGCTGCGTCTAACCCCGGCGGGGGTCCGGAGATGGTGCGGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGGCTTATATCGGCGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATCTGGTCTGTTGGCTGCATTCTTGCTGAGATGCTTTCTAATAGACCCATATTTCCTGGGAAACATTATCTTGACCAGCTTAATCACATACTTGGTATTCTTGGATCTCCATCTCAAGAGGACCTAAACTGTATAATCAATTTAAAAGCTAGGAATTACTTGCTTTCCCTTCCTCACAAAAATAAGGTGCCATGGAACAGACTTTTCCCCAATGCAGATCCCAAAGCTCTAGACTTACTGGACAAGATGCTGACTTTCAACCCCCATAAAAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAGTATTATGACCCAAGTGATGAGCCTGTAGCTGAAGCTCCCTTTAAATTTGAAATGGAGCTTGATGATTTGCCCAAGGAGACTCTGAAGGAGCTAATTTTTGAAGAAACCGCTAGATTCCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTATGGAGGGCAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCGATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTATTATTTTTTTTTTTCTTTTTGTATTGTTTTATAAAGATGCAGTGAATTTCTTTCCATTTTTCTGGGTTTACAGCACTCGGACTTTCACCGGCCCTACACGCTGTATCAAACCACACATTCAAACACTGTGGTATTTGCCATTGTTTTGGGTTTTTTGTTTATTTTTCCCCTCCTTAGTTTTTACTTTTTTTTTTTTTATTTGGGAGAGTTTTTCTCTGGGCACTTTAAATCAATGTAAAGCCCTATTTACTTGCACATATCATTTTAAACAAATTGCAGTTGGAAGCATTGAAATTCTATGGAGCTTATCATATATATATATATAACGGTTACTAGCTTTCTCTAGCACTTAGCAGAACCGAGCAAACTACTATTTTAACCC
  5   1   2      ests                            Xl3.1-IMAGE:6876627.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAATAGTAGTATGTTGAATTTTACATGAGTATAAAGCAAGTGAAACCAAAATCTCGTTACTGTTAGCTGAGGAAGTTTAGAATGAGACTGTGCATTATCACTGCAGAGGTGAAATGCATGCTGTCTGTACAAAGTAAGTGTGGTTAATTTCAGCATTGGAATGAGTGCTTTGATTATAATGCTAACCGAAAGAATCTGCATCTGTAGGTAACGGCGGGTTTTCTTGTCGAGAGAGGCTCTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTATATCTGCTTCATTGAGTCTGGTACCTACAGTTCTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTTGCCCAGCTTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTATTAACATTTCTTTGCAAGTATTTGTTCTTGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAATGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCAGAGTTTTAACAATTTGTCTGCACTGCCTGGAAACATGAACAAAAATTGCACTTGTAAATGAAATAAATTGAAATCTTCTCA
                                               BLH ATG     175    1917                                                          
                                               BLH MIN     169     317                                                          
                                               BLH OVR     175     986                                                          
                                               ORF LNG     175      83                                                          
  5   1   2      ests                            Xl3.1-IMAGE:8071801.5                                                          CACAAGCAACGACTGAGCCAGTGCAGCGAGCCTGGGGCGCCGCCTCGTCATCCGCGTTCTCGCTCCCCACCAGAGAGACGGCCACACCCACGGAGGCGCAGACGGAACGAGCCGTGTAATCGCCGCCGCAGCAGCTCCGGAGAAACTCTCCCCACCGCATTTAATAAAGCAAAACATGGCAGCGGCAGGAGCTGCGTCTAACCCCGGCGGGGGTCCGGAGATGGTGCGGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGGCTTATATCGGCGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATCTGGTCTGTTGGCTGCATTCTTGCTGAGATGCTTTCTAATAGACCCATATTTCCTGGGAAACATTATCTTGACCAGCTTAATCACATACTTGGTATTCTTGGATCTCCATCTCAAGAGGACCTAAACTGTATAATCAATTTAAAAGCTAGGAATTACTTGCTTTCCCTTCCTCACAAAAATAAGGTGCCATGGAACAGACTTTTCCCCAATGCAGATCCCAAAGCTCTAGACTTACTGGACAAGATGCTGACTTTCAACCCCCATAAAAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAGTATTATGACCCAAGTGATGAGCCTGTAGCTGAAGCTCCCTTTAAATTTGAAATGGAGCTTGATGATTTGCCCAAGGAGACTCTGAAGGAGCTAATTTTTGAAGAAACCGCTAGATTCCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTATGGAGGGCAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCGATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTATTATTTTTTTTTTTCTTTTTGTATTGTTTTATAAAGATGCAGTGAATTTCTTTCCATTTTTCTGGGTTTACAGCACTCGGACTTTCACCGGCCCTACACGCTGTATCAAACCACACATTCAAACACTGTGGTATTTGCCATTGTTTTGGGTTTTTTGTTTATTTTTCCCCTCCTTAGTTTTTACTTTTTTTTTTTTTATTTGGGAGAGTTTTTCTCTGGGCACTTTAAATCAATGTAAAGCCCTATTTACTTGCACATATCATTTTAAACAAATTGCAGTTGGAAGCATTGAAATTCTATGGAGCTTATCATATATATATATATAACGGTTACTAGCTTTCTCTAGCACTTAGCAGAACCGAGCAAACTACTATTTTAACCC
