Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl316c17.5                            3 END     1           2       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL436h17ex.5                         51 PI      88          8     1194                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:7980965.5                       9 PI      78        383      669                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:7979206.5                       5 PI      79        384      624                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012838056 Xl3.1-xl316k02.3.5 - 39 ESTs
                                                                       ....-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl316k02.3.5                                                                           TTTGGAAACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTATTTAAGGATGGACTTGTAATGTACAACCCACTACATTACTGCACTCCAAACAGTGCCCTCCAAGCACAGCCAGTGCTCCAGACATGCTTGGCAATACCAGAGAACTTTGCCATGCCCTTGCCCATGTCAACTCACCTTGCACCCTACCCAGAAGTTCCTTGCCCGGTTTCTTACCCTGCCCAGGGGGTACACAGGGGTTTTAAAGCCCAGGATGCTGATAACCATCCCAATAATTCACAGAGCAAATGTTCATTCAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTTCAGTCTACTTATGCTAAATAAAATAATTCACCTGAA
                                                  Xl3.1-CHK-1012722819                                                                                 AACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCACCAGGAGTTATTTAAGGATGGACTTGTAATGTACAACCCACTACATTACTGCACTCCAAACAGTGCCCTCCAAGCACAGCxxxTxCxxxxGACATGCTTGGCAATACCAGAGAACTTTGCxxxGxCCTTGCCCATGTCAACTCACCTTGCACCCTACCCAGAxxTxxxTTGCCCxGxxxxTTACCCTGCCCAGGGGGTACACAGGGGTTTTAAAGCCCAGGATGCTGATAACCATCCCAATAATTCACAGAGCAAATGTTCATTCAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTTCAGTCTACTTATGCTAAATAAAATAATTCA
                                                      consensus depths                                                                                2     4     2     4     3     5     4     6     5     6     9    10     9    10    10    11    10    11    10    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    12    12    11    11    11    11    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    13    12    12    12    12    10    12    10    10     8     8    10    10    10    10    10    10    10    11    10    11    10    10     7     8     5     5     5     5     4     4     3     5     4     5     2     5     4     5     2     5     3     5     2     5     2     5     2     5     3     5     3     5     3     5     2     5     3     6     4     7     4     7     4     7     3     7     4     7     5     9     6    10     7    12     7    12     7    13     8    14     8    13     8    13    10    15    11    15     9    15    10    15    11    15     9    15    14    17    14    20    16    20    17    20    17    20    17    20    17    20    16    20    18    21    18    20    16    18    16    18    15    18    16    19    16    19    16    19    15    16    16    17    17    17    16    17    17    17    16    17    17    17    16    16    16    16    16    16    16    16    17    17    17    17    17    17    16    17    16    17    15    17    14    17    16    17    16    17    13    17    14    16    14    16    11    16    11    16    11    16    11    16    11    16    10    16    10    16     9    14     8    14     8    13     7    10     4     5     4     5     2     3
  5   1   2      ests                               Xl3.1-XL445p06ex.5                                                                           TTTGGAAACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCTTAGAAGGAGGAA
  5   1   2      ests                                 Xl3.1-xl316k02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTTATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCTATCCAACCTCAGCCAGTGCTCCAGCAGACTTCACTGACATGCATGGCAATACCAGAGACCTTGCCCATGTCAACTCACCTTGCACCCTACCCAGACATAAAGAGGAAGGTTTCTTACCCTGCCCAGGGGGTACACAGGGGTTTTAAAGCCCAGGATGCTGATAACCATCCCAATAATTCACAGAGCAAATGTTCATTCAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTTCAGTCTACTTATGCTAAATAAAATAATTCACCTGAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTCAACCAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------A
                                               BLH ATG     100     442                                                                           
                                               BLH MIN     100     117                                                                           
