Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:3301213-IMAGp.5                32 END     1           3        3                UPF0532 protein
     2   2.0    0Xl3.1-xl231d17.3                           12 END     2           7       16                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-XL193p07.3.5                         58 PI      82       1675     1963                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:6862554.5                      33 PI      91          1      856                hypothetical protein LOC446971 [Xenopus laevis]
     5   0.0    0Xl3.1-XL479m05ex.3                         12 PI      85       1677     1823                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:5571993.5                      11 PI      79       1671     1943                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:6957507.3                       6 PI      77       1686     1947                (no blast hit)
     8   0.0    0Xl3.1-XL418g04ex.5                          4 PI      82       1678     1848                (no blast hit)
     9   0.0    0Xl3.1-XL040d03.5                            3 PI      77       1675     1966                (no blast hit)
    10   0.0    0Xl3.1-XL204b16.5                            2 PI      80       1671     1963                (no blast hit)

 This cluster: approximate FL confidence score = 70%

 1012838060 Xl3.1-IMAGE:7976843.5.5 - 28 ESTs
                                                                       .....-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:7976843.5.5                                    TACAGATGGCGGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTAGGAGAAGATGGGCCAAACATTAAAACTGGGGAACAGAAAGAAGAAATCACAACTCCTGTCATAAAAGAAGAGGAAATAAACATGCCAAATGGAGCGTCCACTAGTACAGAGACAAATCAGAAATGTGCAGCTGGAGAAGGATCCCACCTGCTGAAATCAGAAGGCAGCCCTCCGAGTGTATGCAAACTAAAAGAAATGAAAGTGTCTCCAGGATCCAAAGCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTCCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACGGAGGATATTCAGCAATTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTAGGAATTCAAATGCTGTTTCATATCAATACGCTCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCTTTACACCGGGGCCTTCGAGGAGCCATAGATAAAATGAGACTTCTGTTTTCACTATACAAACTGTAATGCGTCTGATTTTTAGGAAAGCCGTTTGAAAGTTTCCAGTTGTAAGTGAGCTTCACTTCCTGAGAAGTTGTTGTCATGTGATAGGGTTGTCTGAATTCTCTTCCAGGTGCAGCATGGAACAGGCCCGCCTTTATCTGCTTGCTCAAATGCTAGTGAGAGGCGTGGTTCACCTTTAAGGTAACCTTTATTATGTTATAGAACGGCCAATTCTAAGCAACTTTTCAATTGGTTGTCATTATTTATAGTTATTTGCATTTTTCTTCTGACTCTTTGCGGCTTTCAATTGGGTGTTGCTGACCCCTTCTAAAAACAAATGCTCTGTAAGGCTACAAATGGCTACAAATGTATCATTTTTATTACTCATCTTTCTATTTAGTATATTCAAGTCTCTTATTCAAATTAGTGCATGGTTGCTAGGCTAATTTGGACCCTAGTTACCAAACTGCTTAAAATAC
                                                  Xl3.1-CHK-1012721454                                          TGGCGGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTAGGAGAAGATGGGCCAAACATTAAAACTGGGGAACAGAAAGAAGAAATCACAACTCCTGTCATAAAAGAAGAGGAAATAAACATGCCAAATGGAGCGTCCACTAGTACAGAGACAAATCAGAAATGTGCAGCTGGAGAAGTATCCCACCTGCTGAAATCAGAAGGCAGCCCTCCGAGTGTATGCAAACTAAAAGAAATGAAAGTGTCTCCAGGATCCAAAGCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTCCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACGGAGGATATTCAGCATTTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTAGGAATTCAAATGCTGTTTCATATCAATACGCTCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCTTTACACCGGGGCCTTCGAGGAGCCATAGATAAAATGAGACTTCTGTTTTCACTATACAAACTGTAATGCGTCTGATTTTTAGGAAAGCCGTTTGAAAGTTTCCAGTTGTAAGTGAGCTTCACTTCCTGAGAAGTTGTTGTCATGTGATAGGGTTGTCTGAATTCTCTTCCAGGTGCAGCATGGAACAGGCCCGCCTTTATCTGCTTGCTCAAATGCTAGTGAGAGGCGTGGTTCACCTTTAAGGTAACCTTTATTATGTTATAGAACGGCCAATTCTAAGCAACTTTTCAATTGGTTGTCATTATTTATAGTTATTTGCATTTTTCTTCTGACTCTTTGCGGCTTTCAATTGGGTGTTGCTGACCCCTTCTAAAAACAAATGCTCTGTAAGGCTACAAATGxxTxxxxATxxxTCATTTTTATTACTCATCTTTCTATTTAGTATATTCAAGTCTCTTATTCAAATTAGTGCATGGTTGCTAGGCTAATTTGGACCCTAGTTACCAAACTGCTTA