                                                  Xl3.1-CHK-1012688946                                                                CAACGACTGAGCCAGTGCAGCGAGCCTGGGGCGCCGCCTCGTCATCCGCGTTCTCGCTCCCCACCAGAGAGACGGCCACACCCACGGAGGCGCAGACGGAACGAGCCGTGTAATCGCCGCCGCAGCAGCTCCGGAGAAACTCTCCCCACCGCATTTAATAAAGCAAAACATGGCAGCGGCAGGAGCTGCGTCTAACCCCGGCGGGGGTCCGGAGATGGTGCGGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGGCTTATATCGGCGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATCTGGTCTGTTGGCTGCATTCTTGCTGAGATGCTTTCTAATAGACCCATATTTCCTGGGAAACATTATCTTGACCAGCTTAATCACATACTTGGTATTCTTGGATCTCCATCTCAAGAGGACCTAAACTGTATAATCAATTTAAAAGCTAGGAATTACTTGCTTTCCCTTCCTCACAAAAATAAGGTGCCATGGAACAGACTTTTCCCCAATGCAGATCCCAAAGCTCTAGACTTACTGGACAAGATGCTGACTTTCAACCCCCATAAAAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAGTATTATGACCCAAGTGATGAGCCTGTAGCTGAAGCTCCCTTTAAATTTGAAATGGAGCTTGATGATTTGCCCAAGGAGACTCTGAAGGAGCTAATTTTTGAAGAAACCGCTAGATTCCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTATGGAGGGCAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCGATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTATTATTTTTTTTTTTCTTTTTGTATTGTTTTATAAAGATGCAGTGAATTTCTTTCCATTTTTCTGGGTTTACAGCACTCGGACTTTCACCGGCCCTACACGCTGTATCAAACCACACATTCAAACACTGTGGTATTTGCCATTGTTTTGGGTTTTTTGTTTATTTTTCCCCTCCTTAGTTTTTACTTTTTTTTTTTTTATTTGGGAGAGTTTTTCTCTGGGCACTTTAAATCAATGTAAAGCCCTATTTACTTGCACATATCATTTTAAAxxAAxTGCAGTTGGAAGCATTGAAATTCTAxxGxxxxTxxxxxxxxxATATATATAACGGTTACTAGCTTTCTCTAGCACTTAxxAGxAxxxxxxAxxxxACTATTTTAACCCTTTCCA
  5   1   2       bld Ov1  5g                IMAGE:4055472-IMAGp.IMAGp TCCTCCCcacacacacacacCCAGCGGGCGGGAAGGCGTCAGCTCGGCAGCGTCTAACACAAGCAACGACTGAGCCAGTGCAGCGAGCCTGGGGCGCCGCCTCGTCATCCGCGTTCTCGCTCCCCACCAGAGAGACGGCCACACCCACGGAGGCGCAGACGGAACGAGCCGTGTAATCGCCGCCGCAGCAGCTCCGGAGAAACTCTCCCCACCGCATTTAATAAAGCAAAACATGGCAGCGGCAGGAGCTGCGTCTAACCCCGGCGGGGGTCCGGAGATGGTGCGGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGGCTTATATCGGCGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATCTGGTCTGTTGGCTGCATTCTTGCTGAGATGCTTTCTAATAGACCCATAT
  5   1   2       bld Emb4 5g                         IMAGE:4957750.5p                                                          CACAAGCAACGACTGAGCCAGTGCAGCGAGCCTGGGGCGCCGCCTCGTCATCCGCGTTCTCGCTCCCCACCAGAGAGACGGCCACACCCACGGAGGCGCAGACGGAACGAGCCGTGTAATCGCCGCCGCAGCAGCTCCGGAGAAACTCTCCCCACCGCATTTAATAAAGCAAAACATGGCAGCGGCAGGAGCTGCGTCTAACCCCGGCGGGGGTCCGGAGATGGTGCGGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGCCTCATATCGGGGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACCTTTTAAACATGAAAACCTCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAAATGAAAGAATGTGACATTGTGCAGGACCTCATGGAGACAGAACTCTATAAGCTCCTGAAGACTCAGCATCCTAGCAATGACCCTATCTGCTATTTCTTG
  5   1   2       bld Ga12 5g                              XL210d09.5p                                                                    GGCTGAGCCAGTGCAGCGAGCCTGGGGCGCCGCCTCGTCATCCGCGTTCTCGCTCCCCACCAGAGAGACGGCCACACCCACGGAGGCGCAGACGGAACGAGCCGTGTAATCGCCGCCGCAGCAGCTCCGGAGAAACTCTCCCCACCGCATTTAATAAAGCAAAACATGGCAGCGGCAGGAGCTGCGTCTAACCCCGGCGGGGGTCCGGAGATGGTGCGGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGGCTTATATCGGCGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTC
  5   1   2       bld Em10 5g                         IMAGE:8322374.5p                                                                      CTGAGCCAGTGCAGCGAGCCTGGGGCGCCGCCTCGTCATCCGCGTTCTCGCTCCCCACCAGAGAGACGGCCACACCCACGGAGGCGCAGACGGAACGAGCCGTGTAATCGCCGCCGCAGCAGCTCCGGAGAAACTCTCCCCACCGCATTTAATAAAGCAAAACATGGCAGCGGCAGGAGCTGCGTCTAACCCCGGCGGGGGTCCGGAGATGGTGCGGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGGCTTATATCGGCGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGA
  5   1   2       bld DMZ  5g3  in                         xl341m01.5p                                                                                                                                      GACGGCCACACCCACGGAGGCGCAGACGGAACGAGCCGTGTAATCGCCGCCGCAGCAGCTCCGGAGAAACTCTCCCCACCGCATTTAATAAAGCAAAACATGGCAGCGGCAGGAGCTGCGTCTAACCCCGGCGGGGGTCCGGAGATGGTGCGGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGGCTTATATCGGCGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCANATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTC
  5   1   2      seed FaB  5g                         IMAGE:8071801.5p                                                                                                                                                                     CGAGCCGTGTAATCGCCGCCGCAGCAGCTCCGGAGAAACTCTCCCCACCGCATTTAATAAAGCAAAACATGGCAGCGGCAGGAGCTGCGTCTAACCCCGGCGGGGGTCCGGAGATGGTGCGGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGGCTTATATCGGCGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATC
  5   1   2       bld Lu1                             IMAGE:4633515.5p                                                                                                                                                                                                                                                                                             GGGGCCAGGCGTTCGACGTAGGCCCTCGATACATCAATCTGGCTTATATCGGCGAGGGAGCGTACGGCATGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACT
  5   1   2       bld DMZ       in                         xl326l10.5p                                                                                                                                                                                                                                                                                                                                                                  TGGTGTGTTCTGCCCATGACAATGTTAACAAAGTTCGAGTTGCTATCAAGAAAATCAGCCCATTTGAGCATCANACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACNTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCANGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATT
  5   1   2       bld Ga12                                 XL154o02.5p                                                                                                                                                                                                                                                                                                                                                                                CATGACAATGTTNACAAAGTTCGAGNTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAACATTGCGGGAGATCAAAATCTTGCTACGNTNTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCA
  5   1   2       bld Oo1                             IMAGE:5084178.5p                                                                                                                                                                                                                                                                                                                                                                                                          TTGCTATCAAGAAAATCAGCCCATTTGAGCATCAGACATACTGCCAGCGAAATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATCTGGTCTGTTGGCTGCATTCTTGCTGAGATGCTTTCTAATAGACCCATATTTCCTGGGAAACATTATCTTGACCAGCTTAATCACATACTTGGTATTCTTGGATCTCCATCTCAAGAGGACCTAAACTGTATAATCAATTTAAAAGCTAGGAATTACTTGGTTTCCCTTCCTCACAAAAATAAGGTGCCATGGAACAGAACTTNTTCCCCAATGCAGATCCCAAAGGGTCTAGACTTTACTGGGAAAAGAAGGTTGAACTTTTCCAACCCCCCCATaaaaaaaatttgaaaagtaaaaaGGGCAAGCCTTTTGGGGCTTTAAATCCCCTTAAATTCTTGGGAAGCT
