Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL086j22.5                            4 PI      90        558     1394                MGC80621 protein [Xenopus laevis]
     2   0.0    0Xl3.1-IMAGE:5515194.5                       4 PI      87       1346     2182                MGC80621 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012838048 Xl3.1-XL463o06ex.3.5 - 36 ESTs
                                                                       .......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL463o06ex.3.5                                                                                                                                                              GAGGCTGCGTCTCACGCCGTCCGGCAAGGGGTGCTGAGGGGAGTGCGTTTGAGCAGGATTTTGTGGCTGCCCATAACACATACAGAAGGAAGCACGGGGCACCCCCATTACAGCTCAGCCGGGACCTCTGCCGATCTGCACAGCAATGGGCTGACCACCTCCTGTCCATCCAGACCCTGAAACACAGTGGGGGAGACACAGGGGAGAACCTCTACTATAAATACAGCTCCAACGCCAGGGAGCTACCAGGCCACGAACCTGTAGACAAATGGTACGATGAGATCGAGGACTATGACTTTGGCCGACCCGGGTTCCGCAGTAACACAGGGCACTTTACTCAGGTTGTCTGGAAGGAGTCCAAGGAGGTTGGAGTTGGGGTGGCTACAGACGGCAATGGGCTTTTCTTTGTGGTGGGACAGTACAACCCAGCAGGGAACATCACCAACTCTGGTTACTTTGAGAAGAACGTTTTGCCTGCCGGGTCTTCTCCTGGAACAGATAATGCTGAGTCTGGTGGCTCACGATGGAAACCAACAGGAGGCTATAAAGAACCAGCTGGAGGCTTTACAGAACCACCCAGAGCCTTCAGAGAACCTGAAAAGTTATCTACCAACCGGAAACCTGTATCAGGATTAACCAAACAGGCAGGAGCTGGCAGTTTTGAGCAGGAAGCTCTGGACGCACACAATAAGTATCGACGTCAGCATGGTGCACCATCTCTGCAAATGTCCCGAGAGCTGTGCGACTCCAGCCAGAAATGGGCCGACCACCTGCTCTCTATCAATGCTCTGCAGCACAGCAACACGGCCAACGGGGAGAACCTGTGGTACAAGTGGAACTCCAGTATGAGGGATGCATCTGGTGCGGGAGGTGGTGGACACATGGTACAATGAGATAAAGGACTATCATTTTGGCCGGCCTGGTTCCAGTCTAACACAGGTCACTTTACACAGGTTGTCTGGAAAGACTCCAGGGAGGTTGGCATTGCCAAAGCTGTGGATGGCAAAGGAATGGTTATAGCAGTTGCGCAGTACAGTCCAGCTGGCAACATCACCAACCCTGGCTACTTTCAGAAGAATGTTCTGCCAAAGGGTACGCCTGTATCCGATGCAGGAACAAGTCCCACGGACAGAGGTACCTCCAACAGCTCATATGTGGGGGCGCGTGGAACAGACTCCGCATCATCACCTACAGCAGATGCCAGAGAGTTTGCGCTTGAGTTCCTAAAGGCTAACAATGCTTATCGATCACGCCATGGAGCAAAACCACTTCAACTCAGCTCTAAGATAAGCCAGGAAGCCCAAAGGTGGGCAGAACATCTCCTCACCCTGAAGACTTTGAAGCACAGTGATACGTCTCACGGAGAGAATATCTGGGCTAAATCTGGAGGCCCCTCCATTACCATCACTGGACAAGAAGTGGCTGACAGCTGGTACAAAGAAGAAAAGAATTATAACTTTTCCAAGCCTGGGTATCAGGCCGACACAGGTCATTTCACCCAGATGGTGTGGAAAGCTTCCAATGAGGTGGGAGTTGGCCTAGCCTCCAGCGGCAAGGGGATGATCATTGTCGTGGCTCAGTATAACCCCAGTGGGATATCACCAACCCAGGGTTCTATGCACGCAATGTCTTCCCTCAAGGCTCAAAGGTGACAGATGATGATGGTGATGAGGATGGCTTTGTGAAGGACACAAGTTCTAGTGCTATCCTTCCCATTCCAGAGAAGGACCAGAGAAAGGACCTGAAAAGCCTTCAGTGAGCACAATAAATACCGCAAGCTCCACAGTGCCGGAGCCCTCCAACTCAGCGCAGCCCTGTCCCAGGAAGCCCAGACGTGGGCAGATCACTTAGTAGGGAAACGTGCCCTACAGAACAGCGACACTCAGCATGGGGAAAACCTATGGTACCGATGGGGCACTGACACCAGCTTGCCAACAGGGAAAGAAGTGTCTGAGTCCTGGTACAACGAGAATACCAAATACAGTTTCAGCAGCCCTGGATTCCAGAGCGGTTCAGGGAACTTCACGCAAATGATATGGAAGTCTTGCTCCCAGGTGGGCTTTGGCCTCAGCACGGACAGCAAGGGAATGTACATTGCTGTGGGATTTTACGACCCAGCAGGAAACATTGCCAACAAAGGCTACTTCGAGGATAATGTCCTGCCCAGGAAGAAGTGATGGCATCTCATGGCACTGAAGGATGAGCCCAAGCTATCAATCAGGATGAAGAACCCCCTTCCCAAGATAAGTTCCTACTTTGCTGGACTCAGGGAATCTGAATGGTTTATTTTTTTTTAATAATTCTGTGCGAGGATCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACACTTGTNCTTTTAGAGATTTTATTTTCTATTAAAGCACAATT
                                                  Xl3.1-CHK-1012721904                                                                                                                                                                    GCGTCTCACGCCGTCCGGCAAGGGGTGCTGAGGGGAGTGCGTTTGAGCAGGATTTTGTGGCTGCCCATAACACATACAGAAGGAAGCACGGGGCACCCCCATTACAGCTCAGCCGGGACCTCTGCCGATCTGCACAGCAATGGGCTGACCACCTCCTGTCCATCCAGACCCTGAAACACAGTGGGGGAGACACAGGGGAGAACCTCTACTATAAATACAGCTCCAACGCCAGGGAACTACCAGGCCAAGAACCTGTAGACAAATGGTACGATGAGATCxAGxACTATGACTTTGGCCGACCCGGGTTCCGCAGTAACACAGGGCACTTTACTCAGGTTGTCTGGAAGGAGTCCAAGGAGGTTGGAGTTGGGGTGGCTACAGACGGCAATGGGCTTTTCTTTGTGGTGGGACAGTACAACCCAGCAGGGAACATCACCAACTCTGGTTACTTTGAGAAGAACGTTTTGCCTGCCGGGTCTTCTCCTGGAACAGATAATGCTGAGTCTGGTGGCTCACGATGGAAACCAACAGGAGGCTATAAAGAACCAGCTGGAGGCTTTACAGAACCACCCAGAGCCTTCAGAGAACCTGAAAAGTTATCTACCAACCGGAAACCTGTATCAGGATTAACCAAACAGGCAGGAGCTGGCAGTTTTGAGCAGGAAGCTCTGGACGCACACAATAAGTATCGACGTCAGCATGGTGCACCATCTCTGCAAATGTCCCGAGAGCTGTGCGACTCCAGCCAGAAATGGGCCGACCACCTGCTCTCTATCAATGCTCTGCAGCACAGCAACACGGCCAACGGGGAGAACCTGTGGTACAAGTGGAACTCCAGTATGAGGGATGCATCTGGTGCGGGAGGTGGTGGACACATGGTACAATGAGATAAAGGACTATCATTTTGGCCGGCCTGGTTxCxxxCTAACACAGGTCACTTTACACAGGTTGTCTGGAAAGACTCCAGGGAGGTTGGCATTGCCAAAGCTGTGGATGGCAAAGGAATGGTTATAGCAGTTGCGCAGTACAGTCCAGCTGGCAACATCACCAACCCTGGCTACTTTCAGAAGAATGTTCTGCCAAAGGGTACGCCTGTATCCGATGCAGGAACAAGTCCCACGGACAGAGGTACCTCCAACAGCTCATATGTGGGGGCGCGTGGAACAGACTCCGCATCATCACCTACAGCAGATGCCAGAGAGTTTGCGCTTGAGTTCCTAAAGGCTAACAATGCTTATCGATCACGCCATGGAGCAAAACCACTTCAACTCAGCTCTAAGATAAGCCAGGAAGCCCAAAGGTGGGCAGAACATCTCCTCACCCTGAAGACTTTGAAGCACAGTGATACGTCTCACGGAGAGAATATCTGGGCTAAATCTGGAGGCCCCTCCATTACCATCACTGGACAAGAAGTGGCTGACAGCTGGTACAAAGAAGAAAAGAATTATAACTTTTCCAAGCCTGGGTATCAGGCCGACACAGGTCATTTCACCCAGATGGTGTGGAAAGCTTCCAATGAGGTGGGAGTTGGCCTAGCCTCCAGCGGCAAGGGGATGATCATTGTCGTGGCTCAGTATAACCCCAxxGGxATATCACCAACCCAGGGTTCTATGCACGCAATGTCTTCCCTCAAGGCTCAAAGGTGACAGATGATGATGGTGATGAGGATGGCTTTGTGAAGGACACAAGTTCTAGTGCTATCCTTCCCATTCCAGAGAAGGAxCxGAxAxxxxxCCxxAAAxxxxxTCAGTGAGCACAATAAATACCGCAAGCTCCACAGTGCCGGAGCCCTCCAACTCAGCGCAGCCCTGTCCCAGGAAGCCCAGACGTGGGCAGATCACTTAGTAGGGAAACGTGCCCTACAGAACAGCGACACTCAGCATGGGGAAAACCTATGGTACCGATGGGGCACTGACACCAGCTTGCCAACAGGGAAAGAAGTGTCTGAGTCCTGGTACAACGAGAATACCAAATACAGTTTCAGCAGCCCTGGATTCCAGAGCGGTTCAGGGAACTTCACGCAAATGATATGGAAGTCTTGCTCCCAGGTGGGCTTTGGCCTCAGCACGGACAGCAAGGGAATGTACATTGCTGTGGGATTTTACGACCCAGCAGGAAACATTGCCAACAAAGGCTACTTCGAGGATAATGTCCTGCCCAGGAAGAAGTGATGGCATCTCATGGCACTGAAGGATGAGCCCAAGCTATCAATCAGGATGAAGAACCCCCTTCCCAAGATAAGTTCCTACTTTGCTGGACTCAGGGAATCTGAATGGTTTATTTTTTTTTAATAATTCTGTGCGAGGATCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACACTTGTNCTTTTAGAGATTTTATTTTCTATTAAAGCACAATTTCCCCA
                                                      consensus depths                                                                                                                                                                   3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     3     4     4     4     4     4     4     4     5     5     5     5     5     5     5     6     5     6     6     6     5     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     3     5     4     5     3     5     3     5     3     5     3     5     3     4     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     3     2     3     2     3     2     3     2     3     2     2     1     2     2     2     2     2     2     2     2     2     2     2     1     1     2     2     2     2     1     1     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     5     6     5     7     5     7     6     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     8    11     8    11     8    11     8    11     8    11     8    11     8    11     8    11     8    11     9    12     9    12     9    12     9    12     9    12     9    12    11    12    10    11    11    13     9    13     9    13    12    17    13    17    12    17    13    18    14    18    14    18    14    18    14    18    14    18    13    18    13    18    14    19    13    18    13    18    13    17    12    16    12    16    12    16    12    16    12    16    12    16    12    16    13    16    12    15    13    16    13    16    13    16    13    16    13    17    13    17    14    16    14    16    14    15    14    14    14    14    13    14    13    14    14    14    14    14    14    14    13    14    14    14    13    13    12    12    11    11    11    11    11    11    11    11    11    11     8    11     6     9     2     6     2     6     2     5
  5   1   2      ests                            Xl3.1-IMAGE:5571966.5                                                                                                                                                                GGCTGCGTCTCACGCCGTCCGGCAAGGGGTGCTGAGGAGAGTGAGTTTGAGCAGGATTTTGTGGCTGCCCATAACTCATACAGAAGGAAGCACGGGGCCCCCCCACTACAACTCAGCCGGGACCTCTGCCGATCTGCACAGCAATGGGCTGACCACCTCCTGTCCATCCAGACCCTGAAACACAGTGGGGGAGACACAGGGGAGAACCTCTACTATAAATACAGCTCCAACGCCAGGGAACTACCAGGCCAAGAACCTGTAGACAAATGGTACGATGAAATCAAGAACTATGACTTTGGCCGACCCGGGTTCCGCAGTAACACAGGGCACTTTACTCAGGTTGTCTGGAAGGAGTCCAAGGAGGTTGGAGTTGGGGTGGCTACAGACGGCAATGGGCTTTTCTTTGTGGTGGGACAGTACAACCCAGCAGGGAACATCACCAACTCTGGTTACTTTGAGAAGAACGTTTTGCCTGCCGGGTCTTCTCCTGGAACAGATAATGCTGAGTCTGGTGGCTCACGATGGAAACCAACAGGAGGCTATAAAGAACCAGCTGGAGGCTTTACAGAACCACCCAGAGCCTTCAGAGAACCTGAAAAGTTATCTACCAACCGGAAACCTGTATCAGGATTAACCAAACAGGCAGGAGCTGGCAGTTTTGAGCAGGAAGCTCTGGACGCACACAATAAGTATCGACGTCAGCATGGTGCACCATCTCTGCAAATGTCCCGAGAGCTGTGCGACTCCAGCCAGAAATGGGCCGACCACCTGCTCTCTATCAATGCTCTGCAGCACAGCAACACGGCCAACGGGGAGAACCTGTGGTACAAGTGGAACTCCAGTATGAGGGATGCATCTGGTGCGGGAGGTGGTGGACACATGGTACAATGAGATAAAGGACTATCATTTTGGCCGGCCTGGTTTCAGTCTAACACAGGTCACTTTACACAGGTTGTCTGGAAAGACTCCAGGGAGGTTGGCATTGCCAAAGCTGTGGATGGCAAAGGAATGGTTATAGCAGTTGCGCAGTACAGTCCAGCTGGCAACATCACCAACCCTGGCTACTTTCAGAAGAATGTTCTGCCAAAGGGTACGCCTGTATCCGATGCAGGAACAAGTCCCACGGACAGAGGTACCTCCAACAGCTCATATGTGGGGGCGCGTGGAACAGACTCCGCATCATCACCTACAGCAGATGCCAGAGAGTTTGCGCTTGAGTTCCTAAAGGCTAACAATGCTTATCGATCACGCCATGGAGCAAAACCACTTCAACTCAGCTCTAAGATAAGCCAGGAAGCCCAAAGGTGGGCAGAACATCTCCTCACCCTGAAGACTTTGAAGCACAGTGATACGTCTCACGGAGAGAATATCTGGGCTAAATCTGGAGGCCCCTCCATTACCATCACTGGACAAGAAGTGGCTGACAGCTGGTACAAAGAAGAAAAGAATTATAACTTTTCCAAGCCTGGGTATCAGGCCGACACAGGTCATTTCACCCAGATGGTGTGGAAAGCTTCCAATGAGGTGGGAGTTGGCCTAGCCTCCAGCGGCAAGGGGATGATCATTGTCGTGGCTCAGTATAACCCCAGTGGGAATTCACCAACCCAGGGTTCTATGCACGCAATGTCTTCCCTCAAGGCTCAAAGGTGACAGATGATGATGGTGATGAGGATGGCTTTGTGAAGGACACAAGTTCTAGTGCTATCCTTCCCATTCCAGAGAAGGAGC
  5   1   2      ests                               Xl3.1-XL463o06ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGATATGGAAGTCTTGCTCCCAGGTGGGCTTTGGCCTCAGCACGGACAGCAAGGGAATGTACATTGCTGTGGGATTTTACGACCCAGCAGGAAACATTGCCAACAAAGGCTACTTCGAGGATAATGTCCTGCCCAGGAAGAAGTGATGGCATCTCATGGCACTGAAGGATGAGCCCAAGCTATCAATCAGGATGAAGAACCCCCTTCCCAAGATAAGTTCCTACTTTGCTGGACTCAGGGAATCTGAATGGTTTATTTTTTTTTAATAATTCTGTGCGAGGATCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACACTTGTCTTTTTAGAGATTTTATTTTCTATTAAAGCACAATTTCC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---A--------
  5   1   2      ests                            Xl3.1-IMAGE:5571966.5                                                                                                                                                                GGCTGCGTCTCACGCCGTCCGGCAAGGGGTGCTGAGGAGAGTGAGTTTGAGCAGGATTTTGTGGCTGCCCATAACTCATACAGAAGGAAGCACGGGGCCCCCCCACTACAACTCAGCCGGGACCTCTGCCGATCTGCACAGCAATGGGCTGACCACCTCCTGTCCATCCAGACCCTGAAACACAGTGGGGGAGACACAGGGGAGAACCTCTACTATAAATACAGCTCCAACGCCAGGGAACTACCAGGCCAAGAACCTGTAGACAAATGGTACGATGAAATCAAGAACTATGACTTTGGCCGACCCGGGTTCCGCAGTAACACAGGGCACTTTACTCAGGTTGTCTGGAAGGAGTCCAAGGAGGTTGGAGTTGGGGTGGCTACAGACGGCAATGGGCTTTTCTTTGTGGTGGGACAGTACAACCCAGCAGGGAACATCACCAACTCTGGTTACTTTGAGAAGAACGTTTTGCCTGCCGGGTCTTCTCCTGGAACAGATAATGCTGAGTCTGGTGGCTCACGATGGAAACCAACAGGAGGCTATAAAGAACCAGCTGGAGGCTTTACAGAACCACCCAGAGCCTTCAGAGAACCTGAAAAGTTATCTACCAACCGGAAACCTGTATCAGGATTAACCAAACAGGCAGGAGCTGGCAGTTTTGAGCAGGAAGCTCTGGACGCACACAATAAGTATCGACGTCAGCATGGTGCACCATCTCTGCAAATGTCCCGAGAGCTGTGCGACTCCAGCCAGAAATGGGCCGACCACCTGCTCTCTATCAATGCTCTGCAGCACAGCAACACGGCCAACGGGGAGAACCTGTGGTACAAGTGGAACTCCAGTATGAGGGATGCATCTGGTGCGGGAGGTGGTGGACACATGGTACAATGAGATAAAGGACTATCATTTTGGCCGGCCTGGTTTCAGTCTAACACAGGTCACTTTACACAGGTTGTCTGGAAAGACTCCAGGGAGGTTGGCATTGCCAAAGCTGTGGATGGCAAAGGAATGGTTATAGCAGTTGCGCAGTACAGTCCAGCTGGCAACATCACCAACCCTGGCTACTTTCAGAAGAATGTTCTGCCAAAGGGTACGCCTGTATCCGATGCAGGAACAAGTCCCACGGACAGAGGTACCTCCAACAGCTCATATGTGGGGGCGCGTGGAACAGACTCCGCATCATCACCTACAGCAGATGCCAGAGAGTTTGCGCTTGAGTTCCTAAAGGCTAACAATGCTTATCGATCACGCCATGGAGCAAAACCACTTCAACTCAGCTCTAAGATAAGCCAGGAAGCCCAAAGGTGGGCAGAACATCTCCTCACCCTGAAGACTTTGAAGCACAGTGATACGTCTCACGGAGAGAATATCTGGGCTAAATCTGGAGGCCCCTCCATTACCATCACTGGACAAGAAGTGGCTGACAGCTGGTACAAAGAAGAAAAGAATTATAACTTTTCCAAGCCTGGGTATCAGGCCGACACAGGTCATTTCACCCAGATGGTGTGGAAAGCTTCCAATGAGGTGGGAGTTGGCCTAGCCTCCAGCGGCAAGGGGATGATCATTGTCGTGGCTCAGTATAACCCCAGTGGGAATTCACCAACCCAGGGTTCTATGCACGCAATGTCTTCCCTCAAGGCTCAAAGGTGACAGATGATGATGGTGATGAGGATGGCTTTGTGAAGGACACAAGTTCTAGTGCTATCCTTCCCATTCCAGAGAAGGAGC