                                                      consensus depths                                         3     3     9    10    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    13    14    14    14    11    13    11    13    12    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    10    13    10    13    10    13    10    13    10    13    10    13     8    13     6    13     7    14     7    10     5     9     4     9     6     9     4     8     3     8     4     8     4     8     4     8     7    11     6    11     7    11     7    11     8    11     7     9     7     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10     9    11     9    11     9    12    10    12     8    11     8    11    10    11     8    11     8    11     8    11    10    11     9    10     8    10     8    10     8    11     8    11     8    11     8    10     8    10     8    10     8    11     8    11     8    11     8    11     6    10     4     8     4     8     4     7     4     6     3     6     3     5     3     5     3     5     3     6     3     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     3     6     4     6     4     6     3     6     5     6     5     6     4     6     2     6     2     6     2     6     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5
  5   1   2       e50                            Xl3.1-IMAGE:7976843.5                                    TACAGATGGCGGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTAGGAGAAGATGGGCCAAACATTAAAACTGGGGAACAGAAAGAAGAAATCACAACTCCTGTCATAAAAGAAGAGGAAATAAACATGCCAAATGGAGCGTCCACTAGTACAGAGACAAATCAGAAATGTGCAGCTGGAGAAGGATCCCACCTGCTGAAATCAGAAGGCAGCCCTCCGAGTGTATGCAAACTAAAAGAAATGAAAGTGTCTCCAGGATCCAAAGCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTCCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACGGAGGATATTCAGCAATTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTGGGAATTCAAATGCGGTTTCATATCAATACGCTCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCATTACACCGGGGCCTTCGAGGAGCCATAGATAAAATGAGACT
  5   1   2       e50                              Xl3.1-xlk115d05ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTAGGAATTCAAATGCTGTTTCATATCAATACGCTCAATCACAANCTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCTTTACACCGGGGCCTTCGAGGAGCCATAGATAAAATGAGACTTCTGTTTTCACTATACAAACTGTAATGCGTCTGATTTTTAGGAAAGCCGTTTGAAAGTTTCCAGTTGTAAGTGAGCTTCACTTCCTGAGAAGTTGTTGTCATGTGATAGGGTTGTCTGAATTCTCTTCCAGGTGCAGCATGGAACAGGCCCGCCTTTATCTGCTTGCTCAAATGCTAGTGAGAGGCGTGGTTCACCTTTAAGGTAACCTTTATTATGTTATAGAACGGCCAATTCTAAGCAACTTTTCAATTGGTTTTCATTATTTATAGTTATTTGCATTTTTCTTCTGACTCTTTGCGGCTTTCAATTGGGTGTTGCTGACCCCTTCTAAAAACAAATGCTCTGTAAGGCTACAAATGTCTACAAATGTATCATTTTTATTACTCATCTTTCTATTTAGTATATTCAAGTCTCTTATTCAAATTAGTGCATGGTTGCTAGGCTAATTTGGACCCTAGTTACCAAACTGCTTAAAATACA
                                                                   SNP                                                                                                                                                                                                                                                ----T----A--
                                                                   SNP                                                                                                                                                                                                                                                            ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                        ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------C-
