Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 06 Jul 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL084h12.3                           14 END     3           6       21                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8822168.5                       6 PI      94        663     1706                general transcription factor IIH, polypeptide 1, 62kDa [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012838107 Xl3.1-IMAGE:7207245.3.5 - 49 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                             3     3     4     5     5     7     5     9     9    11     8    11     9    12    10    12    10    13    10    13    10    13    10    13    13    14    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    10    15    15    16    15    16    15    16    16    17    16    17    16    17    17    17    18    18    18    18    19    19    19    19    19    19    19    19    20    20    19    20    18    20    19    20    19    20    19    20    18    20    18    20    18    20    18    20    19    21    18    20    17    20    18    21    15    20    15    20    10    20     9    19     9    19     9    18     9    18     8    17     8    15     8    15     8    15     8    15     8    14     8    13     7    13     7    13     6    12     6    12     6    12     6    12     6    11     6    11     6    11     6    10     6    10     6     9     5     8     5     8     5     8     4     6     4     6     4     6     4     5     4     5     4     5     3     5     3     5     3     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     4     5     3     4     4     5     4     5     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     1     2     1     2     1     3     2     4     2     4     1     3     2     4     2     3     1     2     2     3     1     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     7     6     8     6     8     5     8     6     8     5     8     5     8     5     8     5     9     6    11     6    11     7    11     8    12    10    14    11    14    10    14    10    14    11    15    13    15    12    15    14    16    15    17    15    17    16    18    16    18    16    18    16    18    16    18    15    18    16    19    16    19    16    19    15    18    15    18    17    20    16    20    18    21    18    21    18    21    16    21    16    21    16    21    15    21    15    21    15    20    14    19    15    19    13    19    13    19    14    19    11    19    10    19    11    18    11    18    11    18    10    17    10    17    10    18    11    18    11    18    11    18    11    18    11    17    11    17    10    16     8    12     8    12     8    12     7    11     6    11     6     7     3     6     2     3
  5   1   2      ests                            Xl3.1-IMAGE:7207245.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTCTAACCCCGGGGGGGGCGCTGATGCAGGGTGCCACTCAGCAAGCTATAAACCAGCTCGTGCCAAACGACATTCAGTTAGAGCTGAAGCACCTGTATGTGGCAGTTGGGGAACTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTGAACTCCCCCTTCCTGGAGGAAAAGGTGATTAAAATGAAGAGCAACTTGGAGCGGTTTCAGGTGACAAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACCAATCTGACCAGTCACCTGGAGGAGATGCTACAGACATCCTACACCAAGTTCCACGCGTGGCAGTCCCGACGGCTGATCAAAAAGACGTGAGGTCTTGCCTCCCAGGGCCAATACCTTCCCGATGTGTATTTGTGGCCAGTGACTGGTAACCTGTGGCTGGTATCCTGGCACAACCCCTTGCACTGCAGCCTGACAATGACTGGTACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGCTCTCTCTCTACTCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAACGGCAATCAGACAACCTGGAACTGCTGGTTTTGTTTTTTAATAAACTGTAATTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAGCGGTGTGTCGGCGAGTAAACAAGACGTGGGAATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAAACCGACGGCTGTAACGGCCTCAGAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGACATCATTG
                                                                   SNP                                                                                                                            --C--------A
                                                                   SNP                                                                                                                                        --T-------C-
                                                                   SNP                                                                                                                                                    C-----------
                                                                   SNP                                                                                                                                                                ----C-------