                                                  Xl3.1-CHK-1012694484                                                                                                                                                                      GTCTCACGCCGTCCGGCAAGGGGTGCTGAGGAGAGTGAGTTTGAGCAGGATTTTGTGGCTGCCCATAACTCATACAGAAGGAAGCACGGGGCCCCCCCACTACAACTCAGCCGGGACCTCTGCCGATCTGCACAGCAATGGGCCGACCACCTCCTGTCCATCCAGACCCTGAAACACAGTGGGGGAGACACAGGGGAGAACCTCTACTATAAATACAGCTCCAACGCCAGGGAACTACCAGGCCAAGAACCTGTAGACAAATGGTACGATGAGATCAAGAACTATGACTTTGGCCGACCCGGGTTCCGCAGTAACACAGGGCACTTTACTCAGGTTGTCTGGAAGGAGTCCAAGGAGGTTGGAGTTGGGGTGGCTACAGACGGCAATGGGCTTTTCTTTGTGGTGGGACAGTACAACCCAGCAGGGAACATCACCAACTCTGGTTACTTTGAGAAGAACGTTTTGCCTGCCGGGTCTTCTCCTGGAACAGATAATGCTGAGTCTGGTGGCTCACGATGGAAACCAACAGGAGGCTATAAAGAACCAGCTGGAGGCTTTACAGAACCACCCAGAGCCTTCAGAGAACCTGAAAAGTTATCTACCAACCGGAAACCTGTATCAGGATTAACCAAACAGGCAGGAGCTGGCAGTTTTGAGCAGGAAGCTCTGGACGCACACAATAAGTATCGACGTCAGCATGGTGCACCATCTCTGCAAATGTCCCGAGAGCTGTGCGACTCCAGCCAGAAATGGGCCGACCACCTGCTCTCTATCAATGCTCTGCAGCACAGCAACACGGCCAACGGGGAGAACCTGTGGTACAAGTGGAACTCCAGTATGAGGGATGCATCTGGTGCGGGAGGTGGTGGACACATGGTACAATGAGATAAAGGACTATCATTTTGGCCGGCCTGGTTTCxxxxxAACACAGGTCACTTTACACAGGTTGTCTGGAAAGACTCCAGGGAGGTTGGCATTGCCAAAGCTGTGGATGGCAAAGGAATGGTTATAGCAGTTGCGCAGTACAGTCCAGCTGGCAACATCACCAACCCTGGCTACTTTCAGAAGAATGTTCTGCCAAAGGGTACGCCTGTATCCGATGCAGGAACAAGTCCCACGGACAGAGGTACCTCCAACAGCTCATATGTGGGGGCGCGTGGAACAGACTCCGCATCATCACCTACAGCAGATGCCAGAGAGTTTGCGCTTGAGTTCCTAAAGGCTAACAATGCTTATCGATCACGCCATGGAGCAAAACCACTTCAACTCAGCTCTAAGATAAGCCAGGAAGCCCAAAGGTGGGCAGAACATCTCCTCACCCTGAAGACTTTGAAGCACAGTGATACGTCTCACGGAGAGAATATCTGGGCTAAATCTGGAGGCCCCTCCATTACCATCACTGGACAAGAAGTGGCTGACAGCTGGTACAAAGAAGAAAAGAATTATAACTTTTCCAAGCCTGGGTATCAGGCCGACACAGGTCATTTCACCCAGATGGTGTGGAAAGCTTCCAATGAGGTGGGAGTTGGCCTAGCCTCCAGCGGCAAGGGGATGATCATTGTCGTGGCTCAGTATAACCCCAGTGGxAxxTCACCAACCCAGGGTTCTATGCACGCAATGTCTTCCCTCAAGGCTCAAAGGTGACAGATGATGATGGTGATGAGGATGGCTTTGTGAAGGACACAAGTTCTAGTGCTATCCTTCCCATTCCAGAGA
  5   1   2       bld Tbd7      in                         XL092g16.5p GGGCAGGCCCATGCCTTTCTTCTCTCCAACAAGCCCCTGTCACATCCCAGCAGCTGGGCCAAGTAATGTGACTCAGCCCTTGTCTTGCTGAGCGGCTGCAGGAGGAGGCCAGGCTGGGGGGCACACGCCCGGGATAAAGCAGGACACGCAGAGATGGGAGGCTGCGTCTCACGCCGTCCGGCAAGGGGTGCTGAGGGGAGTGCGTTTGAGCAGGATTTTGTGGCTGCCCATAACACATACAGAAGGAAGCACGGGGCACCCCCATTACAGCTCAGCCGGGACCTCTGCCGATCTGCACAGCAATGGGCTGACCACCTCCTGTCCATCCGGACCCTGAAACACAGTGGGGGAAACACAGGAGAAAACCTCTACTATAAATACAGTTCCAACGCTAGGGAGCTACCAGGCCAAGAACCTGTAGACTCATGGTATGATGAAATCAAGAACTATGACTTTGGCCGACCCGGGTTCCGCAGTAACACAGGGCACTTTACTCAGGTTGTCTGGAAGGAGTCCAAGGAGGTTGGAGTTGGGGTGGCTACAGACGGCAATGGGCTTTTCTTTGTGGTGGGACAGTACAACCCAGCAGGGAACATCACCAACTCTGGTTACTTTGAGAA
  5   1   1       add Sp1                             IMAGE:5506197.5p                                                  AGCAGCGGGGCCAAGTAATGTGACTCAGCCCTTGTCTTGCTCAGCGCCTGCAGGAGGAGGCCAGGCTGGGGGGCACACGCCCGGGATAAAGAGGGACCCCAGGGATGGGAGGCTGCGTCTCACGCCGTTCAGCAAAGGGTGCTGAGGAGAGTGAGTTTGAGCAGGATTTTGTGGCTGCCCATAACTCATACAGAAGGAAGCACGGGGCCCCCCCACTACAACTCAGCCGGGACCTCTGCCGATCTGCACAGCAATGGGCCGACCACCTCCTGTCCATCCAGACCCTGAAACACAGTGGGGGAGACACAGGGGAGAACCTCTACTATAAATACAGCTCCAACGCCAGGGAACTACCANGCCACGAACCTGTAGACAAATGGTACGATGAGATCGAGGACTATGACTTCAGCAGACCCGGGTTCCGCAGTTACACAGGGCACTTCCCTCCGGTTGTGTGGAAGGAGTCTAAGGAGGGTTGAATTGGGGTGGGCTACAAACCGGCATGGGCTTTTTCTTCTggggggggACGTTCAGCCCCCACCGGGGAAAATTCCCCACCTCTGGAAATTTTTaaaaaaaacccccgggccccgggggcctttccccgggaataaaaaaacttcggggggccccggAAGAAGAGAGGGTTT
  5   1   2       add Ov1                             IMAGE:8331286.5p                                                                                  GGATCAGGCTGAGAGATGGAGCTTTGCTACTTGCACCGTGTGCAGATTTCTAACACTAGTGCAAAACACTGGTGGGGCTGCTGTGGGAAGGGCTCTGTGTACTCAGGTGCTGAGGAGAGTGAGTTTGAGCAGGATTTTGTGGCTGCCCATAACTCATACAGAAGGAAGCACGGGGCCCCCCCACTACAACTCAGCCGGGACCTCTGCCGATCTGCACAGCAATGGGCCAACCACCTCCTGTCCATCCAGACCCTGAAACACAGTGGGGGAGACACAGGGGAGAACCTCTACTATAAATACAGCTCCAACGCCAGGGAACTACCAGGCCACGAACCTGTAGACAAATGGTACGATGAGATCGAGGACTATGACTTCAGCAGACCCGGGTTCCGCAGTAACACAGGGCACTTCACTCAGGTTGTGTGGAAGGAGTCTAATGAGGTTGGAGTTGGGGTGGCTACAGACGGCAATGGGCTTTTCTTCGTGGTGGGACAGTACAGCCCATCGGGGAACATCACCTACTCTGGATACTTTGAGAAGAACGTCCTGCCCGCTGGGTCTTCTCCTGGTATAAATAAATCAGGTGGCTCAAGATGATGAGGTGTTACAGAACCCTTCAAAGGCTTCAGAAAACTGGAAAAGATTTTTACCATCTGGAAACCGGGACCAGAATTA
  5   1   2       bld Neu7      in                         XL017n22.5p                                                                                                                       GACACGCCCGGGNATAAAGCAGGACACGCAGNAGNATGGGAGGCTGCGTCTCACGCCGTCCGGCAAGGGGTGCTGAGGGGAGTGCGTTTGAGCAGGATTTTGTGGCTGCCCATAACACATACAGAAGGAAGCACGGGGCACCCCCATTACAGCTCAGCCGGGACCTCTGCCGATCTGCACAGCAATGGGCTGACCACCTCCTGTCCATCCGGACCCTGAAACACAGTGGGGGAAACACAGGAGAAAACCTCTACTATAAATAAAGTTCCAACGCCAGGGAGCTACCAGGCCAAGAACCTGTAGACTCATGGTATGATGAAATCAAGAACTATGACTTTGGCCGACCCGGGTTCCGCAGTAACACAGGGCACTTTACTCAGGTTGTCTGGAAGGAGTCCAAGGAGGTTGGAGTTGGGGTGGCTACAGACGGCAATGGGCTTTTCTTTGTGGTGGGACAGTACAACCCAGCAGGGAACATCACCAACTCTGGTTACTTTGAGAAGAACGTTTTGCCTGCCGGGTCTTCTCCTGGAACAGATAATGCTGAGTCTGGTGGCTCACGATGGAAACCAACAGGAGGCTATAAAGAACCAGCTGGAGGC
