Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7764468.3                      10 END     6          16       60                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:4033392-IMAGp.5                22 PI      73        619     1684                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:7764468.3                      10 PI      88       2120     2544                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:4031401-IMAGp.5.5              10 PI      73        416     1304                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012838184 Xl3.1-XL191i17.5.5 - 37 ESTs
                                                                       ...-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL191i17.5.5                                                                                                                  TTGACACCTGCCTATATACAGGGGAAGGAGGAAAGGCTGAAGCACACTCATCTACTCCGCACCGCTACCTCTAATATTAGGCCAGCGGGGGAGAGACAAGGGGATAGTCCAAAAGCGCATGCGGCTATGACTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTATATGGGAGCCCTCATCAAAGAGGCTGGTTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGTCCAACTGCAGGCGCGGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCCACTGAGGTTGGAATGCTTATTCAAGAAGCAGCTGGCAGAAGCAATTTGAAGAGAGTGACTCTTGAATTAGGAGGAAAGAGCCCCAACATTATCTTTGCTGATGCAGATTTGGAATATGCAGTTGAGCAAGCACATCAAGGTGTCTTCTTTAACCAAGGACAATGCTGTACGGCTGGCTCACGGACGTTTGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTCGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAACAAGGCCCCCAGACTGATAAGAAGCAATATAACAAAATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGCATTGGGAAGAAAAGGATTTTTTATAGAACCAACCGTTTTCTCCAATGTAGCGGATGATATGCGGATTGCCAGAGAAGAGATTTTTGGACCTGTTCAACAGATATTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGTCTAGTAGCAGCTGTTTTCACCAATGATATCAACAAAGCCTTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAACTGTTACAATTCTCTGAATGCACAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTAAGGGAGTACACCGAAGCAAAAACAGTGACTATAAAGATTCCCCAGAAGAATTCCTAAAAAGACAATTGCAAGAAATGCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACGCCATTGTACTTAGTCTGGACTGTCTCCTACATTTCTTCTTCGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTTGTATTGCGCTTCCCATTTTAACTCTATGTATGTAAATATATGAAATTACTCTTTGTAGTTCTTTATAAATATT
                                                  Xl3.1-CHK-1012722394                                                                                                                        CCTGCCTATATACAGGGGAAGGAGGAAAGGCTGAAGCACACTCATCTACTCCGCACCGCTACCTCTAATATTAGGCCAxxxxxxGAGAGACAAGGGGATAGTCCAAAAGCGCATxCxGCxATGACTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTxCxTTxGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGACTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTATATGGGAGCCCTCATCAAAGAGGCTGGTTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGTCCAACTGCAGGCGCGGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCCACTGAGGTTGGAATGCTTATTCAAGAAGCAGCTGGCAGAAGCAATTTGAAGAGAGTGACTCTTGAATTAGGAGGAAAGAGCCCCAACATTATCTTTGCTGATGCAGATTTGGAATATGCAGTTGAGCAAGCACATCAAGGTGTCTTCTTTAACCAAGGACAATGCTGTACGGCTGGCTCACGGACGTTTGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTCGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAACAAGGCCCCCAGACTGATAAGAAGCAATATAACAAAATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGCATTGGGAAGAAAAGGATTTTTTATAGAACCAACCGTTTTCTCCAATGTAGCGGATGATATGCGGATTGCCAGAGAAGAGATTTTTGGACCTGTTCAACAGATATTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCAGATTATGGTCTAGTAGCAGCTGTTTTCACCAATGATATCAACAAAGCCTTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAACTGTTACAATTCTCTGAATGCACAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTAAGGGAGTACACCGAAGCAAAAACAGTGACTATAAAGATTCCCCAGAAGAATTCCTAAAAAGACAATTGCAAGAAATGCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACGCCATTGTACTTAGTCTGGACTGTCTCCTACATTTCTTCTTCGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTTGTATTGCGCTTCCCATTTTAACTCTATGTATGTAAATATATGAAATTACTCTTTCTAGTTCTTTATA
                                                      consensus depths                                                                                                                       2     2     2     2     2     2     2     2     2     2     4     7     4     9     6    11     8    15     8    15    12    16    16    16    16    16    12    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17     9    17    16    16    16    16    16    16    16    16    16    16    15    17    15    17    15    17    16    18    17    18    16    18    17    18    16    18    16    18    14    17    16    17    15    17    15    17    14    15    14    14    12    13    13    13     9    10     9    10     8     9     7     9     7     8     7     8     6     7     6     7     6     7     5     6     4     5     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     2     2     2     2     3     3     3     3     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     6     4     7     5     7     5     6     6     6     6     6     6     6     6     6     9    10     8    10     8    10     8    10     8    10     8    10     9    11     9    11     9    11    10    12    11    13    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    12    10    12     9    12     9    11     9    11     8     9     8     9     8     9     8     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     5     7     2     3     2     2