                                                                   SNP                                                                                                                                                                            -----------G
                                                                   SNP                                                                                                                                                                                        -C-----T----
                                                                   SNP                                                                                                                                                                                                                ----------C-
                                                                   SNP                                                                                                                                                                                                                                                    -C----------
                                                                   SNP                                                                                                                                                                                                                                                                ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                            -C--------T-
                                                                   SNP                                                                                                                                                                                                                                                                                        -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                    -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                        --T-------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                            ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                        -G--G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                    -------TG---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                            ---A--G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------C-
                                               BLH ATG     145    2271                                        
                                               BLH MIN     145     294                                        
                                               BLH MPR     145     294                                        
                                               BLH OVR     118     204                                        
                                               CDS MIN     118     294                                        
                                               EST CLI     -12       3                                        
                                               ORF LNG     118      70                                        
  5   1   2       bld Egg4      out                   IMAGE:3743827.5p                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTGGGGAGAATAGCAACTTCCACTTCTCTAACGATGTCACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCATCAGCTGCTCCCCAAATTCAAGAGGAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCAGTCTTATTCCACCTGTATAAAGATCTAGTTGTGAGTCAGGTGATCAAGTCCCACGAGTTCTGGGCCACTCGGTTAAGCCTGACCTCATCTTATAGCTGTGTGTCGGCGAGTCTTCATCGATGCAGCATCTCCTCC
  5   1   2       bld Emb4      out                   IMAGE:4202084.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAATTCAAGAGGAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCAGTCTTATTCCAGCTGTATAAAGATCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTTTGGGCCAATCGGTTAAGCCTGAGCTCAGTGGAGAGCGGAGTGTCGGCGAGTAAACAAGACGTGGGAATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAAACCGACGGCTGTAACGGCCTCAGATACAACCTGACCTCTGAGCATTTTGGATCCTTTTTC
  5   1   2      ests                            Xl3.1-IMAGE:7207245.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTCTAACCCCGGGGGGGGCGCTGATGCAGGGTGCCACTCAGCAAGCTATAAACCAGCTCGTGCCAAACGACATTCAGTTAGAGCTGAAGCACCTGTATGTGGCAGTTGGGGAACTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTGAACTCCCCCTTCCTGGAGGAAAAGGTGATTAAAATGAAGAGCAACTTGGAGCGGTTTCAGGTGACAAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACCAATCTGACCAGTCACCTGGAGGAGATGCTACAGACATCCTACACCAAGTTCCACGCGTGGCAGTCCCGACGGCTGATCAAAAAGACGTGAGGTCTTGCCTCCCAGGGCCAATACCTTCCCGATGTGTATTTGTGGCCAGTGACTGGTAACCTGTGGCTGGTATCCTGGCACAACCCCTTGCACTGCAGCCTGACAATGACTGGTACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGCTCTCTCTCTACTCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAACGGCAATCAGACAACCTGGAACTGCTGGTTTTGTTTTTTAATAAACTGTAATTG