                                               BLH ATG       5     149                                    
                                                                                                      PROTEIN --- Ce ---- 1e-039     NP_492187.2 T22C1.1 [Caenorhabditis elegans] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                     PROTEIN === Os ==== 2e-069     NP_001057775.1 Os06g0529800 [Oryza sativa (japonica cultivar-group)] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                PREDICTED - Sp ==== 2e-071     XP_001197926.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                 PROTEIN --- At ---- 1e-072     NP_001078436.1 PHD finger protein-related [Arabidopsis thaliana] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                   PROTEIN --- Dm ==== 8e-078     NP_609837.1 CG15141-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                     PROTEIN === Ag ==== 1e-081     XP_310183.4 AGAP009512-PA [Anopheles gambiae str. PEST] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                          PROTEIN --- Dr ==== 7e-138     NP_997794.1 Unknown (protein for MGC:55404) [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                     PREDICTED - Hs ---- 8e-154     NP_786924.2 hypothetical protein LOC55148 isoform 2 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                     PREDICTED - Mm ---- 2e-155     NP_079942.1 RIKEN cDNA 5730410I19 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                     PREDICTED - Cf ---- 2e-156     XP_868482.1 PREDICTED: similar to Protein C14orf130 isoform 5 [Canis familiaris] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                        PREDICTED - Bt ==== 5e-157     NP_001076070.1 ubiquitin protein ligase E3 component n-recognin 7 (putative) [Bos taurus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                              PROTEIN --- Xl ---- 0          AAI10721.1 Unknown (protein for IMAGE:7976113) [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:7976843.5.5                                         ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------ATG---------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------TAA---------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------TAG------TGA------------------------------------------TAG------------------------------TGA------------------------------------------TGA------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------TAA------ATG---------------------------------------------------------TAG------------------------TAG---ATG------------------------------------------------------------TAA
                                                                   ORF                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2       e50                            Xl3.1-IMAGE:7976843.5                                    TACAGATGGCGGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTAGGAGAAGATGGGCCAAACATTAAAACTGGGGAACAGAAAGAAGAAATCACAACTCCTGTCATAAAAGAAGAGGAAATAAACATGCCAAATGGAGCGTCCACTAGTACAGAGACAAATCAGAAATGTGCAGCTGGAGAAGGATCCCACCTGCTGAAATCAGAAGGCAGCCCTCCGAGTGTATGCAAACTAAAAGAAATGAAAGTGTCTCCAGGATCCAAAGCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTCCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACGGAGGATATTCAGCAATTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTGGGAATTCAAATGCGGTTTCATATCAATACGCTCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCATTACACCGGGGCCTTCGAGGAGCCATAGATAAAATGAGACT