  5   1   2      ests                                 Xl3.1-XL191i17.5                                                                                                                  TTGACACCTGCCTATATACAGGGGAAGGAGGAAAGGCTGAAGCACACTCATCTACTCCGCACCGCTACCTCTAATATTAGGCCAGCGGGGGAGAGACAAGGGGATAGTCCAAAAGCGCATGCGGCTATGACTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTATATGGGAGCCCTCATCAAAGAGGCTGGTTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGTCCAACTGCAGGCGCGGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCCACTGAGGTTGGAATGCTTATTCAAGAAGCAGCTGGCAGAAGCAATTTGAAGAGAGTGACTCTTGAATTAGGAGGAAAGAGCCCCAACATTATCTTTGCTGATGCAGATTTGGAATATGCAGTTGAGCAAGCACATCAAGGTGTCTTCTTTAACCAAGGACAATGCTGTACGGCTGGCTCACGGACGTTTGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTCGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAACAAGGCCCCCAGACTGATAAGAAGCAATATAACAAAATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGCATTGGGAAGAAAAGGATTTTTTATAGAACCAACCGTTTTCTCCAATGTAGCGGATGAT
  5   1   2      ests                                 Xl3.1-xl250n08.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCAGATTATGGTCTAGTAGCAGCTGTTTTCACCAATGATATCAACAAAGCCTTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAACTGTTACAATTCTCTGAATGCACAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTAAGGGAGTACACCGAAGCAAAAACAGTGACTATAAAGATTCCCCAGAAGAATTCCTAAAAAGACAATTGCAAGAAATGCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACGCCATTGTACTTAGTCTGGACTGTCTCCTACATTTCTTCTTCGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTTGTATTGCGCTTCCCATTTTAACTCTATGTATGTAAATATATGAAATTACTCT
                                                                   VAR                                                                                                                                                                                          ATATCCGAGCCC
                                                                   VAR                                                                                                                                                                                                      CTTTAAAGAGACAGAGACAAGGGGTTAATCCAAAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTTTGCATTA
                                                                   SNP                                                                                                                                                                                                                                          C----C------
                                                                   SNP                                                                                                                                                                                                                                                                  -----------G
                                                                   SNP                                                                                                                                                                                                                                                                              -A---------A
                                                                   SNP                                                                                                                                                                                                                                                                                          --T-----C---
                                                                   SNP                                                                                                                                                                                                                                                                                                      C----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                          G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                      -----G----G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                  --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                      --------AG--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                              T----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------A--C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------G-G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------T--A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --G--------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --T--A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                               BLH ATG     126    1279                                                                                                                  