  5   1   2      ests                               Xl3.1-XL445p06ex.5                                                                           TTTGGAAACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCTTAGAAGGAGGAA
                                                  Xl3.1-CHK-1012690987                                                                                 AACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCTTAGAAGGAGxAAAAGATT
  5   1   2      seed Ga15 5g3  in                       XL445p06ex.5p TGCTGGGGCACACCAGTGCTCATATAAAGAGGAGGGGGAGAGAGCAGGGATATATCAGTTATCCCCCTTAGCCATTTGGAAACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCTTANAAGGAGGAAAAGGTTTAAG
  5   1   2       bld Ga18 5g3  in                      xlk127p16ex.5p                                       GGAGAGAGNAGGGATATATCAGTTATCCCCTTAGCCATTTGGAAACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTNNNNGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGANAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCANNNNNAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGNCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGANTTTATCAGCAGCAAGTTCCCTTACTACAAGGNCAAGTNCCCTGCTTGGNNNAANTTCCATCAGGCACNACCTGTCCCTTNATGACTGCTTTATTNAAATAC
  5   1   2       bld Tbd7 5g3  in                         XL076k12.5p                                                   TATATCAGTTATCCCCTTACCATTTGGAAACTACACATTCACAGNAGNAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTA
  5   1   2       bld Neu4 5g3  in                    IMAGE:3557109.5p                                                                    TTAGCCATTTGGAAACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTNTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTNTGATAACGGN
  5   1   2       bld Tbd7 5g                              XL078n22.5p                                                                                                  TGCAGGCAATTCGGCACGAGGCTCACTGGAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAACGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTC
  5   1   2       bld Neu7 5g3  in                         XL049e20.5p                                                                                                            AAGCACAACTCTCACTGGNAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAACGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCTTAGAAGGAGGAAAA
  5   1   2       bld Ga12 5g3  in                         XL141m04.5p                                                                                                                            TGGAGATCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATT
  5   1   2       bld Ga12 5g3  in                         XL213c02.5p                                                                                                                                  TCCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGGAAC
  5   1   2       bld Ga12 5g3  in                         XL188e15.5p                                                                                                                                   CCTGCTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCACTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCTTAGAAGGAGGAAAAGGT
  5   1   2       bld Ga12 5g3  in                         XL185p20.5p                                                                                                                                       CTGTCTACTACTTACTGCCAACCAAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAACGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCTTAGAAGGAGGAAAA
  5   1   2       bld Tbd7 5g                              XL101l18.5p                                                                                                                                                              AAGCATTAGTGCTAACAATGAGCTTTAGCCAGGAGTCTGGTGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATCCCTGCAGCCTAAAGTCACACTTTTACCTACAGCCCACACATTCAGTGATGGGGGACAGTGAGATGCTGAGTCCTTCCAAGCTCAGCTGCACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCT
  5   1   2       add Ga18      in                       xlk80b17ex.5p                                                                                                                                                                                             GGAGNCTGGNGCCCATCATCACCCCCAGGATTATGCAGGACTTTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGANGATCCCTGCAGCCTAAAGNCACACTTTTACCTACAGCCCACACATTCAGNGATGGGGGANAGTNAGATGCTGAGNCCTTCNAAGCTCAGCT