  5   1   2       bld Oo1                             IMAGE:6856769.5p                                                                                                                                                                                                                                                                                                                                                                                                                             GCTGGACCGGTCCGGATTCTCCGATAGCGAACATTGCGGGAGATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATCTGGTCTGTTGGCTGCATTCTTGCTGAGATGCTTTCTAATAGACCCATATTTCCTGGGAAACATTATCTTGACCAGCTTAATCACATACTTGGTATTCTTGGATCTCCATCTCAAGAGGACCTAAACTGTATAATCAATTTAAAAGCTAGGAATTACTTGCTTTCCCTTCCTCACAAAAATAAGGTGCCATGGAACAGACTTTTCCCCAATGCAGATCCCAAAGCTCTAGACTTACTGGACAAGATGCTGACTTTCCACCCCCCATACAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAAGAATATGACCCCAGTGGATGAGCCCTGTAGCTGGAGCCTCCCTTTAAATTTGGAAAGGGAGCCTTGATAATTTTCCCCAGGGAAGACTCTGAAAGGAGCTAAATTTTTGAAAAAAACCCCCTTAGATTCCCAGCCAGGGGTTACTGAACCCCCCCTTCAAACCACCCGGGCAAAGG
  5   1   2       bld Egg1                               PBX0108F08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGGACATCAAAATCTTGCTACGTTTTAAACATGAAAACATCATTGGGATAAACGACATTATTCGCGCTCCAACCATTGAGCAGATGAAAGATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGA
  5   1   2       bld Tbd7      out                        XL058j23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGTGTACATTGTGCAGGACCTCATGGAGACAGACCTCTATAAGCTCCTGAAGACTCAGCATCTTAGCAATGACCATATCTGCTATTTCTTGTACCAGATTCTGAGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATCTGGTCTGTTGGCTGCATTCTTGCTGAGATGCTTTCTAATAGACCCATATTTCCTGGGAAACATTATCTTGACCAGCTTAATCACATACTTGGTATTCTTGGATCTCCATCTCAAGAGGACCTAAACTGTATAATCAATTTAAAAGCTAGGAATTACTTGCTTTCCCTTCCTCACAAAAATAAGGTGCCATGGAACAGACTTTTCCCCAATGCAGATCCCAAAGCTCTAGACTTA
  5   1   2       bld Tad1      in                    IMAGE:6878897.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGAGGATTAAAGTACATCCATTCAGCCAATGTTCTACATCGTGATCTTAAGCCTTCAAATTTGCTGCTTAACACTACCTGTGATCTCAAGATCTGTGATTTTGGATTGGCTCGTGTTGCAGACCCAGATCATGATCACACTGGCTTTCTCACAGAATATGTAGCCACTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATCTGGTCTGTTGGCTGCATTCTTGCTGAGATGCTTTCTAATAGACCCATATTTCCTGGGAAACATTATCTTGACCAGCTTAATCACATACTTGGTATTCTTGGATCTCCATCTCAAGAGGACCTAAACTGTATAATCAATTTAAAAGCTAGGAATTACTTGCTTTCCCTTCCTCACAAAAATAAGGTGCCATGGAACAGACTTTTCCCCAATGCAGATCCCAAAGCTCTAGACTTACTGGACAAGATGCTGACTTTCAACCCCCATAAAAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAGTATTATGACCCAAGTGATGAGCCTGTAGCTGAAGCTCCCTTTAAATTTGAAATGGAGCTTGATGATTTGCCCAAGAGACTCTGAANGAGCTAATTTTTGAAGAAACCGCTAGATTCAGCCAGGGTACTGACCCACATCTAACACCAGGGAAGGATGTGAAGGACTTTGCTGAAACATCCGTGGTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGGTCCGTGCTCCATCTCAGCTGGGCCAAGTCTATTAACTTCTTTG
  5   1   2       bld Tbd7      in                         XL055b06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGCTTTCTCACAGAATATGTAGCCCTCGCTGGTACAGAGCTCCTGAGATCATGCTGAATTCCAAGGGCTATACCAAATCAATTGACATCTGGTCTGTTGGCTGCATTCTTGCTGAGATGCTTTCTAATAGACCCATATTTCCTGGGAAACATTATCTTGACCAGCTTAATCACATACTTGGTATTCTTGGATCTCCATCTCAAGAGGACCTAAACTGTATAATCAATTTAAAAGCTAGGAATTACTTGCTTTCCCTTCCTCACAAAAATAAGGTGCCATGGAACAGACTTTTCCCCAATGCAGATCCCAAAGCTCTAGACTTACTGGACAAGATGCTGACTTTCAACCCCCATAAAAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAGTATTATGACCCAAGTGATGAGCCTGTAGCTGAAGCTCCCTTTAAATTTGAAATGGAGCTTGATGATTTGCCCAAGGAGACTCTTAAGGAGCTAATTTTTGAAGAAACCGCTAGATTCCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGT
  5   1   2       bld Egg1                               PBX0149H07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATCTCCATCTCAAGAGGACCTAAACTGTATAATCAATTTAAAAGCTAGGAATTACTTGCTTTCCCTTCCTCACAAAAATAAGGTGCCATGGAACAGACTTTTCCCCAATGCAGATCCCAAAGCTCTAGACTTACTGGACAAGATGCTGACTTTCAACCCCCATAAAAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAGTATTATGACCCAAGTGATGAGCCTGTAGCTGAAGCTCCCTTTAAATTTGAAATGGAGCTTGATGATTTGCCCAAGGAGACTCTGAAGGAGCTAATTTTTGAAGAAACCGCTAGATTCCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTAT
  3   1   2       add Int2                            IMAGE:8821690.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGATTCTTGGTAGTTAACAATTGTATGATCCTTCAGAGCTAACGTTAATAAGAGATCGTTCCTTCCCAAATAGGCAGGACACTACCATGCGATCCCAAGGCTTAACTTACTGACAAGATGCTGACTTCAACCCCTTAAGAATTGAGTAGAGCAAGTTTGCTCATCTATTGAGCAGTATATGACCAGTGATGAGCTGTAGCTGAGCTCCGTTAAATTTGAAATGAGCTTGATGATTGCCCAAGGAGACTCTGAAGGAGCTAATTTTGAAGAAACCGCTAGATTCCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTATGGAGGGCAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCGATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTATTATTTTTTTTTTTCTTTTTGTATTGTTTTATAAAGATGCAGTGAATTTCTTTCCATTTTTCTGGGTTTACAGCACTCGGACTTTCACCGGCCCTACACGCTGTATCAAACCACACATTCAAACACTGTGGTATTTGCCATTGTTTTGGGTTTTTTGTTTATTTTTCCCCTCCTTAGTTTTTATTTTTTTTTTTTTTATTTGCACGAGCACTCATATGGGCACTTTAAACCAATGTAACGCCTCGACCACTTGCACATATCATTTTAAACAAATGCAGTCGGAAGCATTGAAAGTTTAATGGAGCTTATCACCTATATATATATATATAACGGTTACTAGCTTCAATAGCTTTTAGCAGAACCGAGCAAACTATTTTAACCCTTTCCAGTATAAGGTCGAAAAGATACAAAACTATCGCGCAGATA
  5   1   2       bld Tad2                            IMAGE:6935324.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGCCCGGGGAAATCTCTGTTGGAGGAGAAAGGAAGCAGCTCTGGATTGAAACAGCTCTAGACTTACTGGACAAGATGCTGACTTTCAACCCCCATAAAAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAGTATTATGACCCAAGTGATGAGCCTGTAGCTGAAGCTCCCTTTAAATTTGAAATGGAGCTTGATGATTTGCCCAAGGAGACTCTGAAGGAGCTAATTTTTGAAGAAACCGCTAGATTTCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTATGGAGGGCAATTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCCATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTATTAttttttttttttctttttGAATTGGTTTATAAAGATGCAGTGAATTTCCTTTCCATTTTTCTGGGGTTTACAGCACTTCGGACTTTTCCCCGGCCCCTTACACGCTGGATTCAAACCCCCCCATTCCAACACCTGGGGGTATTTTGCCCATTGGTTTTG
  5   1   2       bld Eye1                            IMAGE:6945081.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCTCTAGACTTACTGGACAAGATGCTGACTTTCAACCCCCATAAAAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAGTATTATGACCCAAGTGATGAGCCTGTAGCTGAAGCTCCCTTTAAATTTGAAATGGAGCTTGATGATTTGCCCAAGGAGACTCTGAAGGAGCTAATTTTTGAAGAAACCGCTAGATTCCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTATGGAGGGCAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCGATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTATTAtttttttttttctttttGTATTGTTTTATAAAGATGCAGTGAATTTCTTTCCATTTTTCTGGGTTTACAGCACTCGGACTTTCACCGGCCCTACACGCTGTATCAAACCACACATTCAAACACTGTGGTATTTGCCATTgttttgggttttttgtttatttttcccctccttagtttttactttttttttttttATTTGGGAGAGTTTTTCTCTGGGCACTTTAAATCAATGTAAAGCCCTATTTACTTGCACATATCATTTTAAAACAAATGCAGTTGTAAGCATTGAAATTCTAAAGGAGCTTATCCTATATATATAATTTTTAACGGTTTAC
  3   1   2       bld Tad1      in                    IMAGE:6878897.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGATTTTCAACCCCCCTAAAAGAATTGAAGTAGAGGCAGCTTTGGCTCATCCTTATCTGGAGCAGTATTATGACCCAAGTGATGAGCCTGTAGCTGAAGCTCCTTTAAAATTGAAAATGGAGCTTGATGATTGCCCCAAGGAGACTCTGAAGGAGCTAATTTTTGAAGAAACCGCTAGATTCCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTATGGAGGGCAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCGATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTATTATTTTTTTTTTTCTTTTTGTATTGTTTTATAAAGATGCAGTGAATTTCTTTCCATTTTTCTGGGTTTACAGCACTCGGACTTTCACCGGCCCTACACGCTGTATCAAACCACACATTCAAACACTGTGGTATTTGCCATTGTTTTGGGTTTTTTGTTTATTTTTCCCCTCCTTAGTTTTTACTTTTTTTTTTTTTATTTGGGAGAGTTTTTCTCTGGGCACTTTAAATCAATGTAAAGCCCTATTTACTTGCACGTATCATTTTAAACAAATGCAGTTGTAAGCATTGAAATTCTAATGGAGCTTATCATATATATATATATAACGGTTACTAGCTTTCTCTAGCACTTAGCAGAACCGAGCAAACTATTTTACCCTTTCCATGTAAAGGTGAGGCG