                                                  Xl3.1-CHK-1012689188                                          TGGCGGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTAGGAGAAGATGGGCCAAACATTAAAACTGGGGAACAGAAAGAAGAAATCACAACTCCTGTCATAAAAGAAGAGGAAATAAACATGCCAAATGGAGCGTCCACTAGTACAGAGACAAATCAGAAATGTGCAGCTGGAGAAGTATCCCACCTGCTGAAATCAGAAGGCAGCCCTCCGAGTGTATGCAAACTAAAAGAAATGAAAGTGTCTCCAGGATCCAAAGCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTCCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACGGAGGATATTCAGCAATTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTGGGAATTCAAATGCGGTTTCATATCAATACGCCCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCATTACACCGGGGCCTTCGAGGAGCCATAGATAAAATGAGACTTCTGTT
  5   1   2       bld Oo1  5g                         IMAGE:6856933.5p CTCGATCCGCCCGCCAGTGTTTTTACTTCTCCTTATACAGATGGCGGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTTCTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAATAACATCTGCTGAGATGGATCCCTGAAGCAAGGATATCAAGGTTGATGATAGCCTGGCTGAGGGTATTCTAGGAGAAGATGGGCTAAACATTAAAAGTGGGGGAACGGAAAGGAAGAAATCCCCACCTCCCTTTTCATAAAAAGAGGGAAAATAAACCTGCCCCAAATGGGAGCCCTCCCCCCTAGTGGCAAGAAAACAAAATCCCAAAAATTGGTGCCAAAATGGGGGAAAGGGGTTCCCCCACCCTGGGCGGGAAATCCCCGGAAAGGC
  5   1   2       bld Emb4 5g                         IMAGE:4683928.5p                        TTACTTCTCCTTATCAGATGGCGGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCTAATAAAGAAGATCCTGCAGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTACACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCGTTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTAGGGAGAAGATGGGCCAAACATTTAAAACTGGGGGAACAGAAAGAAGAAATCCCAACTCCTGTTCATAAAGAGGAGGGAATAACCATGCCAAATGGAGCGTCCACTAGTACCGAGACAAATCANAAATGTGCAGCTTGGAGAATATCCCCCCCTGCTGGAATCAGAAGGCAGCCCTCAGAGTGTATGCCAACTAAAAGAAATG
  5   1   2       bld Emb9 5g                         IMAGE:7976113.5p                         ACTTCTCCTTATACAGATGGCGGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTAGGAGAGGATGGCCAAACATTAAACTGGGGACA
  5   1   2       bld Emb4 5g                         IMAGE:5543251.5p                                      CAGATGGCGGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCTAATAAAGAAGATCCTGCAGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTACACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCGTTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGANAGCAAGGATATCAAGGCTGATGATAGTCTGGCTGAGGGTATTCTAGGAGAAGATGGGCNCAACATTAAAACTGGGGAACAGAAAGAAGAAATCCCACCTCCTGTCCTAAAAGGAGGAAGGAATTAATCTTGCCCAAATGGGAGCGCCCCCCTAAGTACAGAAGACCAATTCCCCAAAATGTGCCCCCCTGGCACAAAATTTccccccccccGGCTTGAAAATCAGAAAGGCGCACCCCTCCCCCAACTGGCATTGCCAA
  5   1   2       bld Emb3                            IMAGE:3399139.5p                                       CACGCGTCCGAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCTAATAAAGAAGATCCTGCAGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTACACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGACGTCCAAGATGAAATGATCCAGTGTATAGTCTGGGACGACTGGTTCCATGGAAGGCACCTT
  5   1   2       bld Te2N      in                    IMAGE:7203461.5p                                             CGGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTAGGAGAAGATGGGCCAAACATTAAAACTGGGGAACAGAAAGAAGAATCANCACTCCTGTCATAAAGAAGAGGAAATAACATGCCAAATGGAGCCCTCACTAGTACAGAGACCAATCAGAATGGGCAAGCTGGAGAAGGATCCCCACTGGCTGAAATCAGAAGGCCAGCCCTCCGAGTGTTATGCAACCTAAAAGAAAATA
  5   1   2      seed Emb9                            IMAGE:7976843.5p                                             CGGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCTAATAAAGAAGATCCTGCAGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTACACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCGTTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTAGGAGAAGATGGGCCAAACATTAAAACTGGGGAACAGAAAGAAGAAATCACAACTCCTGTCATAAAAGAAGAGGAAATAAACATG