  5   1   2      skin Emb4                            IMAGE:5571966.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAATCAAGAACTATGACTTTGGCCGACCCGGGTTCCGCAGTAACACAGGGCACTTTACTCAGGTTGTCTGGAAGGAGTCCAAGGAGGTTGGAGTTGGGGTGGCTACAGACGGCAATGGGCTTTTCTTTGTGGTGGGACAGTACAACCCAGCAGGGAACATCACCAACTCTGGTTACTTTGAGAAGAACGTTTTGCCTGCCGGGTCTTCTCCTGGAACAGATAATGCTGAGTCTGGTGGCTCACGATGGAAACCAACAGGAGGCTATAAAGAACCAGCTGGAGGCTTTACAGAACCACCCAGAGCCTTCAGAGAACCTGAAAAGTTATCTACCAACCGGAAACCTGTATCAGGATTAACCAAACAGGCAGGAGCTGGCAGTTTTGAGCAGGAAGCTCTGGACGCACACAATAAGTATCGACGTCAGCATGGTGCACCATCTCTGCAAATGTCCCGAGAGCTGTGCGACTCCAGCCAGAAATGGGCCGACCACCTGCTCTCTATCAATGCTCTGCAGCACAGCAACACGGCCAACGGGGAGAACCTGTGGTACAAGTGGAACTCCAGTATGAGGGATGCATCTGGTGCGGGAGGTGGTGGACACATGGTACAATGAGATAAAGGACTATCATTTTGGCCGGCCTGGTTTCCAGTCTAACACAGGTCACTTTTACACAGGGTTGTCTGGAAAGACTCCAGGGGAAGTTGGCATTGGCCAAAAGCTGTGAATTGGAAAAGAAATGGTTTTTAGCCAGTTTGCGCAGTTACAGGTCCCAGCTTGGCAAACATTCACCCAAACCTTGGCTTAACTTTTCGAAAAAATGGGTCCTGGCCCAAAGGGGTTACGCCCCGGTTATCCCAATTGGCGGGGACAAAGTCTCCCCCGGGAACGAGAGGGTTCCCCTCCAACCACCCTCTATTTTgggggggggcggcggggg
  5   1   2      skin Neu7      in                         XL011b14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACAGGGCACTTTACTCAGGTTGTCTGGAAGGAGTCCAAGGAGGTTGGAGTTGGGGTGGCTACAGACGGCAATGGGCTTTTCTTTGTGGTGGGACAGTACAACCCAGCAGGGAACATCACCAACTCTGGTTACTTTGAGAAGAACGTTTTGCCTGCCGGGTCTTCTCCTGGAACAGATAATGCTGAGTCTGGTGGCTCACGATGGAAACCAACAGGAGGCTATAAAGAACCAGCTGGAGGCTTTACAGAACCACCCAGAGCCTTCAGAGAACCTGAAAAGTTATCTACCAACCGGAAACCTGTATCAGGATTAACCAAACAGGCAGGAGCTGGCAGTTTTGAGCAGGAAGCTCTGGACGCACACAATAAGTATCGACGTCAGCATGGTGCACCATCTCTGCAAATGTCCCGAGAGCTGTGCGACTCCAGCCAGAAATGGGCCGACCACCTGCTCTCTATCAATGCTCTGCAGCACAGCAA
  5   1   2      seed Ga15                               XL423l13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTAGCTGGCAGTTTTGAGCAGGAAGCTCTGGACGCACACAATAAGTATCGACGTCAGCATGGTGCACCATCTCTGCAAATGTCCCGAGAGCTGTGCGACTCCAGCCAGAAATGGGCCGACCACCTGCTCTCTATCAATGCTCTGCAGCACAGCAACACGGCCAACGGGGAGAACCTGTGGTACAAGTGGAACTCCAGTATGAGGGATGCATCTGGTGCGGAGGTGGTGGACACATGGTACAATGAGATAAAGGACTATCATTTTGGCCGGCCTGGTTTCCAGTCTAACACAGGTCACTTTACACAGGTTGTCTGGAAAGACTCCAGGGAGGTTGGCATTGCCAAAGCTGTGGATGGCAAAGGAATGGTTATAGCAGTTGCGCAGTACAGTCCAGCTGGCAACATCACCAACCCTGGCTACTTTCAGAAGAATGTTCTGCCAAAGGGTACGCCTGTATCCGATGCAGGAACAAGTCCCACGGACAGAGGTACCTCCAACAGCTCATATGTGGGGGCGCGTGGAACAGACTCCGCATCATCACCTACAGCAGATGCCAGAGAGTTTGCGCTTGAGTTCCTAAAGGCTAACAATGCTTATCGATCACGCCATGGAGCAAAACCACTTCAACTCAGCTCTAAGATAAGCCAGGAAGCCCAAAGGTGGGCAGAACATCTCCTCACCCTGAAGACTTTGAAGCACAGTGATACGTCTCACGGAGAGAATATCTGGGCTAAATCTGGAGGCCCCTCCATTACCATCACT
  5   1   2       bld Neu7      in                         XL004n03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGATNATTTTGGCCGGCCTGGTTTCCGTCTAACACAGGTCACTTTACACAGGTTGTCTGGAAAGACTCCAGGGAGGTTGGCATTGCCAAAGCTGTGGATGGCAAAGGAATGGTTATAGCAGTTGCGCAGTACAGTCCAGCTGGCAACATCACCAACCCTGGCTACTTTCAGAAGAATGTTCTGCCAAAGGGTACGCCTGTATCCGATGCAGGAACAAGTCCCACGGACAGAGGTACCTCCAACAGCTCATATGTGGGGGCGCGTGGAACAGACTCCGCATCATCACCTACAGCAGATGCCAGAGAGTTTGCGCTTGAGTTCCTAAAGGCTAACAATGCTTATCGATCACGCCATGGAGCAAAACCACTTCAACTCAGCTCTAAGATAAGCCAGGAAGCCCAAAGGTGGGCAGAACATCTCCTCACCCTGAAGACTTTGAAGCACAGTGATACGTCTCACGGAGAGAATATCTGGGCTAAATCTGGAGGCCCCTCCATTACCATCACTGGACAAGAAGTGGCTGACAGCTGGTACAAAGAAGAAAAGAATTATAACTTTTCCAAGCCTGGGTATCAGGCCGACACAGGTCATTTCACCCAGATGGTGTGGAAAGCTTCC
  5   1   2       bld Tad1                            IMAGE:6877418.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGCAGTTGCGCAGTACAGTCCAGCTGGCAACATCACCAACCCTGGCTACTTTCAGAAGAATGTTCTGCCAAAGGGTACGCCTGTATCCGATGCAGGAACAAGTCCCACGGACAGAGGTACCTCCAACAGCTCATATGTGGGGGCGCGTGGAACAGACTCCGCATCATCACCTACAGCAGATGCCAGAGAGTTTGCGCTTGAGTTCCTAAAGGCTAACAATGCTTACCGATCACGCCATGGAGCAAAACCACTTCAACTCAGCTCTAAGATAAGCCAGGAAGCCCAAAGGTGGGCAGAACATCTCCTCACCCTGAAGACTTTGAAGCACAGTGATACGTCTCACGGAGAGAATATCTGGGCTAAATCTGGAGGCCCCTCCATTACCATCACTGGACAAGAAGTGGCTGACAGCTGGTACAAAGAAGAAAAGAATTATAACTTTTCCAAGCCTGNGTATCAGGCCGACACAGGTCATTTCACCCAGATGGTGTGGAAAGCTTTCAATGAGGTGGGAGTTGGCCTAGCCTCCAGNCGCAAGGNGATGATCATTGTCGTGGCTCAGTATAACCCCAGTGGGAATATCACCAACCCANGGGTTCTATGCACGCAATGTCTTCCCCTCAGGGCTCAAAAGGTGACAAATGATGATGGTTGATGAAGGAATGGCTTTGTGAAAAGACACCAGTTTCTAGTGCTATCCCTTCCCCATCCCAGAGAAAGGACCTGAAAAGCCTTTCCCGTAAAGGATCTTGGCTCAGTGGAAGCCACAATAAAAAAACGGCCAAGGCA