                                               BLH MIN     126     403                                                                                                                  
                                               BLH MPR     105     403                                                                                                                  
                                               BLH OVR     126      37                                                                                                                  
                                               EST CLI      54      29                                                                                                                  
                                               ORF LNG     126       7                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                             PROTEIN -== Ce ==== 0          NP_498081.2 ALDH1J1, ALdehyde deHydrogenase (55.1 kD) (alh-1) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ag ---- 0          XP_313425.3 AGAP003652-PA [Anopheles gambiae str. PEST] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 0          NP_609285.1 CG3752-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 0          XP_001178539.1 PREDICTED: similar to aldehyde dehydrogenase 1A2 isoform 2 [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bt ---- 0          NP_776664.1 aldehyde dehydrogenase 1 family, member A1 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = ?? ==== 0          XP_615062.4 PREDICTED: similar to aldehyde dehydrogenase 1A2 [Bos taurus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 0          NP_571925.1 aldehyde dehydrogenase 1 family, member A2; retinaldehyde dehydrogenase 2 [Daniorerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Gg ==== 0          NP_990326.1 aldehyde dehydrogenase 1A2 [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 0          NP_033048.1 aldehyde dehydrogenase family 1, subfamily A2; retinaldehyde dehydrogenase 2;alcohol dehydrogenase family 1, subfamily A7; alcohol dehydrogenase family 1,subfamily A2; retinaldehyde dehydrogenase [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                      PREDICTED = Cf ==== 0          XP_535494.2 PREDICTED: similar to aldehyde dehydrogenase 1A2 isoform 1 isoform 1 [Canis familiaris] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_003879.2 aldehyde dehydrogenase 1A2 isoform 1; retinaldehyde dehydrogenase 2;retinaldehyde-specific dehydrogenase type 2 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 0          AAI60401.1 Aldehyde dehydrogenase 1 family, member A2 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 0          NP_001084244.1 RALDH2 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL191i17.5.5                                                                                                                                                                                                                                                ATG------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------TAA------------------------ATG---------------------------ATG---TAA---------------------------------------TAA------------TAG---------------------------------------TAA---------------------------------TAA------------------------------ATG---------------------TAG---------------------------------------------------------TAG------------------------------------------TAA---------------------------------------------TGA---------TGA---------------------------------------------------------------------------------------------TAG---------------------------------TGA------------TAA------------------------------------------------TAG------------------------------------------------------------ATG------TAA------------------------------------------------------TAG------------------------------------------------------------------ATG------------TGA------------TAG