  5   1   2       bld Brn3                            IMAGE:8537303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTGATGAGCCTGTAGCTGAAGCTCCCTTTAAATTTGAAATGGAGCTTGATGATTTGCCCAAGGAGACTCTGAAGGAGCTAATTTTTGAAGAAACCGCTAGATTCCAGCCAGGGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTATGGAGGGCAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCCGATGAATTCTTTCTATATGGAGAATTGTTCTTGACACTCCTTAGTGATAGTGGTGCGGCGAACAGACTTCTGCTGAGACCTTCTTTTATCCGGTTGTACAATTGGTTTTTTGGCCTTGGGTTCTGTTTCTTTAAGATTCTGTTTTTTTACTGCTCCCTCTTTCTGGGGTTTACAGGTCTTCGGACTATATACAGTGTGTTTCTCTTTGCTCTACATCTTTCTTTTTATTTGTGATGTCTGTGGCGCTGTTTTAGTTTCTTGTACCTTGTCCCATAGTTTGTGGTTCttttttttttctgatcatttgtttatttttatttgttcctttttttcctatgggtgcctaaatttttttactttttGAATGGTTATATTATTCAATTGATTTTAAGTCTTTGATGTTTTACTTATTGCTTGCCTATTCGCTTTAACTTCTTTCGGTGtttttttttggtctgttttttatttttccgtttgtctttttattaaaacatttttttGTC
  5   1   2       bld Ga12      out                        XL195i12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTACTGACCACCATCTAACCACAGGGAAAGGATGTGAAGGACTTTGCTGAGACATCGGTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTAACTTCTTTGAGCCATTATGGAGGGCAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCGATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTAtttttttttttctttttGAATNGTTTTATAAANATGCAGNGAATTTCTTTCCATTTTTCNGGGTTTACAGCACTCGGACTTTCACCGGCCCTACNCGCTGTATCAAACCACACATTCAAACACTGGGGnatttgccattgttttgggttttttgttnatttttccccncctnagtttttacttttttttttttNNT
  5   1   2       bld FaBN      out                   IMAGE:8074768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGTTGTTCTTGCCAGTTCTTCCTCCTTGGGCGTGTCCTGTGCTCCATCTCAGCTTGTCCAGTCTATAACTTCTTTGAGCCATTATGGAGGGCAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCGATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTATTAttttttttttctttttGTATTGTTTTATAAAGATGCAGTGAATTTCTTTCCATTTTTCTGGGTTTACAGCACTCGGACTTTCACCGGCCCTACACGCTGTATCAAACCACACATTCAAACACTGTGGTATTTGCCATTgttttgggttttttgtttatttttcccctccttagtttttacttttttttttttATTTGGGAGAGTTTTTCTCTGGGCACTTTAAATCAATGTAAAGCCCTATTTACTTGCACATATCATTTTAAACAAATGCAGTTGTAAGCATTGAAATTCTAATGGAGCTTATCatatatatatatatataACGGTTACTAGCTTTCTCTAGCACTTAGCAGAACCGAGCAAACTATTTTAACCCTTTCCATGTTTAAGGTCGAAAAGATAATAATGCCCCCTAATAAAATGTGTGTGTACGTGCTTACAGAACTCAACCTCTCATTCTTTTAAGCTGCTGCAATATATTCAAACAGGGAAAAAAACTTTGGGCATTTTTGCATGCA
  5   1   2       bld Tad2      in                    IMAGE:6876627.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGTTCCTGGTAGTTGTGGCTTTTTATGCTTCTGATGAATTCTTTCGATATGGAGAATTGTTCTTGACACTCCTTTGTGAAAGTGGTGCGGCAAACACACACCTGCTGAGACCTTCATTAACCGCTTGTACATTATTAtttttttttttctttttGTATTGCTTTATAAAGATGCAGTGAATTTCTTTCCATTTTTCTGGGTTTACAGCACTCGGACTTTCACCGGCCCTACACGCTGTATCAAACCACACATTCAAACACTGTGGTATTTGCCATTgttttgggttttttgtttatttttcccctccttagtttttacttttttttttttttATTTGGGAGAGTTTTTCTCTGGGCACTTTAAATCAATGTAAAGCCCTATTTACTTGCACATATCATTTTAAACAAATGCAGTTGGAAGCATTGAAATTCTAATGGAGCTTATCatatatatatatatataACGGTTACTACCTGTCTCTAACACTTAGCAGAACCGAGCGAACTATTTTAACCCTTTCCATGTTTAAAGTCGAAAACATAATAATAGCCCCCTAATACAATGGGGTGTGTACGTTGCTTACAGAAACTTCAACCTCCCGTTCTCTTTAAGGCTGTTGCAATATATTCCCAACGGGGGAAAAACAATCTTTTGGGGGAATTTTTTTGCCACCTGCAATTGGGCCCTTTCCTCGGGGCGCCGGGGCTCTTTATTTTCAAGGCCTCCGGGGGAAAGTATGGGAAAATTGGCGGAAAATTTTTTTCCCTGAGAATAATTAAACCCCCAAGGGGGAGAACCCCCAAAATTTCCGCGCCCGTAAAGTGGC
  5   1   2      ests                            Xl3.1-IMAGE:6876627.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAATAGTAGTATGTTGAATTTTACATGAGTATAAAGCAAGTGAAACCAAAATCTCGTTACTGTTAGCTGAGGAAGTTTAGAATGAGACTGTGCATTATCACTGCAGAGGTGAAATGCATGCTGTCTGTACAAAGTAAGTGTGGTTAATTTCAGCATTGGAATGAGTGCTTTGATTATAATGCTAACCGAAAGAATCTGCATCTGTAGGTAACGGCGGGTTTTCTTGTCGAGAGAGGCTCTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTATATCTGCTTCATTGAGTCTGGTACCTACAGTTCTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTTGCCCAGCTTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTATTAACATTTCTTTGCAAGTATTTGTTCTTGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAATGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCAGAGTTTTAACAATTTGTCTGCACTGCCTGGAAACATGAACAAAAATTGCACTTGTAAATGAAATAAATTGAAATCTTCTCA
