Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3548595.3                       3 END     1           2       33                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012838222 Xl3.1-xlk157n18ex.3.5 - 35 ESTs
                                                                       .0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-xlk157n18ex.3.5  GCAGTCCAGTCCGCGCCCTAGAAGCTTTGAGGATTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAGTTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAGGACGAAGAGGTGGCCGAGGTGGTGGAAGCCAGTATGGTGGATACAAAGGAAGAAATGAAGAAGTTGGTGTAGAATCTGGAAAAAGTCAAGAAGAAGGAAATGAAAAAGATGAAAAACCAAAAAAGGTGACCTATATTCCTCCGCCTCCACCTGATGGTGAAGATAATATATTCCGGCAATACCAGTCTGGAATCAATTTTGATAAATATGATGAGATTCTTGTTGATGTGACCGGAAAGGATGTTCCTCCTGCCATACTGACTTTTGAAGAAGCTAACCTTTGTGAAACACTAAGAAGAAATGTTGCTAGAGCTGGATATGTAAAGCTAACACCAGTGCAGAAACACAGCATCCCTATTATAATGGCTGGTCGTGATTTAATGGCTTGCGCACAGACTGGTTCTGGTAAAACTGCTGCTTTTCTTTTGCCAATTCTCAGTTATATGATGAATGAAGGAATTACAGCTAGTCAGTATTTACAACTTCAGGAACCAGAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCTCGAAAATTTTCATATGGAACCTGCGTGCGTCCAGTAGTTGTATATGGTGGTATACAACCTGTACATGCAATGAGGGACGTTGAAAAAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGCTGGACATAGTGAGCAAAGAAAAAATTGGCTTAAGTAAGCTAAGATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCGGAAATAGAAAAATTAATGACAAAGCCAGGAATGCCAACAAAAGAAAAGCGACAAACACTAATGTTCAGTGCTACCTATCCTGAGGAAATTCGGAGGTTGGCTTCGAATTATTTGAAATCTGAACATTTGTTTGTTGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGCACAAACAGTTCTTGAAATGCGAGAAAATGGAAAGATGGAAAAGCTACTTGAAATTCTGAAAAGCTCAGAGAAAGAGCGAACTATGATTTTTGTGAATACAAAAAAGAAGGCAGATTTTATTGCTGGTTACCTTTGTCAAGAGAAATTTTCATCAACAAGCATTCACGGTGATAGAGAACAATACCAAAGAGAGAGTGCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGTCTGCACAGCAGTTGCTGCCAGAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTTGCTTTTTCTTCCAAAACAAGCACCAATAAACCCACATCATTCTGAAAAAAA
                                                  Xl3.1-CHK-1012722859        CAGTCCGCGCCCTAGAAGCTTTGAGGATTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAGTTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAGGACGAAGAGGTGGCCGAGGTGGTGGAAGCCAGTATGGTGGATACAAAGGAAGAAATGAAGAAGTTGGTGTAGAATCTGGAAAAAGTCAAGAAGAAGGAAATGAAAAAGATGAAAAACCAAAAAAGGTGACCTATATTCCTCCGCCTCCACCTGATGGTGAAGATAATATATTCCGGCAATACCAGTCTGGAATCAATTTTGATAAATATGATGAGATTCTTGTTGATGTGACAGGAAAGGATGTTCCTCCTGCCATACTGACTTTTGAAGAAGCTAACCTTTGTGAAACACTAAGAAGAAATGTTGCTAGAGCTGGATATGTAAAGCTAACACCAGTGCAGAAACACAGCATCCCTATTATAATGGCTGGTCGTGATTTAATGGCTTGCGCACAGACTGGTTCTGGTAAAACTGCTGCTTTTCTTTTGCCAATTCTCAGTTATATGATGAATGAAGGAATTACAGCTAGTCAGTATTTACAACTTCAGGAACCAGAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCTCGAAAATTTTCATATGGAACCTGCGTGCGTCCAGTAGTTGTATATGGTGGTATACAACCTGTACATGCAATGAGGGACGTTGAAAAAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGCTGGACATAGTGAGCAAAGAAAAAATTGGCTTAAGTAAGCTAAGATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCGGAAATAGAAAAATTAATGACAAAGCCAGGAATGCCAACAAAAGAAAAGCGACAAACACTAATGTTCAGTGCTACCTATCCTGAGGAAATTCGGAGGTTGGCTTCGAATTATTTGAAATCTGAACATTTGTTTGTTGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGCACAAACAGTTCTTGAAATGCGAGAAAATGGAAAGATGGAAAAGCTACTTGAAATTCTGAAAAGCTCAGAGAAAGAGCGAACTATGATTTTTGTGAATACAAAAAAGAAGGCAGATTTTATTGCTGGTTACCTTTGTCAAGAGAAATTTTCATCAACAAGCATTCACGGTGATAGAGAACAATACCAAAGAGAGAGTGCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGTCTGCACAGCAGTTGCTGCCAGAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTTGCTTTTTCTTCCAAAACAAGCACCAATAAACCCACATCATTCTGAAAAAAAAAAAAA