                                                                   ORF                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2      ests                                 Xl3.1-XL191i17.5                                                                                                                  TTGACACCTGCCTATATACAGGGGAAGGAGGAAAGGCTGAAGCACACTCATCTACTCCGCACCGCTACCTCTAATATTAGGCCAGCGGGGGAGAGACAAGGGGATAGTCCAAAAGCGCATGCGGCTATGACTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTATATGGGAGCCCTCATCAAAGAGGCTGGTTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGTCCAACTGCAGGCGCGGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCCACTGAGGTTGGAATGCTTATTCAAGAAGCAGCTGGCAGAAGCAATTTGAAGAGAGTGACTCTTGAATTAGGAGGAAAGAGCCCCAACATTATCTTTGCTGATGCAGATTTGGAATATGCAGTTGAGCAAGCACATCAAGGTGTCTTCTTTAACCAAGGACAATGCTGTACGGCTGGCTCACGGACGTTTGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTCGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAACAAGGCCCCCAGACTGATAAGAAGCAATATAACAAAATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGCATTGGGAAGAAAAGGATTTTTTATAGAACCAACCGTTTTCTCCAATGTAGCGGATGAT
                                                  Xl3.1-CHK-1012689599                                                                                                                        CCTGCCTATATACAGGGGAAGGAGGAAAGGCTGAAGCACACTCATCTACTCCGCACCGCTACCTCTAATATTAGGCCAxxxxxxGAGAGACAAGGGGATAGTCCAAAAGCGCATxCxGCxATGACTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTxCxTTxGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGACTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTATATGGGAGCCCTCATCAAAGAGGCTGGTTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGTCCAACTGCAGGCGCGGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCCACTGAGGTTGGAATGCTTATTCAAGAAGCAGCTGGCAGAAGCAATTTGAAGAGAGTGACTCTTGAATTAGGAGGAAAGAGCCCCAACATTATCTTTGCTGATGCAGATTTGGAATATGCAGTTGAGCAAGCACATCAAGGTGTCTTCTTTAACCAAGGACAATGCTGTACGGCTGGCTCACGGACGTTTGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTCGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAACAAGGCCCCCAGACTGATAAGAAGCAATATAACAAAATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGCATTGGGAAGAAAAGGATTTTTTATAGAACCAACCGTTTTCTCCAATGTAGCGGATGATATGCGG
  5   1   2       bld Ga12 5g3  in                         XL210h10.5p GGCACGAGGATGGCTCCGCGTTGGGCGCCTTATGTAAATAGACGTTTATAATTATATCATTGTAGGATGAACCAGCCCCCCTCCTCCCAATGTCCAATGAGAAGAGAGGCAGCTTGACACCTGCCTATATACAGGGGAAGGAGGAAAGGCTGAAGCACACTCATCTACTCCGCACCGCTACCTCTAATATTAGGCCACTTTAAAGAGACAGAGACAAGGGGTTAATCCAAAACGCGGCTATGACTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGT
  5   1   2       bld Ga12 5g3  in                         XL175n06.5p                                                                                                                  TTGACACCTGCCTATATACAGGGGAAGGAGGAAAGGCTGAAGCACACTCATCTACTCCGCACCGCTACCTCTAATATTAGGCCACTTTAAAGAGACAGAGACAAGGGGTTAATCCAAAACGCGGCTATGACTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGACTGCTGGATAAATTAGCCGATCTGGTGGAAAGGGAGAGGACTGCTCTTGCTACACTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGGTACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGT
  5   1   2       bld Oo1  5g                         IMAGE:6638595.5p                                                                                                                                                                     CACGCGTCCGCCGCTAACTAAATATCCGAGCCCGCGGGGGAGAGACAAGGGGATAGTCCAAAAGCGCATCCAGCCATGACTTCCAGTAAAATAGAGATGCCCGGGGAAGTTAAGACAGATCCCGCCGCCCTGATGGCTTCTCTGCAGCTCCTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACAGCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAAAGCTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGTCTGACGTAGATAAAGCAGTGCAAGCTGCCCGACTGGCTTTTGCATTAGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTTTACAGTCTTATTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACGAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCCTGCTGATGTTTGCCTGGAAAGATGCTCCTGCCCTGTGCTGTGNGAATACTGTAGTAATTANACCTGCTNGACAGACTCCGCTCACTGCTCTCTATATGGGAGCCCTCATCAAAGAAGCTGGTTTTCCACCAGGGGGTTGTTAACATTTTACCCAAGATATGGGTCCAACTGCAGGGAGCAGCNGATAGCTTTCTCACAATTGGCCATTTGATAAAAATTGCATTTCACTGGGTTNCTTACTGAAGGTTGGGGAATGTTTTAATTCAAGGAAAGCT
  5   1   2       bld Neu4 5g3  in                    IMAGE:4085004.5p                                                                                                                                                                        CTCCGCACCGCTACCTCTAATATTAGGCCACTTTAAAGAGACAGAGACAAGGGGTTAATCCAAAACGCGGCTATGACTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGACTGCTGGATAAATTAGCCGATCTGGTGGAAAGGGAGAGGACTGCTCTTGCTACACTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACA
  5   1   2       bld Egg1 5g                         IMAGE:4678149.5p                                                                                                                                                                        GCACGAGGGCTAACTAAATATCCGAGCCCGCGGGGGGAGAGACAAGGGGATAGTCCAAAAGCGCATCCAGCCATGACTTCCAGTAAAATAGAGATGCCCGGGGAAGTCAAGACAGATCCCGCCGCCCTGATGGCTTCTCTGCAGCTCCTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACAGCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAAAGCTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGTCTGACGTAGATAAAGCAGTGCAAGCTGCCCGACTGGCTTTTGCATTAGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTTTACAGTCTTATTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATG
  5   1   2       bld Ga17 5g                              DN828664.5p                                                                                                                                                                           CGCACCGCTACCTCTAATATTAGGCCACTTTAAAGAGACAGAGACAAGGGGTTAATCCAAAACGCGGCTATGANTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGACTGCTGGATAAATTAGCCCGATCTGGTGGAAAGGGAGAGGACTGCTCTTGCTACACTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGNGCGATCAAAACATTCANGTCTATGCTGGCTGGCCCGCAAGATACATGGACTGACTATCCA
  5   1   2       bld Ooc2 5g                         IMAGE:3745392.5p                                                                                                                                                                             GGAATTCCACTAAATATCCGAGCCCGCGGGGGAGAGACAAGGGGATAGTCCAAAAGCGCATCCAGCCATGACTTCCAGTAAAATAGAGATGCCCGGGGAAGTCAAGACAGATCCCGCCGCCCTGATGGCTTCTCTGCAGCTCCTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACAGCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAAAGCTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGTCTGACGTAGATAAAGCAGTGCAAGCTGCCCGACTGGCTCTTGCATTAGGTTCTGTGTGGAGGAGAATGGATGCCTCAGACAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTCGAATCTCTAAACAGTGGCAAACCATCGTTACAGACTTATTATGTGGATCTCGCAATGTGCTATCGGACATTCATATACTATGACTGGTGTGCAGACAGTATCATGCACTGACTATCCACGCCAATGGAG
  5   1   2       bld Oo1  5g                IMAGE:6638595-IMAGp.IMAGp                                                                                                                                                                               CCGCTAACTAAATATCCGAGCCCGCGGGGGAGAGACAAGGGGATAGTCCAAAAGCGCATCCAGCCATGACTTCCAGTAAAATAGAGATGCCCGGGGAAGTTAAGACAGATCCCGCCGCCCTGATGGCTTCTCTGCAGCTCCTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACAGCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAAAGCTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGTCTGACGTAGATAAAGCAGTGCAAGCTGCCCGACTGGCTTTTGCATTAGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTTTACAGTCTTATTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACGAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTG
  5   1   2       bld Em10 5g                         IMAGE:8322299.5p                                                                                                                                                                               CCGCTAACTAAATATCCGAGCCCGCGGGGGAGAGACAAGGGGATAGTCCAAAAGCGCATCCAGACATGACTTCCAGTAAAATAGAGATGCCCGGGGAAGTTAAGACAGATCCCGCCGCCCTGATGGCTTCTCTGCAGCTCCTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACAGCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAAAGCTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGTCTGACGTAGATAAAGCAGTGCAAGCTGCCCGACTGGCTTTTGCATTAGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTTTACAGTCTTATTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACGAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCTGCTGAACAGAC
  5   1   2       bld Ooc2 5g3  out                   IMAGE:3745296.5p                                                                                                                                                                                            ATCCGAGCCCGCGGGGGAGAGACAAGGGGATAGTCCAAAAGCGCATCCAGCCATGACTTCCAGTAAAATAGAGATGCCCGGGGAAGTCAAGACAGATCCCGCCGCCCTGATGGCTTCTCTGCAGCTCCTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACAGCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAAAGCTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGTCTGACGTAGATAAAGCAGTGCAAGCTGCCCGACTGGCTTTTGCATTAGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTTTACAGTCTTATTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTNTACGAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACCTCCCC
  5   1   2       bld Ga12 5g3  in                         XL181i14.5p                                                                                                                                                                                            GGTTAGGCCACTTTAAAGAGACAGAGACAAGGGGTTAATCCAAAACGCGGCTATGACTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGACTGCTGGATAAATTAGCCGATCTGGTGGAAAGGGAGAGGACTGCTCTTGCTACACTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGGTACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCGTGTGT
  5   1   2       bld Ga12 5g3  out                        XL191i17.5p                                                                                                                                                                                                       GGGGGGAGAGACAAGGGGATAGTCCAAAAGCGCATCCAGCCATGACTTCCAGTAAAATAGAGATGCCCGGGGAAGTCAAGACAGATCCCGCCGCCCTGATGGCTTCTCTGCAGCTCCTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACAGCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAAAGCTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGTCTGACGTAGATAAAGCAGTGCAAGCTGCCCGACTGGCTTTTGCATTAGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTTTACAGTCTTATTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACGAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCTGCTGAACAGACTCCGCTCACTGCTCTCTATATGGGAGCCCT