  5   1   2       bld Ga18      in                      xlk105n19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACAGACTCCGCATCATCACCTACAGCAGATGNCAGAGAGTTTGCGCTTGAGTTCCTAAAGGCTAACAATGCTTATCGATCACGCCATGGAGCAAAACCACTTCAACTCAGCTCTAAGATAAGCCAGGAAGCCCAAAGGTGGGCAGAACATCTCCTCACCCTGAAGACTTTGAAGCACAGTGATACGTCTCACGGAGAGAATATCTGGGCTAAATCTGGAGGCCCCTCCATTACCATCACTGGACAAGAAGTGGCTGACAGCTGGTACAAAGAAGAAAAGAATTATAACTTTTCCAAGCCTGGGTATCAGGCCGACACAGGTCATTTCACCCAGATGGTGTGGAAAGCTTCCAATGAGGTGGGAGTTGGCCTAGCCTCCAGCGGCAAGGGGATGATCATTGTCGTGGCTCAGTATAACCCCAGTGGNATATCACCAACCCAGGGTTCTATGCACGCAATGTCTTCCCTCAAGGCTCAAAGGTGACAGATGATGATGGTGATGAGGATGGCTTTGTGAAGGACACAAGTTCTAGTGCTATCCTTCCCATTCCAGAGAAGGAGCTGNNNNNNTCCGTANGATCTGCTCAGTGAGCACAATAAATACCGCAAGCTCCACAGTGCCGGAGNCCTCCAACTCAGCGCNGNNCTGTCCCAGGAAGNCCAGACGTGGGCAGATCACTNAGTAGGGAAACGTGCCCTACAGAACAGCGACACTCAGCATGGGNNA
  5   1   0       add Neu7      in                         XL048n13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGAGGTGGGAGTTGGCCTAGCCTCCAGCGGCAAGGGGATGATCATTGTCGTGGCTCAGTATAACCCCAGTGGGAATATCACCAACCCAGGGTTCTATGCACGCAATGTCTTCCCTCAAGGCTCAAAGGTGACAGATGATGATGGTGATGAGGATGGCTTTGTGAAGGACACAAGTTCTAGTGCTATCCTTCCCATTCCAGAGAAGGAGCTGAAAGCCTTCCGTAAGGATCTGCTCAGNGAGCACAATAAATACCGCAAGCTCCACAGNGCCGGAGCCCTNCAACTNAGCGCAGNCCTGNNCCAGGAAGCCCAGACGNGGGCAGAT
  5   1   2      ests                               Xl3.1-XL463o06ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGATATGGAAGTCTTGCTCCCAGGTGGGCTTTGGCCTCAGCACGGACAGCAAGGGAATGTACATTGCTGTGGGATTTTACGACCCAGCAGGAAACATTGCCAACAAAGGCTACTTCGAGGATAATGTCCTGCCCAGGAAGAAGTGATGGCATCTCATGGCACTGAAGGATGAGCCCAAGCTATCAATCAGGATGAAGAACCCCCTTCCCAAGATAAGTTCCTACTTTGCTGGACTCAGGGAATCTGAATGGTTTATTTTTTTTTAATAATTCTGTGCGAGGATCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACACTTGTCTTTTTAGAGATTTTATTTTCTATTAAAGCACAATTTCC
                                                  Xl3.1-CHK-1012688751                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAAGTCTTGCTCCCAGGTGGGCTTTGGCCTCAGCACGGACAGCAAGGGAATGTACATTGCTGTGGGATTTTACGACCCAGCAGGAAACATTGCCAACAAAGGCTACTTCGAGGATAATGTCCTGCCCAGGAAGAAGTGATGGCATCTCATGGCACTGAAGGATGAGCCCAAGCTATCAATCAGGATGAAGAACCCCCTTCCCAAGATAAGTTCCTACTTTGCTGGACTCAGGGAATCTGAATGGTTTATTTTTTTTTAATAATTCTGTGCGAGGATCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACACTTGTNxTTTTAGAGATTTTATTTTCTATTAAAGCACA
  5   1   2       bld Neu7      in                         XL032g12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTAAGGATCTGCTCAGTGAGCACAATAAATACCGCAAGCTCCACAGTGCCGGAGCCCTCCAACTCAGCGCAGCCCTGTCCCAGGAAGCCCAGACGTGGGCAGATCACTTAGTAGGGAAACGTGCCCTACAGAACAGCGACACTCAGCATGGGGAAAACCTATGGTACCGATGGGGCACTGACACCAGCTTGCCAACAGGGAAAGAAGTGTCTGAGTCCTGGTACAACGAGAATACCAAATACAGTTTCAGCAGCCCTGGATTCCAGAGCGGTTCAGGGAACTTCACGCAAATGATATGGAAGTCTTGCTCCCAGGTGGGCTTTGGCCTCAGCACGGACAGCAAGGGAATGTACATTGCTGTGGGATTTTACGACCCAGCAGGAAACATTGCCAACAAAGGCTACTTCGAGGATAATGTCCTGCCCAGGAAGAAGTGATGGCATCTCATGGCACTGAAGGATGAGCCCAAGCTATCAATCAGGATGAAGAACCCCCTTCCCAAGATAAGTTCCTACTTTGCTGGACTCAGGGAATCTGAATGGTTTAtttttttttAATAATTCTGTGCGAGGGTCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAA
  5   1   0       add Ga15      in                       XL463o06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGGGAANACCTATGGTACCGATGGGGCACTGACNCCAGCTTGCCAACAGGGAAAGAAGTGTCTGAGTCCTGGTACAACGAGAATACCAAATACAGTTTCAGCAGCCCTGGATTCCA
  5   1   2       bld Tbd7      in                         XL090o12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGATATGGAAGTCTTGCTCCCAGGTGGGCTTTGGCCTCAGCACGGACAGCAAGGGAATGTACATTGCTGTGGGATTTTACGACCCAGCAGGAAACATTGCCAACAAAGGCTACTTCGAGGATAATGTCCTGCCCAGGAAGAAGTGATGGCATCTCATGGCACTGAAGGATGAGCCCAAGCTATCAATCAGGATGAAGAACCCCCTTCCCAAGATAAGTTCCTACTTTGCTGGACTCAGGGAATCTGAATGGTTTAtttttttttAATAATTCTGTGCGAGGATCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGC
  5   1   2       bld Bone                            IMAGE:8743397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCAGGAAACATTGCCAACAAAGGCTACTTCGAGGATAATGTCCTGCCCAGGAAGAAGTGATGGCATCTCATGGCACTGAAGCATGAGCCCAAGCTATCAATCAGGATGAAGAACCCCCTTCCCAAGATAAGTTCCTACTTTGCTGGACTCAGGGAATCTGAATGGTTTAtttttttttAATAATTCTGTGCGAGGATCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGGGGGCAAATAAGTCTTTACCAATTTAGCCAGCAATGCACGGGGCCCATCAGGATGATCTGATGGAAGCGATGCAGTGGATAATGTATTCAGTCTTGGCTAGCATGTAGGGTGCAGTCATGACGCTTAAAAATAGGTATACCTATCTCCAAGCGTTACTGCGTACGGAAGCTGATACTATAGTAAG