  5   1   2       bld Ga12      in                         XL150g24.5p                                                                                                                                                                                                                                                                                                                                                                            ACTGAAAGTGAGAGTGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCTCAACCACCCCAACTGGTAGCAAAGCCAAAAGGACTCTGGTAAAGCCTCCTTACTCTTACATTGCTCTAATCACCATGGCTATCCTGCAGAGTCCCCACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCANAATTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCAC
  5   1   2       bld Ga12                                 XL179l16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCCCTGCTTGGCANAATTCCATCAAGCACAACCTGTCCCTTANTGACTGCTTTATTAGAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGACCCTGCTTCTGAGGACATGTTTGATAACGGAAGCTTCCT
  5   1   2       bld Emb1                   IMAGE:6632292-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTAGACCCTGCCTCCAAGGACATGTTTGATAACGGAAGCTTCCTTAGAAGGAGAAAAAGATTTAAAAGGCAACACCAGGAGTTATTTAAGGATGGACTTGTAATGTACAACCCACTACATTACTGCACTCCAAACAGTGCCCTCCAAGCACAGCAGATTCCAATGACATGCTTGGCAATACCAGAGAACTTTGCCATGCCAAACCACCTTGTTCCCTACCCCGACATAAACATAACAGTTCCTTGCCCCGACCAGGGGGTACACAGGGTATTGACAGCACAGGATGTTGATAACCATCCCAGTAATTCTCACAGCAAATGCTCATTTAGTATAGAGAACATCATGGGTGAAACCAAGGAGCCAGAAAAACATCTTACAAGCTTCAACCAAAATTGGAACTATAATCATTTGTTGCAGAGTTCAAGGTTGTGCCTTCTTCCATCTGGGTCTCACCTTGCCAATGCCCATCATTCAGCACAGTGCAACCTCATAAAGTTCCCTGGGTGCTATTAAAGTGTCAGACTTTGGGCATCACCTGGACTACATACACTAGTAATCATAATACTCCTGGTTGCCTCTTCCTGAATTCTACTTCATCTAGGACATTGCATTGGCTCTGACCCCAAAATTCTTAGTTTGTATTTATTGTCTAAAAAAGGCTCTGCGTCCTTGGCTATCCTGTTAGCTA
  5   1   0       add Emb1                            IMAGE:6632292.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCACGAAATCCAGGAAAAGGCAATTATTGGACACTAGACCCTGCCTCCAAGGACATGTTTGATAACGGAAGCTTCCTTAGAAGGAGAAAAAGATTTAAAAGGCAACACCAGGAGTTATTTAAGGATGGACTTGTAATGTACAACCCACTACATTACTGCACTCCAAACAGTGCCCTCCAAGCACAGCAGATTCCAATGACATGCTTGGCAATACCAGAGAACTTTGCCATGCCAAACCACCTTGTTCCCTACCCCGACATAAACATAACAGTTCCTTGCCCCGACCAGGGGGTACACAGGGTATTGACAGCACAGGATGTTGATAACCATCCCAGTAATTCTCACAGCAAATGCTCATTTAGTATAGAGAACATCATGGGTGAAACCAAGGAGCCAGAAAAACATCTTACAAGCTTCAACCAAAATTGGAACTATTAATCATTTGTTGCAGAGTTCAAGCGTTGTGCCTTCTTCCATCTGGGTCTCACCCTTGCCCAATGCCCATCATTCAGGCACAGTGCAAACCTCCATAAAAGTTCCCCCTGGGGTGCTATTAAAGTGCCGGACTTTTGGGGCATCCCCCTGGAACTACCTACCCTTAAGTAATCATAATAACTCCTGGGTTGCCCTCTTTCCTGAAATTTCTACTTTCATCTAGGAACTTTCGGCATTGGGCTCCCTGACCCCACAAAATTGCTTAAGCTCTGGTATTTTATTGGCCCTaaaaaaaaGGCTCTGCCCTTCCCTTTGGGCTATTCCCTGTGCAACCTAAGAACCTCCCTATCAACTTGGGAAGGCTAACCAAGTGTTGCAATAATACACTCGGGTCCAACAGGCAATCGGAATTTTGGCGTGGGACCGTCCCCCAATACCAGGCGCGCATTTTGTGAAAAAGCCCGGCAACACAGAGGGAATCGCACTCTGGGCCCCCTTATGATGGCACAAATTCGGTCCA
  5   1   0       add DMZ                                  xl340d04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTACAAGCTTCAACCAAAATTGGAACTATAATCATTTGTTGCAGAGTTCAAGGTTGTGCCTTCTTCCATCTGGGTCTCACCTTGCCAATGCCCATCATTCAGCACAGTGCAACCTCATAAAGTTCCCTGGGTGCTATTAAAGTGTCAGACTTTGGGCATCACCTGGACTACATACACTAGTAATCATAATACTCCTGGTTGCCTCTTCCTGAATTCTACTTCATCTAGGACATTGCATTGGCTCTGACCCCAAAATTCTTAGTTTGTATTTATTGTCTAAAAAAGGCTCTGCGTCCTTGGCTATCCTGTTAGCTAGAACTCCTAGAGTTGGAGGGAACAAGTTGTATATACCTGGTCAAAGGGACGCTCCAGCAGAAAAATGGATGTAAAAGAGGCACGCAAGAGAAACACCACAGACTGTAATGCCATCAAAGCCACCAAAAGCAATCCCACTATGTGTCTGAATAAAAGCAGGAAAAAGAACTTGCTGCAGGAAGACACCAACTACAGAAGATGAGAGGTGTATTACAAAGAGATCANGAAGCCCANAGGAGCATCCNATTGATGGAANGGAANANAAAAGGANTANAGNGGACNCCANNCACCNNCGNCCCNCANNATTACNNANTANNNANNCNNGA
  5   1   2      ests                                 Xl3.1-xl316k02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTTATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCTATCCAACCTCAGCCAGTGCTCCAGCAGACTTCACTGACATGCATGGCAATACCAGAGACCTTGCCCATGTCAACTCACCTTGCACCCTACCCAGACATAAAGAGGAAGGTTTCTTACCCTGCCCAGGGGGTACACAGGGGTTTTAAAGCCCAGGATGCTGATAACCATCCCAATAATTCACAGAGCAAATGTTCATTCAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTTCAGTCTACTTATGCTAAATAAAATAATTCACCTGAAAA
                                                  Xl3.1-CHK-1012689318                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTTATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCTATCCAACCTCAGCCAGTGCTCCAGCAGACTTCACTGACATGCATGGCAATACCAGAGACCTTGCCCATGTCAACTCACCTTGCACCCTACCCAGACATAAAGAGGAAGGTTTCTTACCCTGCCCAGGGGGTACACAGGGGTTTTAAAGCCCAGGATGCTGATAACCATCCCAATAATTCACAGAGCAAATGTTCATTCAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTTCAGTCTACTTATGCTAAATAAAATAATTCACC