  5   1   2       bld Neu7 5g3  out                        XL025h09.5p                                                                                                                                                                                                         GGGGAGAGACAAGGGGATAGTCCAAAAGCGCATCCAGACATGACTTCCAGTAAAATAGAGATGCCCGGGGAAGTTAAGACAGATCCCGCCGCCCTGATGGCTTCTCTGCAGCTCCTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACAGCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAAAGCTTTCCCAGNCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGTCTGACGTAGATAAAGCAGTGCAAGCTGCCCGACTGGCTTTTGCATTAGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTTTACAGTCTTATTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACGAGACATGAACCCATTGGCGTGTGT
  5   1   2       bld Neu6 5g                IMAGE:4085004-IMAGp.IMAGp                                                                                                                                                                                                            CACGAAAGACAAAGGGGTTAATCCCAAAACGCGGCTATGACTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGACTGCTGGATAAATTAGCCGATCTGGTGGAAAGGGAGAGGACTGCTCTTGCTACACTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGGTACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTATA
  5   1   2       bld Ga12 5g3  in                         XL164i23.5p                                                                                                                                                                                                              AGACAGAGACAAGGGGTTAATCCAAAACGCGGCTATGACTTCCAGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGTTCTGTGTGGAGGAGAAAGGATGCCTCAGAAAGGGGGCGACTGCTGGATAAATTAGCCGATCTGGTGGAAAGGGAGAGGACTGCTCTTGCTACACTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGGTACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCGTGTGTGG
  5   1   2       bld Neu7                                 XL027d10.5p                                                                                                                                                                                                                                        AAACGCGGCTTGACTTCNGTAAAATAGAGATGCCCGGAGGAGTGAAGACCGACCCCGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGACTGCTGGATAAATTAGCCGATCTGGTGGAAAGGGAGAGGACTGCTCTTGCTACACTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGGTACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGAT
  5   1   2      seed Emb1                            IMAGE:6637302.5p                                                                                                                                                                                                                                                                                               CGCTGCCTTGATGGCTTCCCTGCAGCTTCTGCCTTCTCCCAGCACTAACCTAGAAGTCAAACACACCAAGATTTTCATAAACAATGAATGGCAGACTTCTGAGAGTGGAAATACTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTTCAAGCTGCCCAACTGGCCTTTTCTTTGGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGACTGCTGGATAAATTAGCCGATCTGGTGGAAAGGGAGAGGACTGCTCTTGCTACACTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGGTACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTATATGGGAGCCCTCATCAAAGAGGCTGGTTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGTCCAACTGCAGGCGCGGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCCCACTGGAGGTTGGGAATGCTTTATTCNNAGAAGCAGCTGGCAGAAGCAATTTTGAAGAGAGTGACTCTTTGAATTTANGAGGGAAAGAGCCCCAACAATATCTTTTGCTGATGCAGAATTTGGAATAT
  5   1   2       bld Gas1                                Gas1-C018.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ANCGAGAGCTCTANTGGAAAGCCCGACGAGGATTGCTCTNGCTACCCTTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATGNAGGTACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTATATGGGAGCCCTCATCAAAGAGGCTGGTTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGTCCAACTGCAGGCGCGGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCCACTGAGGTTGGAATGCTTATTCAAGAAGCAGCTGGCAGAAGCAATTTGAAGAGAGTGACTCTTGAATTAGGAGGAAAGAGCCCCAACATTATCTTTGCTGATGCAGATTTGGAATATGCAGTTGAGCAAGCACATCAAGGTGTCTTCTTTAACCAAGGACAATGCTGTACGGCTGGCTCACGGACGTTTTGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTCGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTT
  5   1   2       bld DMZ       in                         xl250n08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCGATTCGTGAATCTCTAAACAGTGGCAAACCATTTATACAGTCTTATTATGTGGATCTCCAAGGTGCGATCAAAACATTCAGGTACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACTAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTATATGGGAGCCCTCATCAAAGAGGCTGGTTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGTCCAACTGCAGGCGCGGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCCACTGAGGTTGGAATGCTTATTCAAGAAGCAGCTGGCAGAAGCAATTTGAAGAGAGTGACTCTTGAATTAGGAGGAAAGAGCCCCAACATTATCTTTGCTGATGCAGATTTGGAATATGCAGTTGAGCAAGCACATCAAGGTGTCTTCTTTAACCAAGGACAATGCTGTACGGCTGGCTCACGGACGTTTGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTCGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAACAAGGCC
  5   1   2       bld Ga12      in                         XL167j04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCTCTATATGGGAGCCCTCATCAAAGAGGCTGGTTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGTCCAACTGCAGGCGCGGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCCACTGAGGTTGGAATGCTTATTCAAGAAGCAGCTGGCAGAAGCAATTTGAAGAGAGTGACTCTTGAATTAGGAGGAAAGAGCCCCAACATTATCTTTGCTGATGCAGATTTGGAATATGCAGTTGAGCAAGCACATCAAGGTGTCTTCTTTAACCAAGGACAATGCTGTACGGCTGGCTCACGGACGTTTGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTCGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAACAAGGCCCCCAGACTGATAAGAAGCAATATAACAAAATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGCATTGGGAAGAAAAGGATTTTTTATAGAACCAACCGTTTTCTCCAATGTAGCGGATGATATGCGGATTG
  5   1   2       bld Ga12      in                         XL146g07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTCTATATGGGAGCCCTCATCAAAGAGGCTGGTTTTCCCCAGGAGTTGTTAACATTTTACCAGGATATGGTCCAACTGCAGGCGCGGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCCACTGAGGTTGGAATGCTTATTCAAGAAGCAGCTGGCAGAAGCAATTTGAAGAGAGTGACTCTTGAATTAGGAGGAAAGAGCCCCAACATTATCTTTGCTGATGCAGATTTGGAATATGCAGTTGAGCAAGCACATCAAGGTGTCTTCTTTAACCAAGGACAATGCTGTACGGCTGGCTCACGGACGTTTGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTCGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAACAAGGCCCCCAGACTGATAAGAAGCAATATAACAAAATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGCATTGGGAAGAAAAGGATTTTTTATAGAACCAACCGTTTTCTCCAATGTAGCGGATGATATGCGGATTGCCAGAGAAGAGATTTTTGGACCTGTTCAACAGATATTAAGGTTTAAAACTGTTG
  5   1   2      ests                                 Xl3.1-xl250n08.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCAGATTATGGTCTAGTAGCAGCTGTTTTCACCAATGATATCAACAAAGCCTTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAACTGTTACAATTCTCTGAATGCACAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTAAGGGAGTACACCGAAGCAAAAACAGTGACTATAAAGATTCCCCAGAAGAATTCCTAAAAAGACAATTGCAAGAAATGCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACGCCATTGTACTTAGTCTGGACTGTCTCCTACATTTCTTCTTCGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTTGTATTGCGCTTCCCATTTTAACTCTATGTATGTAAATATATGAAATTACTCT
                                                  Xl3.1-CHK-1012691353                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGTCTAGTAGCAGCTGTTTTCACCAATGATATCAACAAAGCCTTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAACTGTTACAATTCTCTGAATGCACAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTAAGGGAGTACACCGAAGCAAAAACAGTGACTATAAAGATTCCCCAGAAGAATTCCTAAAAAGACAATTGCAAGAAATGCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACGCCATTGTACTTAGTCTGGACTGTCTCCTACATTTCTTCTTCGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTTGTATTGCGCTTCCCATTTTAACTCTATGTATGTAAATATATGAAATTACTCTTTGTAG
  5   1   2       add Egg1                               PBX0048D05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGATTGCCAGAGAAGAGATTTTTGGACCTGTTCAACAAATATTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGTCTAGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCTTGACTGTTTCTTCAGCAATGCAAGCAGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTAAGGGAGTACACCGAAGCAAAAACAGTGACTATAAAGATTCCCCAGAAGAATTCCTAAAAAGACAATTGCAAGAAATGCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAATAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATG
  5   1   2       bld Gas5                            IMAGE:3749754.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAATTCCTCAACAGATATTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCAGATTATGGTCTAGTAGCAGCTGTTTTCACCAATGATATCAACAAAGCCTTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAACTGTTACAATTCTCTGAATGCACAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGGCTGAGGGAATATACAGAAGCAAAAACAGT
  3   1   2       bld Ga12 5g3  in                         XL164i23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAATTCAGATTATGGTTTAGTAGCAGCTGTTTTCACCAATGATATCAACAAAGCCTTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAACTGTTACAATTCTCTGAATGCACAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGGCTGAGGGAATATACAGAAGCAAAAACAGTGACTATAAAGATTCCACAGAAGAATTCCTAAAAAGACAATTGCAAGAAACGCAACATGCAAATAAACAGAGTCCTGCGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACGCCATTGTACTTAGTCTGGACTGTCTCCTACATTTCTTCTTCGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAAAAAACAGAA
  5   1   2       bld Ga15      out                      XL519g10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGTTTCTTCAGCAATGCAAGCAGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTAAGGGAGTACACCGAAGCAAAAACAGTGACTATAAAGATTCCCCAGAAGAATTCCTAAAAAGACAATTGCAAGAAATGCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTTACTCCATTGTACTTAGTCTGGACTGTCTCCTACATTTCTCCTTTCAGCAAGCACCTAGaaaaaaaaaTTACTGCGTATAATTATATATTTAAATTGTTTGTGTAGTTGAAAACTAAAATATGGGAATACCTAAAAAGCAATTGTAGGTGTCCAATATACCCTTTGAGAACAGTAAGGTAGGAGCCAATTTATTGTATTTAAAGTAGGTATTTTGTTGTATTATTCGTTCTTATGTATAGTCTGGAATGTGTGTAGAGTCCAGCTATTCACAAGTCTCCACTTCGAGTTTTGCATTGACTTTTTACATGAGATCTACCTGGTCCCACTCAAGAATTGTCTACAAGTCTTTTAATCTTTGCTGCTTCTGATATACTTAAGTGAAATATTTAAATGCCAGAAAATAAGTTCTTTTAAAGCATATACTTTTAAGTGTAATACAGATGGTGCTTTTAATTGGATATTAATTGCCAGCGTTCAG
  3   1   2       bld Ga12 5g3  in                         XL175n06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCAGCAATGCAAGCTGGAACTGTTTGGATAAACTGTTACAATTCTCTGAATGCACAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGGCTGAGGGAATATACAGAAGCAAAAACAGTGACTATAAAGATTCCACAGAAGAATTCCTAAAAAGACAATTGCAAGAAACGCAACATGCAAATAAACAGAGTCCTGCGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACGCCATTGTACTTAGTCTGGACTGTCTCCTACATTTCTTCTTCGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTAATTCCTTATTGCCCTTTTTAGTATCATCTTAAAACTCC
  5   1   2       add Egg2      out                   IMAGE:5162188.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTAAGGGAGTACACCGAAGCAAAAACAGTGACTATAAAGATTCCCCAGAAGAATTCCTAAAAAGACAATTGCAAGAAATGCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAATAACTCTGTTCTCTTGAATGGGCA
  5   1   2       add Ooc1      out                     xlnoc002d14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAAGGGGAGAGTATGGACTAAGGGAGTACACCGAAGCAAAAACAGTGACTATAAAGATTCCCCAGAAGAATTCCTAAAAAGACAATTGCAAGAAATGCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTTACTCCATTGTACTTAGTCTGGACTGTCTCCTACATTTCTCCTTTCAGCAAGCACCTAGaaaaaaaaaTTACTGCCGATAATTATATATTTAAATTGTTTGTGTAGCTGAAAGCTAAAATATGGGAATACCTAAAAAGCAATTGTAGGTGTCCAATATACCCTTTGAGAACAGTAAGGTAGGAGCCAAT
  5   1   2       bld Ga12      in                         XL168f10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTAACGCCATTGTACTTAGTCTGGACTGTCTCCTACATTTCTTCTTCGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCTGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTT
  3   1   2       bld DMZ       in                         xl250n08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGGCATTGAGACATGCATGGGTTTAACGCCATTGTACTTAGTCTGGACTGTCTCCTACATTTCTTCTTCGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTTGTATTGCGCTTCCCATTTTAACTCTATGTACGTAAATATANGAAATACTCTTC
  3   1   2       bld Ga12      in                         XL168f10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTTCGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCTGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTTGTATTGCGCTTCCCATTTTAACTCTATGTATGTAAATATATGAAATTACTCTTTCT
  3   1   2       bld Ga12 5g3  in                         XL181i14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTTCGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTTGTATTGCGCTTCCCATTTTAACTCTATGTATGTAAATATATGAAATTACTCTTTCTTGTTCTTTATAAATATTCAGA
  3   1   2       bld Ga12 5g3  in                         XL210h10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAGCAAACACNTAAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCTGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTTGTATTGCGCTTCCCATTTTAACTCTATGTATGTAAATATATGAAATTACTCTTTCTGTTCTT
  3   1   2      seed Ga12      in                         XL167j04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGAGCAAACACCTAAAAAAACATACTGCGTATAATTATACAGTATATTTAAATTGTTTCTGTAGTTTTAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTTGTATTGCGCTTCCCATTTTAACTCTATGTATGTAAATATATGAAATTACTCTTTCT
  5   1   2       bld Gas3                              xlnga002g23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAAGCAAAAAAATATGGGAAGACCCATAAAGGAATTGTAGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATTATTCTTCAAAACTGCTTGAACGTTATTTATTGCTT
  3   1   2       bld Ga12      in                         XL146g07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCTGTCCCATATACTTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCGGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTTGTATTGCGCTTCCCATTTAACTCTATGTATGTAAATATANAAATACTCTTTCTGTTCTTT
  3   1   2       bld Neu4 5g3  in                    IMAGE:4085004.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTCAGAACAGTAAGGTAGGAGCCAATGTATTGTATTTAAAGTAGGTATTTTGTAGTTATCCGTCCTTATGTATAGTCTGGAATGTGTAAGAGTTAAGTCCAGCTATTCACAAGTCTCCTCTTAGAATTCTGCATTGACTTTGTACATGAGGTCTACACGGTATCACTGTGAATTCCTTATTGCCCTTTTTAGTATCATCTTTAAAACTCCTGGAACTTTATTTATTGCTTAATAAAACAGAATAGATAAGTGAAGCAGACTTTGTTTTTTTAGATATTTGAAAAGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTTCTGCTTAAAAAGGGTCTAAAATTTTAGGGAATTTTATTAGTTTATAAGACAAGTCATTACAGTTTTAAGGCACTACTGCATTTTAATATGCTGAGTTAAAATGGAAACGTGTGCAGTGCTGGATGTTTACTTTATGCATGTTACTGTTGCTTATAGTGTATAGAGATTCCTATTGTAGGCATATTTAGAGTATCCTAGTATTGCGCTTCCCATTTTAACTCTATGTATGTAAATATATGAAATTACTCTTTGTAGTTCTTTATAAATATTCATGAAACTCAGAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)