  5   1   2       bld Lmb1                            IMAGE:8536322.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAANNNNCCTCGTGTTCNGNGAGGAGTCACTAATAATACTCNNCCCGGCATCTCATGGCACTGAAGCATGAGCCCAAGCTATCAATCAGGATGAAGAACCCCCTTCCCAAGATAAGTTCCTACTTTGCTGGACTCAGGGAATCTGAATGGTTTAttttttttttAATAATTCTGTGCGAGGATCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCATTTAGCCAGCAATGCACGGGGCCAATCAGGTGATCTGATGAAAGCGAATGCCGAGTTGATAATGATTCGAGTCTGGCCTATCATGTAGGGTGCAATCTGAACGCCTAAAAAAGGTATATACTTAATCTTCAAAAGTTACCTGCGTTCCCGGGAGCGATATCTATAATATGATACTAAAAAACGCTGTGTTGAATTCTCAC
  5   1   2       bld Tbd7      in                         XL089c06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGATGAAGAACCCCCTTCCCAAGATAAGTTCCTACTTTGCTGGACTCAGGGAATCTGAATGGTTTAtttttttttAATAATTCTGTGCGAGGATCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTG
  5   1   2       bld FaBN                            IMAGE:8078654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCTTCCCAGATAAGTTCCTACTTTGCTGGACTCAGGGAATCTGAATGGTTTAtttttttttAATAATTCTGTGCGAGGGTCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACCCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGTACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAAGTTTATATTACCTTTATTCTTTCCTATAGTGTTTACACATGCTGTTTTCACCGGGGAA
  5   1   2       bld Bone                            IMAGE:8742441.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGAAAGGTAGGCGATAGGTCATCGTATTCGAGTTCGTCCCTTTTTTTAATAATTCTGTGCGAGGATCAGGTGGAAATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGATTATCTAATAGTTAGTGTTATTACCTAAAATAGAGCAGCATGATGTGTGACATGTCTACGACCAACCCCCACCACTGCACGGTAATGTTATTTGGTCCTAGCAACTGCCTGTAACGTAAAGATGACCCCGATAGACTTACTAACGGTGTGTACTAGACGGTGGTTCGGTTAGATTTAA
  5   1   2       bld Bone                            IMAGE:8740194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGTCTGGGAAAGACACTGGATAACATACTGAATGTTTCCATCACCCATGTATGGCAGCACCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAGCAGCCATGATTGTTGTGACATGTCTACGACCACACCCCCACCACTGGCACGTAAATGGTATTGTCCAAGCACACTGCTGTAGACGTAAAAAGGATGCCCCGCTAGCCATAGCTAACGTGTGTAGAAGGACGTGATCAGGTAAGTCAACTGCATATGGTCACTGGATG
  5   1   2       bld Thy                             IMAGE:8551119.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCATTCTCTCCGATGCAGCTCCACACAATTATACTTTTATTTGCTACAAAATGATGTGGTTAAAAGGAACCTCAGGAGCAGGCATGGGATATATACCATACAATAGGCTGTTAGTTGGGTTAGGTGTTGCCTTCAGGCCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCAGAGGCACAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGCTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTATTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAATGGTTATTGGNNTCCCAANGCACACTGCTTGGTAGACGTTAAAAAAAGATGGCCCCGCTAGCACTTAGCTATACGTGTGTGTCCTTAAGACAGTGGTTCTGGTAGATCTACATGCTATGTC
  5   1   2       bld Ga18      in                      xlk121a12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAGTGTTGCCTTCAGNCTGACATGGCCATGCTACACTCAGCCCAGGGGTACGAACCANNNNNCAACTAAATACCCACACAGCCTGGTGCAACATTTTCAATTGGGCCTTGNTCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCNNCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTGAGCCCCATTTGATGGCCTCCTGGGCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGANNNNNGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGNCTTATAAAATAGGNTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGNGTATTACCTAAAATAGAAGCAGNCATGATTATTGTGACATGTCTACAGACCACACCCCCACCNCTNGCCAACGNAAAATGGT
  3   1   2       bld Ga18      in                      xlk121a12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CANCNAGGGGTNCGNNNNGANGNNNACTAANNNCCCNNACAGCCTGGTGNAANNTTTTCAATNGGGNCNTNCTCCACAATCTAANCTCACNCCNNNCACCTTTCCCTTACTGATACTCCATANNATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTGAGCCCCATTTGATGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGNAATGCACGGGGNCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTNTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTATTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGNCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGNCACTTNTCTTTTAGA
  3   1   2       bld Ga18      in                      xlk105n19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGGGNTNCGNANCNNGAGGCACNACTAANNNCCNNNNCAGCCTNNNGCANNNTTTCAANTGGGNNTNCTCCNNAATCTAANCTCNCACCACNNNCCTTTCCNTTACTGATNCTCCATANNATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTANCCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAANNGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTNTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACACTTNTCTNTTAGAG
  5   1   2       bld Ga15                               XL424f20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCACGTCGTTCCGCCACAATCTAAGCTCACACCACGCACCTTTCCCTTACTGATACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGCCCACTTGTATTCNGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATANAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTaaaaaaaaGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTA
  3   1   2      seed Ga15      in                       XL463o06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTCCATAGCATCGCCTGGGGGACATCCTGGTGCATTTAATCAGTCCACTTGTATTCAGCCCCATTTGATGGCCTCCTGGGCCAGATCTGCTTGGTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACAC
  3   1   2       bld Neu7      in                         XL004n03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGAGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGTACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGTGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTNCTGAATGGTACAGACACTTGTNCTTTTAGAGATTTTATTTTNCTATTAAAGCACA
  3   1   2       bld Tbd7      in                         XL090o12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGTGGGCAAATAAGTCTTTAACCAATTTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTACTGTNCTGAATGGTACAGACAC
  3   1   2       bld Neu7      in                         XL011b14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTAAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTATTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACACTTGTNCTTTTAGAGATTTTATTTTCTATTAAAGCACAATTTCCCCA
  3   1   2       bld Neu7      in                         XL032g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCCAGCAATGTACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGTGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACACTTGTGCTTTTAGAG
  3   1   2       bld Tbd7                                 XL087p22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACACTTGTCTTTTAGAGATTTTATTTTNCTATTAAAGCACAATTTCCCCA
  3   1   2       bld Tbd7      in                         XL089c06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGCAATGCACGGGGCCCAATCAGGATGATCTGATTGAAAGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACACTTGTNCTTTTAGAGATTTTATTTTNCTATTAAAGCACAATTTCCCCA
  3   1   2       bld Neu7      in                         XL017n22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCGAATGCCAGAGTTTGATAAATGTATTCAGAGTCTTGTCCTTAGCAATGTAGGGGTGCAAGTCATGAAGCGCCTTATAAAATAGGTTTATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTCTGTCTGAATGGTACAGACACTTGTCTTTAGAGATTTTATTTTCTATTAAAGCACAATTCCCCA
  3   1   2       bld Tbd7      in                         XL092g16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATTACCTTTATTCTTTCCTATAGAGTTTACACATGCTGTTTCACCCGGGGATGCTGAATTATCCTAATAGTTAAGTGTATTACCTAAAATAGAAGCAGCCATGATTGTTGTGACATGTCTACAGACCACACCCCCACCACTGGCCAACGGTAAAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAATTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATNTGNNCATTGCTTATATGGTACTGTGTTTNTATGTTG
  3   1   2       bld Neu7      out                        XL046m11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATGGTTATTTGGTTCCCCAAAGGCACACTGCTTGGTAGACGTTAAAAAAAAGGAATGGCCCCCGCTAAGCACTTTAGCTATAACCGTGTGTGTCACTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCAAACTGGGAANTGTGAAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGNACTGTGCT
  3   1   2       bld Neu7      in                         XL048n13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGGCCCCCGCTNAGCNCTTNAGCTATANCCGTGTGTGTCNCTTTAAGGACAGGTGGGTTTCTGGGTATAGATCTAAACATGCATTATTGGTCNANCTGGGAATTGTGNAATTGTGATTGTTCCCGCTCCCTGCACCTTCCCACTGGTCCCATTTGTGCATTGCTTATATGGTACTGTGCTTTTATGTTGAGGTACTGCTGTTGAATGGAATAAAACCACTAATACTGCAAATTATTGAGCTTGCACGAAGGTTACTGTNCTGAATGGTACAGACACTTGTNCTTTAGNAGNATTTTATTTTNCTATTAAAGCACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)