                                                  Xl3.1-CHK-1012688548                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACCCCGGGGGGGGCGCTGATGCAGGGTGCCACTCAGCAAGCTATAAACCAGCTCGTGCCAAACGACATTCAGTTAGAGCTGAAGCACCTGTATGTGGCAGTTGGGGAACTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTGAACTCCCCCTTCCTGGAGGAAAAGGTGATTAAAATGAAGAGCAACTTGGAGCGGTTTCAGGTGACAAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACCAATCTGACCAGTCACCTGGAGGAGATGCTACAGACATCCTACACCAAGTTCCACGCGTGGCAGTCCCGACGGCTGATCAAAAAGACGTGAGGTCTTGCCTCCCAGGGCCAATACCTTCCCGATGTGTATTTGTGGCCAGTGACTGGTAACCTGTGGCTGGTATCCTGGCACAACCCCTTGCACTGCAGCCTGACAATGACTGGTACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGCTCTCTCTCTACTCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAACGGCAATCAGACAACCTGGAACTGCTGGTTTTGTTTTTTAATAAACTGTAATTGCTTTAC
  5   1   2       bld Tbd7      in                         XL096h19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGAACAGCAACGCTGCCATCATAAAGCGCTTCAACCATCACAGCGCCATGGTGCTCGCCGCAGGCCTCAGGAAGGAGGAGGCGCAGAGTGACCAATGCAGTGAGACCAGCAGCACAGATGGCAACTCCCGAGACTCTGATTTCTTTCTGCCTCCTGTTAAAAAGGTGAAGTTACAGGAGGCCATAGAATATGAGGATTTGGACCAGACTAATGGAATGAAACCCATTGTGCTGAATCTGAAGAAATCTGACAGGTATTATCATGGTCCAACCCCAGTCCAGTCCCAGCAATATGCCTCCAGCCAGGATATTCTCAGCTCTTTCCATAGTATTCAACTACAAATGGAAACCTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGCTGCTGCCAGTAGTACGACTGTTGCTCTAACCCCggggggggCGCTGATGCAGGGTGCCACTCAGCAAGCTATAAACCAGCTCGTGCCAAACGACATTCAGTTAGAGCTGAAGCACCTGTATGTGGCAGTTGGGGAACTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTGAACTCCCCCTTCCTGGAGGAAAAGGTGATTAAAATGAAGAGCAACTTGGAGCGGTTTCAGGTGACAA
  5   1   0       add Egg4      in                    IMAGE:3744067.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGCAGCGAGACCAGCAGCACAGATGGCGACTCCCGAGACTCTGATTTCTTTCTGCCTCCTGTTAAAAAGGTGAAGTTACAGGAGGCCATAGAATATGAGGATTTGGACCAGACTAATGGAATGAAACCCATTGTGCTGAATCTGAAGAAATCTGACAGGTATTCTCATGGTCCAACCCCAGTACAGTCCCAGCAGTATGCCTCCAGCCAGGATATTCTCAGCTATTTCCATAGTTTTCAACTACAAATGGAAACCTATACCCCAACGCTTACTCAGGTTCTGTCGAGC
  3  -1   2       bld Tbd4                            IMAGE:4059234.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGCTCAGCTCTTTCCATAGTATTCAACTACAAATGGAAACCTATACCCCAAGGCTTACTCAGGTTCTGTCGAGCGCTGCTGCCATAGTACGACTGCTGCTCTAACCCCGGGGGGGGCGCTGATGCAGGGTGCCACTCAGCAAGCTATAAACCAGCTCGTGCCAAACGACATTCAGTTAGAGCTGAAGCACCTGTATGTGGCAGTTGGGGAACTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTGAACTCCCCCTTCCTGGAGGAAAAGGTGATTAAAATGAAGAGCAACTTGGAGCGGGTTCAGGTGACANAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACCAATCTGACCAGTCACCTGGAGGAGATGCTACAGACATCCTACACCAAGTTCCACGCGTGGCAGTCCCGACGGCTGATCAAAAAGACGTGAGGTCTTGC
  5   1   2       bld Emb1                            IMAGE:6632305.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGCAGGGTGCCACTCAGCAAGCTATAAACCAGCTCGTGCCAAACGACATTCAGTTAGAGCTGAAGCACCTGTATGTGGCAGTTGGGGAACTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTGAACTCCCCCTTCCTGGAGGAAAAGGTGATTAAAATGAAGAGCAACTTGGAGCGGTTTCAGGTGACAAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACCAATCTGACCAGTCACCTGGAGGAGATGCTACAGACATCCTACACCAAGTTCCACGCGTGGCAGTCCCGACGGCTGATCAAAAAGACGTGAGGTCTTGCCTCCCAGGGCCAATACCTTCCCGATGTGTATTTGTGGCCAGTGACTGGTAACCTGTGGCTGGTATCCTGGCACAACCCCTTGCACTGCAGCCTGACAATGACTGGTACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGctctctctctactctctctcACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGGGGGGTGGTTTTGTGCTGCTGCTAATGTGACTTTACAGCANGGAGATTCTGTGGAGCAAACTGAAATGGCTGATGGGTAA
  5   1   2       bld Emb1                   IMAGE:6632305-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGAACGCACCTCGTATCGTAGGCAGTTGGGGAACTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTGAACTCCCCCTTCCTGGAGGAAAAGGTGATTAAAATGAAGAGCAACTTGGAGCGGTTTCAGGTGACAAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACCAATCTGACCAGTCACCTGGAGGAGATGCTACAGACATCCTACACCAAGTTCCACGCGTGGCAGTCCCGACGGCTGATCAAAAAGACGTGAGGTCTTGCCTCCCAGGGCCAATACCTTCCCGATGTGTATTTGTGGCCAGTGACTGGTAACCTGTGGCTGGTATCCTGGCACAACCCCTTGCACTGCAGCCTGACAATGACTGGTACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGctctctctctactctctctcACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCCGTTGTACCGTTTACAGGTTCTACTT