  5   1   2       add Ga18      in                      xlk111d17ex.5p                                             ATGGCGGCAAACGGACAGCCAGAGAAGNAGGATGGAGGNGAAGGAGAGGAGNCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGNNNNGGCNCNTNNNTGCTGAAAAATGCTCCTACCCTGAGNNNATGTAAGGCGGNNNNNNTGTATGCGTGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGNGTGTTCATACAAATGTCATGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGNCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGNCTGGTTCCATGGAAGGCACCTTGNNNNNTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATNNATCCTGAAAGCAAGGATATCAAGGTTGATGATAGNCTGGCTGAGGGNATCTAGGNAGAAGATGGGCCAAACATTAAAACTGGGGANNANANGAAGAAATCACAACTCCTTTCATAAAAGA
  5   1   2       bld DMZ       in                         xl231c24.5p                                              GGCAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCGTGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGCGTGTTCATACAAATGTCATGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAAGGTATTCTAGGAGAAGATGGGCCCAACATTAAANCTGGGGANCAGAAA
  5   1   2       bld Ga15                               XL424f10ex.5p                                                CAAACGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCTAATAAAGAAGATCCTGCAGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTACACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCGTTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTANGAGAANATGGGCCAAACATTAAAACTGGGGAACANAAANAANA
  5   1   2       bld Ga18      in                      xlk115d05ex.5p                                                 GCAAACGGACAGCCAGAGAAGNAGGATGGAGGNGAAGGAGAGGAGNCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTNNNNNGGCGCCTNCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCNNNNCTGTATGCGTGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGNGTGTTCATACAAATGTCATGAGGGANATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGNGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGANGAAATGATCCAGTGTATAGTCTGTGAGGACTGGNTCCATGGAAGGCACCTTnnnnnnnnTCCACCGGAGCATATGGACTTTTCAGGAGANNATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTNACAAAAATAACANCTGCTGAGATGGATCCNGAAAGCAAGGATATCNAGGTTGATGATAGNNTGGCTNAGGGTNTTCTAGGAGAAGNNGGGCCAAACATTAAAACTGGGGANNNGA
  5   1   2       bld Em10      in                    IMAGE:7980333.5p                                                    CGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCGTGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATTGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTAGGAGAAGATGGGCCCAACATTAAAACTGGGAAACAGAAAGAAGAAATC
  5   1   2       bld Ov1                             IMAGE:8332582.5p                                                    CGGACAGCCAGAGAAGCAGGATGGAGGCGAAGGAGAGGAGCCAGTGCTGTCTCTGTTGGATGTGCTGGAAGAGGACGATGCGTTAGAAGACAAGGCATGCGCTGTGCTGGGCGCCTGCGATGCTGAAAAATGCTCCTACCCTGAGGGTTATGTAAGGCGGCAAGCTCTGTATGCATGTAATACCTGTACTCCCAATAGAGAAGATCCTGCTGGAATCTGCTTGGCGTGTTCATACAAATGTCACGAGGGACATGACTTGTTCGAACTCTATACAAAGAGGAATTTTCAGTGTGACTGCGGGAATGCAAAGTTTAAACAGCTGGAGTGCAAGTTGTTCCCTGAAAAAGAGAATTGTAATTCACTTAATAAATACAACCAAAACTTCTTTGGTGTGTACTGCACGTGCAAGAGGCCTTATCCGGATCCAGAAGATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCATTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAAGGTATTCTAGGAGAAGAATGGGCCAACATTAAAACTGGGGAA
  5   1   2       bld Ga15      in                       XL432f12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGAGGTCCAAGATGAAATGATCCAGTGTATAGTCTGTGAGGACTGGTTCCATGGAAGGCACCTTGGTGCAGTTCCACCGGAGCATATGGACTTTCAGGAGATGATATGCCAGATCTGCATGGACCGATGTTCGTTTCTTTGGGCCTATGCTGCATATATAGCAATTCCTCCTGTTACAAAAATAACATCTGCTGAGATGGATCCTGAAAGCAAGGATATCAAGGTTGATGATAGTCTGGCTGAGGGTATTCTAGGAGAAGATGGGCCAAACATTAAAACTGGGGAACAGAAAGAAGAAATCACAACTCCTGTCATAAAAGAAGAGGAAATAAACATGCCAAATGGAGCGTCCACTAGTACAGAGACAAATCAGAAATGTGCAGCTGGAGAAGTATCCCACCTGCTGAAATCAGAAGGCAGCCCTCAGAGTGTATGCAAACTAAAAGAAATGAAAGTGTCTCCAGGATCCAAAGCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTTCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGG
  3   1   2       bld Te2N      in                    IMAGE:7203461.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           NGGCCAAACATTAAAACTGGGAACAGAAAGAAGAAATCACAACTCCTGTCATAAAAGAAGAGGAAATAAACATGCCAAATGGAGCCTCCACTAGTACAGAGACAAATCAGAAATGTGCAGCTGGAGAAGGATCCCACCTGCTGAAATCAGAAGGCAGCCCTCAGAGTGTATGCAAACTAAAAGAAATGAAAGTGTCTCCAGGATCCAAAGCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTTCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACGGAGGATATTCAGCATTTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTAGGAATTCAAATGCTGTTTCATATCAATACGCTCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCATTACACCGGGGCCTCGAGAGCCATGAAAAAGAACTCTC
  3   1   2       bld DMZ       in                         xl231c24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGAAAGAAGAAATCACAACTCCTTTCATAAAAGAAGAGGAAATAAACATGCCAAATGGAGCGTCCACTAGTACAGAGACAAATCAGAAATGTGCAGCTGGAGAAGTATCCCACCTGCTGAAATCAGAAGGCAGCCCTCAGAGTGTATGCAAACTAAAAGAAATGAAAGTGTCTCCAGGATCCAAAGCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTTCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACTGAGGATATTCAGCATTTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTAGGAATTCAAATGCTGTTTCATATCAATACGCTCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCTT
  3   1   2       bld Em10      in                    IMAGE:7980333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTTGTCATAAAAGAAGAGGAAATAAACCTGCCAAATGGAGCGTCCTCTAGTACAGAGACAAATCAGGAATGTGCAGCTGGAGAAGGATCCCACCTGCTGAAATCAGAAGGCAGCCCTCCGAGTGTATGCAAACTAAAAGAAATGAAAGTGTCTCCAGGATCCAAAGCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTCCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACGGAGGATATTCAGCAATTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTGGGAATTCAAATGCGGTTTCATATCAATACGCCCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGACCCGTGTATTATTGTCTTACTTCTCTACAACGGGCCATTCGAGGGAGCCAAAAGAAAAATGAAACCTTTG
  3   1   2       bld Ga15                               XL509j13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCGNGATCCCACCTGCNGAAATCANAAGGCAGCCCTCCGAGTGTATGCAAANTAAAAGAAATGAAANTGTCTCCAGGATCCAAAGNTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTCCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACGGAGGATATTCAGCAATTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCGAGCTAAACTTGCAGCTACATGTTCTAGAAATTGGGAATTCAAATGCGGTTTCNATATC
  5   1   2       bld Ga15      in                       XL508j13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCCCACCTGCTGAAATCAGAAGGCAGCCCTCCGAGTGTATGCAAACTAAAAGAAATGAAAGTGTCTCCAGGATCCAAAGCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTCCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACGGAGGATATTCAGCAATTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTGGGAATTCAAATGCGGTTTCATATCAATACGCCCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGACCCGTGTATTATTGTCTTACTTCTTTACAACGGGCCCTTCGAGGAGCCAAAGATAAAATGAGACTTCTGTTTCCACTATaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL508j13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCCCACCTGCTGAAATCAGAAGGCAGCCCTCCGAGTGTATGCAAACTAAAAGAAATGAAAGTGTCTCCAGGATCCAAAGCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTCCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACGGAGGATATTCAGCAATTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTGGGAATTCAAATGCGGTTTCATATCAATACGCCCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGACCCGTGTATTATTGTCTTACTTCTTTACAACGGGCCCT
  5   1   2       bld Tbd7      out                        XL080a08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGAGGAAAGTGTCTCCGGNATCCAAAGNCTAATACGGCAACATACTGGCCGAGCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTTCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGAAAACTGAGGATATTCAGCATTTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTAGGAATTCAAATGCTGTTTCATATCAATACGCTCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCATTACACCGG
  5   1   2       bld Emb4      out                   IMAGE:4202229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAATTGGCGCAGCAAATTGTGCTCATGTGATGACTGCAAGAAGATGTACACACAGCTAGAGGTCCTGTTCCTGTTGGATGAAAATGACACAGTTCAAGCTTATGAAAATAAAGGCAAAACTCAGCAGGCAACAGAGAGCAGAGACCCATTAATGACCGCTCTCAGCAGTATGAATCGGGTGCAACAGGTGGAGCTAATCTGCGAATACAATGATTTGAAGACTGAGCTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGTTGTGAAAACGGAGGATATTAAGCAATTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTAC
  3   1   2       bld Ga15      in                       XL432f12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGACTGATTACCTAAAGAGATTTGCAGAGGAAGGAAAGGGTTGTGAAAACTGAGGATATTCAGCATTTCTTTGAAGAACTGCGCTCTCGGAAAAGGCGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTAGGAATTCAAATGCTGTTTCATATCAATACGCTCAATCACAAACTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCATTACACCGGGGCCTTCGAGGAGCCATAGATAAAATGAGACTTCTGTTTTCACTATACAAACTGTAATGTGTCTGATTTTTAGGAAAGCCGTTTGAAAGTTTCCAGTTGTAAGTGAGCTTCACTTCCTGAGAATGTTGTTGTCATGTGATAGGGTTGTCTGAATTCTCTTCCATGTGCAGCATGGAACAGGCCCGCCTTTATCTGCTTGCTCAAATGCTAGTGAGAGGCGTGCTTCACCTTTAAGGTAACCTTTATTATGTTATAGAACAGACAATTCTAAGCAACTTTTCAATTGGTTGTCATTATTTATAGTTATTTGCATTTTTCTTCTGACTCTTTGCGGCTTTCAATTGGGTGTCGCTGACCCCTTCTAAAAACAAATGCTCTGTAAGGCTACAAATGTATTGTTATCGCTCATTTTTATTACTCATCTTTCTATTTAGTATATTCAAGTCTCTTATTCAAATTAGTGCATGGTTGCTAGGCTAATTTGGACCCTAGTTACCAAACTGCTTAAAATACAAACTGCAGAGCTGCT
  5   1   2       e50                              Xl3.1-xlk115d05ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTAGGAATTCAAATGCTGTTTCATATCAATACGCTCAATCACAANCTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCTTTACACCGGGGCCTTCGAGGAGCCATAGATAAAATGAGACTTCTGTTTTCACTATACAAACTGTAATGCGTCTGATTTTTAGGAAAGCCGTTTGAAAGTTTCCAGTTGTAAGTGAGCTTCACTTCCTGAGAAGTTGTTGTCATGTGATAGGGTTGTCTGAATTCTCTTCCAGGTGCAGCATGGAACAGGCCCGCCTTTATCTGCTTGCTCAAATGCTAGTGAGAGGCGTGGTTCACCTTTAAGGTAACCTTTATTATGTTATAGAACGGCCAATTCTAAGCAACTTTTCAATTGGTTTTCATTATTTATAGTTATTTGCATTTTTCTTCTGACTCTTTGCGGCTTTCAATTGGGTGTTGCTGACCCCTTCTAAAAACAAATGCTCTGTAAGGCTACAAATGTCTACAAATGTATCATTTTTATTACTCATCTTTCTATTTAGTATATTCAAGTCTCTTATTCAAATTAGTGCATGGTTGCTAGGCTAATTTGGACCCTAGTTACCAAACTGCTTAAAATACA
                                                  Xl3.1-CHK-1012703723                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTAGGAATTCAAATGCTGTTTCATATCAATACGCTCAATCACAANCTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCTTTACACCGGGGCCTTCGAGGAGCCATAGATAAAATGAGACTTCTGTTTTCACTATACAAACTGTAATGCGTCTGATTTTTAGGAAAGCCGTTTGAAAGTTTCCAGTTGTAAGTGAGCTTCACTTCCTGAGAAGTTGTTGTCATGTGATAGGGTTGTCTGAATTCTCTTCCAGGTGCAGCATGGAACAGGCCCGCCTTTATCTGCTTGCTCAAATGCTAGTGAGAGGCGTGGTTCACCTTTAAGGTAACCTTTATTATGTTATAGAACGGCCAATTCTAAGCAACTTTTCAATTGGTTGTCATTATTTATAGTTATTTGCATTTTTCTTCTGACTCTTTGCGGCTTTCAATTGGGTGTTGCTGACCCCTTCTAAAAACAAATGCTCTGTAAGGCTACxxAxGxCTACAAATxxxTCATTTTTATTACTCATCTTTCTATTTAGTATATTCAAGTCTCTTATTCAAATTAGTGCATGGTTGCTAGGCTAATTTGGACCCTAGTTACCAAACTGCTTAA
  3   1   2      seed Ga18      in                      xlk115d05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GNNNGAGCNNNTCTGCGAATANAATGATTNNANGNCTGAGCTGNCTGANTNNCTAAAGAGATTTGNAGNNGAAGGAAAGGTTGTGNAANCTGAGGATATTCAGCATTTCTTTNNAGAACTGNGCTCTNNNNAAANNNNGCGCCTGGATGGAATGCAGTACTATTGCAGCTAAACTTGCAGCTACTGTTCAGAAATTAGGAATTCAAATGCTGTTTCATATCAATACGCTCAATCACAANCTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCTTTACACCGGGGCCTTCGAGGAGCCATAGATAAAATGAGACTTCTGTTTTCACTATACAAACTGTAATGCGTCTGATTTTTAGGAAAGCCGTTTGAAAGTTTCCAGTTGTAAGTGAGCTTCACTTCCTGAGAAGTTGTTGTCATGTGATAGGGTTGTCTGAATTCTCTTCCAGGTGCAGCATGGAACAGGCCCGCCTTTATCTGCTTGCTCAAATGCTAGTGAGAGGCGTGGTTCACCTTTAAGGTAACCTTTATTATGTTATAGAACGGCCAATTCTAAGCAACTTTTCAATTGGTTGTCATTATTTATAGTTATTTGCATTTTTCTTCTGACTCTTTGCGGCTTTCAATTGGGTGTTGCTGACCCCTTCTAAAAACAAATGCTCTGTAAGGCTACAAATGTATTGTTATTGCTCATTTTTATTACTCATCTTTCTATTTAGTATATTCAAGTCTCTTATTCAAATTAGTGCATGGTTGCTAGGCTAATTTGGnCCCTAGTTACCAAACTGCTTAAAATACAAACnnnGAGCTGCTAAAnAACTCAAANNCA