                                                  Xl3.1-CHK-1012695508                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTAGTATGTTGAATTTTACATGAGTATAAAGCAAGTGAAACCAAAATCTCGTTACTGTTAGCTGAGGAAGTTTAGAATGAGACTGTGCATTATCACTGCAGAGGTGAAATGCATGCTGTCTGTACAAAGTAAGTGTGGTTAATTTCAGCATTGGAATGAGTGCTTTGATTATAATGCTAACCGAAAGAATCTGCATCTGTAGGTAACGGCGGGTTTTCTTGTCGAGAGAGGCTCTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTATATCTGCTTCATTGAGTCTGGTACCTACAGTTCTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTTGCCCAGCTTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTATTAACATTTCTTTGCAAGTATTTGTTCTTGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAATGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCAGAGTTTTAACAATTTGTCTGCACTGCCTGGAAACATGAACAAAAATTGCACTTGTAAATGAAATAAATTGAAATCTTCTCATTAATT
  5   1   2       bld Egg1                               PBX0079A08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAACGGTTACTAGCTTTCTCTAGCACTTAGCAGAACCGAGCAAACTATTTTAACCCTTTCCATGTTTAAGGTCGAAAAGATAATAATGCCCCCTAATAAAATGTGTGTGTACGTGCTTACAGAACTCAACCTCTCATTCTTTTAAGCTGCTGCAATATATTCAAACAGGGaaaaaaaaCTTTGGGCATTTTTGCCATGCACTGGCCTTCTCTGGTCTGGGTTTTTTTCATGCATGGAGAAATAGTAGTATGTTGAATTTTACATGAGTATAAAGCAAGTGAAACCAAAATCTCGTTACTGTTAGCTGAGGAAGTTTAGAATGAGACTGTGCATTATCACTGCAGAGGTGAAATGCATGCTGTCTGTACAAAGTAAGTGTGGTTAATTTCAGCATTGGAATGAGTGCTTTGATTATAATGCTAACCGAAAGAATCTGCATCTGTAGGTAACGGCGGGTTTTCTTGTCGAGAGAGGCTCTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTATATCT
  3   1   2       bld DMZ       in                         xl326l10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAATAGTAGTATGTTGAATTTTACATGAGTATAAAGCAAGTGAAACCAAAATCTCGTTACTGTTAGCTGAGGAAGTTTAGAATGAGACTGTGCATTATCACTGCAGAGGTGAAATGCATGCTGTCTGTACAAAGTAAGTGTGGTTAATTTCAGCATTGGAATGAGTGCTTTGATTATAATGCTAACCGAAAGAATCTGCATCTGTAGGTAACGGCGGGTTTTCTTGTCGAGAGAGGCTCTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTATATCTGCTTCANTGAGTCTGGTACCTACAGTTCTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTTGCCCAGCTTGGAGCAACCCGCCAAACTAGCANTAATTTTANACTATTAACATTTCTTTGCAAGTATTNGTTCTNGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCANGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAATGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTNTTCTGTCTTTCCTTGTCC
  3   1   2       add DMZ  5g3  in                         xl341m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGTATNAAGCAAGTGAAACCAAAATCTCGTTACTGTTAGCTGAGGAAGTTTAGAATGAGACTGTGCATTATCACTGCAGAGGTGAAATGCATGCTGTCTGTACAAAGTAAGTGTGGTTAATNTCAGCATNGGAATGAGTGCTTTGATTATAATGCTAACCGAAAGAATCNGCATNNGTAGGTAACGGCGGGTTTTCTAGTCGAGAGAGGNTNTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTANATCNGCTTCATTGAGTCTGGTACCTACAGTTNTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTTGCCCAGCNTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTANTAACATTTCTTTGCAAGTATTTGTTCNNGGAATNGTATAATGTGGAGTTTANTAGATGNTANGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAANGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCAGAGNTTTAACAATTTGTCTGCACTGCCTGGAAACATGAACAAAAAT
  3   1   2       bld Tad2      in                    IMAGE:6876627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGAAACCCAAAATCTCGTTACTGTTAGCTGAGGATGTTTAGAATGAGACTGTGCATTATCATTGCAGAGGTGAAAATGCATGCTGTCTGTACAAGGTAAGTGTGGTTAATTTCAGCATTGGAATGAGTGCTTTGATTATAATGCTAACCGAAAGAATTTGCATCTGTAGGTAACGGCGGGTTTTCTTGTCGAGAGAGGCTCTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTATATCTGCTTCATTGAGTCTGGTACCTACAGTTCTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTTGCCCAGCTTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTATTAACATTTCTTTGCAAGTATTTGTTCTTGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAATGTTATTCTGTAACTTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCAGAGTTTTAACAATTTGTCTGCACTGCCTGGAAACATGAACAAAAATTGCACTTGTAAATGAAATAAATTGAAATCTTCTCATTAATTTACAGGTTTATTAATTTTTTTTTCTCCAATTTAATTTGCTTTGAAAGCAGTTTCTGTGACGTTTGTGATTTCTTGCTATGCATTTCGGATTTTTTTGAGCACNGACCTTTGTA