  5   1   2       bld Ga18      in                       xlk73b10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGNNCCTGCTTCTGAGGNCATTTTGATAACGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTTATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCTATCCAACCTCAGCCAGTGCTCCAGCAGACTTCACTGACATGCATGGNAATACCAGAGACCTTGCCCATGTCAACTCACCTTGCACCCTACCCAGACATAAAGAGGAAGGTTTCTTACCCTGCCCAGGGGGTACACAGGGGTTTTAAAGCCCAGGATGCTGATAACCATCCCAATAATTCACAGAGCAAATGTTCATTCAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGNTTAACTTATCCACTGGCCCTCTNCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGANCTTCTTGTGTNCNAAATCCAAAGACtttaattttattttttatttaTTGTCGANGANNNGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTNCCGGG
  5   1   2       bld DMZ       in                         xl316k02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCTATCCAACCTCAGCCAGTGCTCCAGCAGACTTCACTGACATGCATGGCAATACCAGAGACCTTGCCCATGTCAACTCACCTTGCACCCTACCCAGACATAAAGAGGAAGGTTTCTTACCCTGCCCAGGGGGTACACAGGGGTTTTAAAGCCCAGGATGCTGATAACCATCCCAATAATTCACAGAGCAAATGTTCATTCAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTATTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACtttaattttattttttatttaTTGTCGA
  3   1   2       bld Ga18      in                       xlk73b10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TNCTTTAAGGANGGNCTNNTGATNNNNACTNTCTGCCTTNCTACNNGNCCCTANAGTGCTANCCNNCNTCAGCCAGTNCTCCAGNAGACTTNNCTGACATNCATGGCAATNCCAGAGNCCTTGCCCATGTCAACTCACCTTGCACCCTACCCAGACATAAAGNNGAANNTTTCTTACCCTGCCNAGGGGGTACACAGGGGTTTTAAAGCCCAGGATGCTGATANNCATCCCAATAATTCACAGAGCAAATGNTCATTCAGTATTGAGAACATCATGAGGAAACCCAAGGANNCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCANNTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTNNCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTNNNNNCAGTGGGCAACGGGTATGCAGTTTTGTAACACCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTNNAA
  5   1   2       bld Emb1                            IMAGE:6634424.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGGTTTCTTACCCTGCCCAGGGGGTACACAGGGGTTTTAAAGCCCAGGATGCTGATAACCATCCCAATAATTCACAGAGCAAATGTTCATTCAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACtttaattttattttttatttaTTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACCACCCAAACGTGGGCACATGTGCCTGCCTGGGAGGCTTTGGAATTTACGCTTGGAATTCACCTATGGGATTTTTATGGAATATGGGGTGTGGGAAAATTGGTGGGTTTTTAGGGATGGGCTTTAAGGAATGTCCACCTTTGGGCCCCCCCAGTGTGGCCAGACGGGGGTTAATTGCCaggttttttgttaaaccggccattccctttttttggtttgtttgggcctttaaattttttAACTGGGGTGTTAAACATTNTTTTAAATTGGGTAAAAGACTTTACGAAATGGGGGTAAAT
  3   1   2       bld Ga18 5g3  in                      xlk127p16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TNNNTANCCNNCCAGGGGGTANNNANGGNTTTNNAAGCCCAGNATGCTGANANCNNNCCANTANTTCACAGAGNAAATGTTCATTCAGTATTGAGAACATCATGAGGAAACCCAAGGANCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGANCTATAATCATGTATTCCAGAGGCCAAGTTCCTGNCTTCTCCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTNNCAGGCAATACANCCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGNCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTNNNNAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTNNA
  3   1   2       bld DMZ       in                         xl316k02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTCACAGAGCAAATGTTCATTCAGTATTGAGAACATCATGAGGAAACCCANGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTATTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCACTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAAACACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACACCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTAT
  3   1   2      seed Ga12 5g3  in                         XL188e15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAGCAAATGTTCATTCAGTATTGAGANCATCATGAGGAAACCCAAGGAGCCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTTCAGTCTACTTA
  3   1   2       bld DMZ       out                        xl316c17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGCAAATGTTCATTCAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTNTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCAAGTTTCNANTAGGTGAC
  3   1   2       bld Ga18      in                       xlk80b17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AANNTCANNNAGTATNNNNANATCATNNGNANCCCNNGNNNNAGANCCAAATNTTCAAAGCTTCNACTCACACTGGAACTATAATCATGTNNCCAGAGGCCAAGTTNNNGCCTGCNCCCAGCTGTGNTTAACTTATCCACTGNNCCTCTGCTAGNCAATACTCAGGGTNNCAGGCAATACAACCTCANACAATTCCCTGGGTGTNACTGAAGTAAGTGACTTTGGGTCTCATACANCTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGNACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTNGNCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTT
  5   1   2       bld Emb1                   IMAGE:6634424-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTCAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACtttaattttattttttatttattGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAAATTGTGGTTT
  3   1   2       bld Neu7 5g3  in                         XL049e20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACCCAAAGGAGCCAGAGCCAAATATTCAAAGCTTCAACTCACACTGGAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCCTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAAGTATTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCACTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAAACACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACACCATCCTTTTGTTTTATCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTTCAGTCTACTTATGCTAAATAAAAT
  3   1   2       bld Ga12 5g3  in                         XL213c02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAACTATAATCATGTATTCCAGAGGCCAAGTTCCTGCNTTCTCCCAGCTGTGCTTAACTTATCCACTGGCCCTCTGCTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCACTTTTCAGTCTACTTA
  3   1   2       bld Ga12                                 XL169o10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCANGTATTCCAGAGGCCAAGTTCNTGCNTTNTCCCAGNTGTGCTTAANTTATCCACTGGCCCTNTGNTAGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTNGGGTCTCATACAACTCCAGTATTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATT
  3   1   2       bld Tbd7 5g3  in                         XL076k12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATAACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACACCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATNCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTCAGNCTACT
  3   1   2       bld Ga12 5g3  in                         XL185p20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCAATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTATTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCACTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAAACACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACACCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTTCAGT
  3   1   2       bld Ga12                                 XL170o10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTNGGGTCTCATACAACTCCAGTATTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTAT
  3   1   2       bld Ga12      in                         XL150g24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTCAGGGTGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTTCAGTCTACTTATGCTAAATAAAANATTCACC
  3   1   2       bld Ga15 5g3  in                       XL445p06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCCAGGCAATACAACCTCATACAATTCCCTGGGTGTTACTGAAGTAAGTGACTTTGGGTCTCATACAACTCCAGTACTGCCCTCCCATTTTCTTAATATGTTATNGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTNGAATCACTATGGATTTTATGTATANGTGTGTGAAATTGNGGCTTAGGANGGCTTAGGGATGTCACTNGGCCCCAGNGGGCAACGGGTATGCAGTTTNGTAACACCATCCTTTNGTTTNGTCTTATTTTACNGTTAATATATAANGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTAGTGCAACTTT
  3   1   2       bld Neu4 5g3  in                    IMAGE:3557109.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCCATTTTCTTAATATGTTATTGCTCATGGATTCTACAACTAGGACCTTCTTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTTATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTACTAAAGTAAAATTTCTAGCACCCCCTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGTTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTTCAGTCTACTTATGCTAAATAAAATAATTCACCTGAAAA
  3   1   2       bld Ga12                                 XL146k01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGTGTCCAAATCCAAAGACTTTAATTTTATTTTTNATTTATTGTCGAAGACAAGGTTATCCAATCTGTGACCCTCCACTTTGTANTAAAGTAAAATTTCTAGCACCCCNTAAATTACAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGGACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGANATTGTGGCTTAGNATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCACCCTTTTGTTTTGTCTTATTTTACTGTTAACANATAATGTAAATA
  3   1   2       bld Ga12 5g3  in                         XL141m04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTTATCCGNTGTGNGACCCTCCACTTTGNNNNAAAGTAAAATTTCTAGCACCCCCTAAATNNCAAGGTTGTCCGGGAAGGACGGAAGTTGCAGTTCAATAACAGCTAGAGAACCGCTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGCANGCNTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGCTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTGTAATATATAATGTAAANAGAAATGTA
  5   1   2       bld Neu2                            IMAGE:2942305.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGTTATACATAACCAGACAGTCATATGTACTTGTATGACAACCCAAACGTGGCACATGTGCTGCTGGAGGCTTGAATTACGCTTGAATCACTATGGATTTTATGTATATGTGTGTGAAATTGTGGTTTAGGATGGCTTAGGATGTCACTTGGCCCCAGTGGGCAACGGGTATGCAGTTTTGTAACGCCATCCTTTTGTTTTGTCTTATTTTACTGTTAATATATAATGTAAATAGAAATGTAATCTATTCAACTATTTATTATAAAAGTTATTGCAACTTTTCAGTCTACTTATGCTAAATAAAATAATTCACCTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaagaaaaggaaaaggaaaaggaaaaaaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)