                                                      consensus depths       2     2     2     3     3     5     8     9     8     9     8    10     8    11     9    12    11    12    12    13    12    13    12    13    12    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    15    14    15    14    15    14    15    14    15    14    15    14    15    13    14    13    14    13    14    12    14    13    14    13    14    13    14    12    13    12    13    12    13     9    11    10    11     8    10     7    10     8    10     7    10     7    10     7    10     6    10     5    10     4     9     3     9     4     9     2     8     3     9     3     8     3     7     3     6     3     6     3     6     3     6     2     6     2     6     3     6     3     5     4     5     3     5     4     5     4     4     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     4     5     5     5     5     5     4     5     4     5     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     4     5     4     5     4     5     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     6     4     6     3     6     3     6     3     6     2     5     2     5     2     5     2     5     2     5     3     6     4     7     5     8     5     8     5     8     5    10     5    10     5    10     5     9     4     8     8     8     8     8     8     8     8     8     8     9     9    10    10    11    11    12    11    12    11    12    12    12    12    12    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    12    13    12    13    12    13    12    13    13    14    12    14    12    14    13    14    13    14    12    14    13    14    13    14    12    14    12    14    12    14    12    14    12    14    12    14    12    14    13    14    13    14    12    14    11    13    11    13    11    13    11    13    10    13     7    11     4     7     4     7     4     5     2     4
  5   1   2      ests                              Xl3.1-xlk157n18ex.5             CGCGCCCTAGAAGCTTTGAGGATTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAGTTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAGGACGAAGAGGTGGCCGAGGTGGTGGAAGCCAGTATGGTGGATACAAAGGAAGAAATGAAGAAGTTGGTGTAGAATCTGGAAAAAGTCAAGAAGAAGGAAATGAAAAAGATGAAAAACCAAAAAAGGTGACCTATATTCCTCCGCCTCCACCTGATGGTGAAGATAATATATTCCGGCAATACCAGTCTGGAATCAATTTTGATAAATATGATGAGAT
  5   1   2      ests                              Xl3.1-xlk157n18ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTTGAAGAAGCTAACCTTTGTGAAACACTAAGAAGAAATGTTGCTAGAGCTGGATATGTAAAGCTAACACCAGTGCAGAAACACAGCATCCCTATTATAATGGCTGGTCGTGATTTAATGGCTTGCGCACAGACTGGTTCTGGTAAAACTGCTGCTTTTCTTTTGCCAATTCTCAGTTATATGATGAATGAAGGAATTACAGCTAGTCAGTATTTACAACTTCAGGAACCAGAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCTCGAAAATTTTCATATGGAACCTGCGTGCGTCCAGTAGTTGTATATGGTGGTATACAACCTGTACATGCAATGAGGGACGTTGAAAAAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGCTGGACATAGTGAGCAAAGAAAAAATTGGCTTAAGTAAGCTAAGATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCGGAAATAGAAAAATTAATGACAAAGCCAGGAATGCCAACAAAAGAAAAGCGACAAACACTAATGTTCAGTGCTACCTATCCTGAGGAAATTCGGAGGTTGGCTTCGAATTATTTGAAATCTGAACATTTGTTTGTTGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGCACAAACAGTTCTTGAAATGCGAGAAAATGGAAAGATGGAAAAGCTACTTGAAATTCTGAAAAGCTCAGAGAAAGAGCGAACTATGATTTTTGTGAATACAAAAAAGAAGGCAGATTTTATTGCTGGTTACCTTTGTCAAGAGAAATTTTCATCAACAAGCATTCACGGTGATAGAGAACAATACCAAAGAGAGAGTGCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGTCTGCACAGCAGTTGCTGCCAGAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTTGCTTTTTCTTCCAAAACAAGCACCAATAAACCCACATCATTCTGAAAAAAAAAAAAAA
                                                                   SNP                                                                          ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -G----------
                                               BLH ATG      85    1889  
                                               BLH MIN      85     306  