  5   1   2       chi Te1                             IMAGE:6929136.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGCACCTGTATGTGGCAGTTGGGGAACTGCTGCGCCACTTCTGGTCCTGCTTCCCGGTGAACTCCCCCTTCCTGGAGGAAAAGGTGATTAAAATGAAGAGCAACTTGGAGCGGTTTCAGGTGACAAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACCAATCTGACCAGTCACCTGGAGGAGATGCTACAGACATCCTACACCAAGTTCCACGCGTGGCAGTCCCGACGGCTGATCAAAAAGACGTGAGGTCTTGCCTCCCAGGGCCAATACCTTCCCGATGTGTATTTGTGGCCAGTGACTGGTAACCTGTGGCTGGTATCCTGGCACAACCCCTTGCACTGCAGCCTGACAATGACTGGTACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGctctctctctactctctctcACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTTCTGTTCGTTTTTTCAGTAAAAGCTGCCCGTTGGTCTCCTCAGCTTGCtccccttttaacccattttcctgtttatccccccaaaaacctttttttGGGTTGGGTTTTGGTGGCCTGCCCTGCCTTAAATTGTTGGAT
  5   1   2       bld Te2       in                    IMAGE:7207245.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAGCAACTTGGAGCGGTTTCAGGTGACAAAGCTGCGGCCTTTCCAGGAGAAGCTCCGGAAGCAGTACCTGGGGACCAATCTGACCAGTCACCTGGAGGAGATGCTACAGACATCCTACACCAAGTTCCACGCGTGGCAGTCCCGACGGCTGATCAAAAAGACGTGAGGTCTTGCCTCCCAGGGCCAATACCTTCCCGATGTGTATTTGTGGCCAGTGACTGGTAACCTGTGGCTGGTATCCTGGCACAACCCCTTGCACTGCAGCCTGACAATGACTGGTACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGctctctctctactctctctcACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATATCATCTGTTATGGAGCCGCTGCCCGCAAAAGGGAGTGTGCATGNCGCACCCC
  5   1   2       bld Ga18      in                       xlk79a21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCCACGCGTGCAGTCCCGACGCTGATCAAAAAGACGTGAGGNCTTGCCTCCCAGGGCCAATACCTTCCCGATGTGTATTTGTGGCCAGTGACTGGTAACCTGTGGCTGGTATCCTGGCACAACCCCTTGCACTGCAGCCTGACAATGACTGGTACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGctctctctctactctctctcACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGNNGGGTGGNTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGANTCTGTGGAGCAAACTGAATGCTGNTGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCNNTTATGGAGCCNCCTGCCCGCAGAGGGGAGTGTNCCATNNCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGNAATGAGAATCGGGGGNNNNTCTNGANNTTTCCNTGCATCCCCCAGTGCAGACACNNTNNCATTCNNNNTCATCTNTCCCTNNNT
  3   1   2       bld Emb9      in                    IMAGE:7973826.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGACAGTCCCCGAACGCCTGATCAGAAAAGCATAAGGTCTTGCTCCCAGGGCCAAATACCTTTCCCGAATGTGTATTTGTGGCCAGTAACTGGTAACCTGTGGCTGGTATCCTGGCACAACCCTTGCACTGCAGCTGACAATGACTGGTAGGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTTCCAGCTGCTCATGGCTCTCTCTCTACTCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAATGGCAATCAGACAACCTGGAACTGCTGGTTTGTTGTAATAAACTTAAGC
  3   1   2       bld Ga18      in                      xlk123n14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGACGNCTGATNAAAANNCGTGAGGTCTTNCNNCCNAGGNNCANNNCCTTCCCNATGTGTATTTGTGGCCAGTGACTGGTANCCTGTGGCTGGTATCCTGNNACAACCCCTTNNACTGCANNCTGACAATGACTGGTACCNGAACCAAGCCCAGNAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGANCCTCTTTNCTTTCCAGCTGCTCATGGCTCTCTCTCTACTCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGNNCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTNCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTNNNNATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAACGGNAATCAGACANCCTGGANCTNC
  3   1   2       bld Tail                            IMAGE:8541502.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATTGGACCTGTGAGGTTCTGCTGCATGTATCTTGCAGATGGTTATTGTGGCAAGTGAACTGGTAACCTGTGCCTGTATCTTGCACACCCTTGCAATGCAGCTGACATGACTGTACTGAGCAGCCAGGAGTCAGAATTAAGTGCAAGTCCATCACTCAGGAGCCTCTTTCCCTTTCCCAGCTGCTCATGGCTCTCTCTCTACTCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAACGGCAATCAGACAACCTGGAACTGCTGGTTTTGTTTTTTAATAAACTGTAATTGCTTTACTTAGGTTTGGTCTCATTATTATCCTGTAAAAGGGCTTGGGCACCTTCCAAAAACTTATTTCAGTTCAGTTGGTTCAGTCAGTCCTCCAAAAAAAAAAA
  3   1   2       bld Ga15      in                       XL490h13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CNGGTATCNTTGGCACAACCCNTTGCACTGCAGCCTGGACAATGGACTGGTACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGCTCTCTCTGTACTCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAACGGCAATCGAGACAACC
  3   1   2       bld Ga18      in                       xlk79a21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTGGTANNNGGNANACCNTTNNACTGCAGCCTGACAATGACTGGTACCGGAACNAAGCCCANGAGTCAGAANNAAGTGCAAAGTCCATTCACTNAGGAGCCNCTTTCCTTTCCAGCTGCTCATGGCTCTCTCTCTACTCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGNNCCAGCTGTAAATTTCTTTTGGNTCCCCGGCTGTATATTNCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTNNNNATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGNCAGACTGCTAATGTGGCACTGTAACGGNAATCAGNCANCCTGGAACTNC
  3   1   2       bld DMZ       in                         xl253p15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGCACAACCCCTTGCACTGCAGCCTGACAATGACTGGTACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGCTCTCTCTCTACTCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGAACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAACGGCAATCAGACAACCTGAACTGCTG