  3   1   2       bld Ga18      in                      xlk111d17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNNTCTGNGAATANAATGATTTGAAGACTGANCTGACTGANTNCCTAAAGAGATTTGCAGAGGANNNAAAGGTTGNGAAANTGAGGATATTCAGCATTTCTTTGAANNACTGNGCTCTCGNNAAANNNGGCGCCTGGATGGAATGCAGTACTATTGCAGCTAANCTTGCAGCTACTGTTCAGAAATTAGGAATTCAAATGCTGTTTCATATCAATACGCTCAATCACAANCTTCTCTCTCCTGTGTTGTACATTCAGCTAGCTGAGCTGGTTTGGTTAGTGAGCCGTGTATTATTGTGTTACTTCTTTACACCGGGGCCTTCGAGGAGCCATAGATAAAATGAGACTTCTGTTTTCACTATACAAACTGTAATGCGTCTGATTTTTAGGAAAGCCGTTTGAAAGTTTCCAGTTGTAAGTGAGCTTCACTTCCTGAGAAGTTGTTGTCATGTGATAGGGTTGTCTGAATTCTCTTCCAGGTGCAGCATGGAACAGGCCCGCCTTTATCTGCTTGCTCAAATGCTAGTGAGAGGCGTGGTTCACCTTTAAGGTAACCTTTATTATGTTATAGAACGGCCAATTCTAAGCAACTTTTCAATTGGTTGTCATTATTTATAGTTATTTGCATTTTTCTTCTGACTCTTTGCGGCTTTCAATTGGGTGTTGCTGACCCCTTCTAAAAACAAATGCTCTGTAAGGCTACAAATGTATTGTTATTGCTCATTTTTATTACTCATCTTTCTATTTAGTATATTCAAGTCTCTTATTCAAATTAGTGCATGGTTGCTAGGCTAATTTGGACCCTAGTTACCAAACTGCTTAAAATACAAANNNNGNGCTNCTAANNAACTNAAA
  5   1   1       add Gas9                                 BG410101.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCACGCGTCCGAGAGGACCACTCTTTTTAATAGTTATGCCAATTCATATTTTGAGGTCTAGATCCACTTTAAAAGGATATCTCGTTCAAGTGAATATACCTTATTTACAGGTGTTTTGTACCATCACAGCAGtttttttttAAATAGGGAAGGTGCCTATTGCATTGTCCCCAGATTTCTGACAGAGCTCANATTAACTCTGCTGTCCCCTTATTGCAACGTCAGAGTATGCGAGCACAGTACAACGTCTTGTATAAACCTTATAGCTAAGATAATTTGCTCCATGGCTGCAAAGTGTTACTGAAATATGTATCATTTGATTTCAGATCCTAAAATGAAGGAGTTCTGCACAGGGGTGGGGGTGGTTCACCTTTGGGGTAACTTTTATTATGTTGTGGAACTGCCAGTGCTAAGCAACTTTTCAATTAGTTTTCATTAtttttttttGNGGTTGTTTGCCTTTTTCTTCTGGCTCTTTGCAGCTTTTGAATGGGCCGTCGCTGACTCCCTTCTANAAAAACAGATGCTCTGTAAGGCTACAAATGTATTGTTGCTGATGCTTCTGTTCCGGCCCTTTCCTATTCGNGTCCAATCTCTTGTTCGAGTCGGTGCATGGNTGCTNGGGTGGTTTGGACCCTAATTGCCAGGTCGGTTGGGATGCCAATTGAAAACCTGCTGAGTAGGGGGCTAAATAACTCAAAANAT
  3   1   1       add Oo1       out                   IMAGE:3405013.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAAAAGGATATCTCGTTCAAGTGAATATACCTTATTTACAGGTGTTTTGTACCATCACAGCAGTTTTTTTTTAAATAGGGAAGGTGCCTATTGCATTGTCCCCAGATTTCTGACAGAGCTCAGATTAACTCTGCTGTCCCCTTATTGCAACGTCAGAGTATGCGAGCACAGTACAACGTCTTGTATAAACCTTATAGCTAAGATAATTTGCTCCATGGCTGCAAAGTGTTACTGAAATATGTATCATTTGATTTCAGATCCTAAAATGAAGGAGTTCTGCACAGGGGTGGGGGTGGTTCACCTTTAAGGTAACTTTTATTATGTTATAGAACTGCCAGTGCTAAGCAACTTTTCAATTAGTTTTCATTATTTTTTTTTATAGTTGTTTGCCTTTTTCTTCTAGCTCTTTGCAGCTTTAAAAAAAAAAAAAGAAAAAAAAAATAA
  5   1   1       add Oo1                             IMAGE:6642384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACTGGAAGGATGATCAGCGTGTTGTGCTTTATTTCACTGCTTCCATTGACAGTCACTTGTATACTTTTATTTAGCAGTCTGTCAGTTTAGCAGGTTGCTTTATACAATATGTATAATATGTATTAAAGGGGTGGTTCACCTTTGAGGTTACTTTTAATATGTTGTAGAGCGGCCAATTCTAAGCAACttttcaattggttttcattatttatttttttatagttattggcctttttCTTCTGACTTCTTCCAGCTTTGAAATGGGCGTCGCTGACCCCCTTCTAAAAAACAAATGCTTGGTAAGGCTACAAATGTATTGTTACTTTTTATTACTCTTCTTTCTATTCAGTTTtattccagtctcttattcaaatcagtgcatggtcgctagggtaatttggaccctagttaccggattgctgaaggtgctagttgaagagctgctgaataaaaagctaaataacTTGAATAGTAAAAGATGAAAACCAACAGAAAGTTGTCTCGGAATATCTCTTTCTGCATCATACTAGGGGTTAATTCAAAGGTGAACAACCCCTTTAAGTAAAGGGGTGCAATGGTGGTGGCCAAATTTATACTCCATGGGACACttttttttACTTTACACTGGCCACAGCATGTATTTACAGTGATTAATGGCTAACGTCATTCTTCATGGGACATTCTGATCGAAGCAACAACCCCTTTCTGAATAGCCGCAAAACATGTGACTTCATTTTCAATATTACACCCGTTGCCTTAATGTCCGAATGAACTGAATGTAGTGTTTATTTGAGTTATTTTGTGATCAAAATGTGTTTATTTTGCCAAATACAGAAAGAGGGCCTTAACAATATGTGGGGGCTTTATTTCAACTGAAGAATACGTCTCNACACATAGGGGCAGATTTATCAAGGGTTGAATTGAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)