  3   1   2       bld Tbd7      in                         XL055b06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTAGAATGAGACTGTGCATTATCACTGCAGAGGTGAAATGCATGCTGTCTGTACAAAGTAAGTGTGGTTAATTTCAGCATTGGAATGAGTGCTTTGATTATAATGCTAACCGAAAGAATCTGCATCTGTAGGTAACGGCGGGTTTTCTTATCGAGAGAGGCTCTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTATATCTGCTTCATTGAGTCTGGTACCTACAGTTCTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTTGCCCAGCTTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTATTAACATTTCTTTGCAAGTATTTGTTCTTGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAATGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCAGAGTTTTAACAATTTGTCTGCACTGCCGGAAACANAACAAAAAT
  5   1   2       bld Egg1                               PBX0071F04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCACGAGGGCAGAGGTGAAATGCATGCTGTCTGTACAAAGTAAGTGTGTTAATTTCAGCATTGGAATGAGTGCTTTGATTATAATGCTAACCGAAAGAATCTGCATCTGTAGGTAACGGCGGGTTTTCTTGTCGAGAGAGGCTCTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTATATCTGCTTCATTGAGTCTGGTACCTACAGTTCTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTTGCCCAGCTTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTATTAACATTTCTTTGCAAGTATTTGTTCTTGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCG
  5   1   2      seed Lmb2      in                    IMAGE:8635988.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACCAACTAAAAAAGGAAGGCGACTCTTATCAAATTCGTCCCCTTTGATTATAATGCTAACCGAAAGAATCTGCATCTGTAGGTAACGGCGGGTTTTCTTGTCGAGAGAGGCTCTTGTTTGTAACCAACATCTCTACTTTATTATTCTCAAACCTATATCTGCTTCATTGAGTCTGGTACCTACAGTTCTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTTGCCCAGCTTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTATTAACATTTCTTTGCAAGTATTTGTTCTTGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAATGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCAGAGTTTTAACAATTTGTCTGCACTGCCTGGAAACATGAACAAAAATTGCACTTGTAAATGAAATAAATTGAAATCTTCTCATTaaaaaaaaaaaaaaaaaaaaaaaaaTG
  3   1   2       bld Lmb2      in                    IMAGE:8635988.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAACTTTAACTTATTATTCTCAAACAAAATATATGATTCATTTGAGTCTGGTACATACAGTTCTGTAGTGTCTGAAAGATATAGTAATCTTTTTCTAGCCCAGCTTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTATTAACATTTCTTTGCAAGTATTTGTTCTTGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAATGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCTAGAGTTTTAACAAATTTTTGTTCT
  5   1   2       bld Ov1                             IMAGE:6317282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAACTGTAGGTACCAGACTCAATGAAGCAGATATAGTAATCTTTTTCTTGCCCAGCTTGGAGCAACCCGCCAAACTAGCACTAATTTTAAACTATTAACATTTCTTTGCAAGTATTTGTTCTTGGAATTGTATAATGTGGAGTTTACTAGATGTTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCTGAATCATATTCAACTGAAATGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCAGAGTTTTAACAATTTGTCTGCACTGCCTGGAAACATGAACAAAAATTGCACTTGTACATGAAATAAATTGAAATCTTCTCATATaaaaaaaaaaaaaaaGGGG
  3   1   2       add Ga15                               XL494l03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAAACTATTAACATTTCTTNGCAAGNATTNGNTCTNGGAATNGTATAANGTGGAGTTTACTAGATGNTATGTCGAAGTGCGGTGCCTCCTCCTTCCCCCCCACCCACCTCAAGATTTGCCTTGTTTGAAATGACCGTGCCCTCGCATGACTGTTAAGCTTTTCTGTGCAAAGATGATTGTTTAAGTGCCACATGCCTTTGATGATATAAGAAAATGTGTTACCTCATGAATCATATTCAACTGAAATGTTATTCTGTAACCTACATGAGGAGAAAACGGCTCTATCTTAATCCTCTTCTCTATTCTGTCTTTCCTTGTCCGGCAGAGTTTTAACAATTTGTCTGCACTGCCTGGAAACATGAACAAAAATGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)