  5   1   2       bld Egg2      in                    IMAGE:5162349.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTTCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGctctctctctactctctctcACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGCTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCATCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAAGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCACAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACC
  3   1   2      seed Te2       in                    IMAGE:7207245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACCGGAACCAAGCCCAGGAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGCTCTCTCTCTACTCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAATGGCAATCAGACAACCTGGAACTGCTGGTTAAGCTATTAAC
  3   1   2       bld Ga12 5g3  in                         XL219m02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCAAGCCCAGGNAGTCAGAATTAAGTGCAAAGTCCATTCACTCAGGAGCCTCTTTCCTTTCCAGCTGCTCATGGCTCTCTCTnTACTCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAACGGCAATCAGACAACCTGGAACTGCTG
  3   1   2       bld DMZ                                 rxl322p20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCNTCTTTCCTTTNCNAGNTGGTCATGGCTCTCTCTCTACTCTCTGTCACCAACCCCCACAGACTTTGTACTCTTATTCTTNTTCTATTAAATCTTGACNTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTNTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGNTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTANTGNTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGNTATGGAGCCGCCTGCCNGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCAGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTAAGTGTCATC
  3   1   2       bld Tbd7      in                         XL096h19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGAACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGGGCACTGTAACGGCAATCAGACAACCGGAACTGCGGTTTGTTTTTTAATAAACTG
  3   1   2       bld Ga12      in                         XL160i21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCTCACCAACCCCCACAGACTTTGTACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTNCATCCAGCGATCTNATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGANAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTG
  3   1   2       bld Egg2      in                    IMAGE:5162349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCTTATTCTTTTTCTATTAAATCTTGACTTGTGGCACAGGGGCCCAGCTGTAAATTTCTTTTGGGTCCCCGGCTGTATATTTCCCTAGGGGCCCCGGTTGTACCGTTTACAGGTTCTACTTGTTCTGTTCGTTTTTCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATTTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAACGGCAATCAGGCAAAATGGAACTGCTGGTTTTGTTTTAAATAACCTGTAATT
  3   1   2       bld Ga18                              rxlk59k01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TNNNNNNTTCCCTANGNGNCCCGGTTNTNCNGTTTACAGGTTCTNCNTGTNCTGTTCNNNTNNCAGTAGAGCTGCCGTTNTCTCTCAGCTGCTCCGTTNANCCATTTCTGTTATCCCCAAAGCNGTNTGGGTGGTTTGTGCTGCTGCTAATGTGACTTNANAGCAGGAGATTCTGTGGAGCAANCTGAATGCTGATGGGTNCTGCTAAANCCCGTTACTCTATCCANCGATCTGATANTCATCTGTTANGGAGCCGCCTNNCNGCAGAGGGGAGTGNCCATGCCCGCNCCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTANGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGNAGACACATTGGCATTCTGTGTCATCTGNCCCTATGTTACCAGTGGGTGNCAGTCTGCTAATGTGNCACNGNA
  3   1   2       bld Egg4      in                    IMAGE:3744067.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAGTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCT
  3   1   2       bld Emb4 5g3  in                    IMAGE:4201742.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTAGAGCTGCCGTTGTCTCTCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAAAGGGGAGTTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCT
  3   1   2       bld Emb4                            IMAGE:4203335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAGCTGCTCCGTTTAACCATTTCTGTTATCCCCAAAGCTGTGTGGGTGGTTTGTGCTGCTGCTAATGTGACTTTACAGCAGGAGATTCTGTGGAGCAAACTGAATGCTGATGGGTACTGCTAAACCCCGTTACTGCTCTATCCAGCGATCTGATAATCATCTGTTATGGAGCCGCCTGCCCGCAGAGGGGAGTGTGCCATGCCCGCACCCCATGTTGGAATAACTTGATCCTACCGACACATATGACCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGAATCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCT
  5   1   2       bld Ov1                             IMAGE:8332436.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCCATACTATCTATGCAGAAATTGAGAAGTAATGAGGGTCGGGGGTGTATCTGGATATTTCCGTGCATCCCCCAGTGCAGACACATTGGCATTCTGTGTCATCTGTCCCTATGTTACCAGTGGGTGTCAGACTGCTAATGTGGCACTGTAACGGCAATCAGACAACCTGGAACTGCTGGTTTTGTTTTTTAATAAACTGTAATTGCTTTaaaaaaaaaaaaaaaaG

In case of problems mail me! (