                                               BLH MPR      82     306  
                                               BLH OVR      85      63  
                                               CDS MIN      85      34  
                                               EST CLI      12      34  
                                               ORF LNG      85      12  
  5   1   2      ests                              Xl3.1-xlk157n18ex.5             CGCGCCCTAGAAGCTTTGAGGATTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAGTTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAGGACGAAGAGGTGGCCGAGGTGGTGGAAGCCAGTATGGTGGATACAAAGGAAGAAATGAAGAAGTTGGTGTAGAATCTGGAAAAAGTCAAGAAGAAGGAAATGAAAAAGATGAAAAACCAAAAAAGGTGACCTATATTCCTCCGCCTCCACCTGATGGTGAAGATAATATATTCCGGCAATACCAGTCTGGAATCAATTTTGATAAATATGATGAGAT
                                                  Xl3.1-CHK-1012692269                   CTAGAAGCTTTGAGGATTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAGTTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAGGACGAAGAGGTGGCCGAGGTGGTGGAAGCCAGTATGGTGGATACAAAGGAAGAAATGAAGAAGTTGGTGTAGAATCTGGAAAAAGTCAAGAAGAAGGAAATGAAAAAGATGAAAAACCAAAAAAGGTGACCTATATTCCTCCGCCTCCACCTGATGGTGAAGATAATATATTCCGGCAATACCAGTCTGGAATCAATTTTGATAAATATGA
  5   1   2       bld Emb1 5g                         IMAGE:6632447.5p GGCAGTCCAGTCCGCGCCCTAGAAGCTTTGAGGATTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAGTTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAGGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAGGACGAAGAGGTGGCCGAGGTGGTGGAAGCCAGTATGGTGGATACAaaggaagaaatgaagaagttggtgtagaatctgggaanaagtcaagaagaaggaaatgaaaaagatgaaaaacccaaaaaagGTGACCCTATATTCCTCCGCCTCCACCTGGATGGTGGAAGATAATA
  5   1   2       bld Ga18 5g3  in                      xlk153g02ex.5p  GCAGTCCAGTCCGCGCCCTAGAAGCTTTGAGGATTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAGTTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGNTTTAACAACTCTGATACTGGTGGAAGAGGNNGAAGAGGTGGCCGAGGTGGTGGAANNCAGTATGGTGGATANAAAGGAAGAAATGAAGAAGTTGGNNTAGAATCTNgnaaaagtcaagaagangaaatgaaaagntgaaaannaaaaaagNNGACCTAT
  5   1   2       bld Ov1  5g                         IMAGE:6316170.5p      CCACGCGTCCGCCTACAAGCTTTGAGGATTGCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAATTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAGGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTGGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGGGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAGGACGAAAAGGTGGCCGAGGTGGTGGAAGCCAGTATGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCAACGTTCTTATGGGAGAGGGGGTTTTAACCACCTCTGATACTGGTGGGAAAGAGGACGAAAAAGGTGGGCCCGAGCgtgggggaaaagccccgtaatggtgggataccaaggggaagaaaatggaagaaaattgggggggtacaaatcctgggaaaaaaaatccaaagacaagaaggggaaactcgaaaaaaa
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073797.5p                     CCACGCGTCCGGGATTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAATTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAGGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTGGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGGGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGT
  5   1   2       bld Ov1  5g                         IMAGE:6318906.5p                         GCTTTGAGGATTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAATTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAGGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTGGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGGGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTCTAACAACTCTGATACTGGTGGAAGAGGACGAAGAGGTGGCCGACGTGGTGGAAACCAGTATGATTTTGGTAATTCTGGTGAAGAGAAGATCGTCCACGTTCTTATGGGAGAGCGGGTTTTAACACCTCTGATACTGGTGGACAAGGACCAACAGGGTGGCGAGGTGGTGAAAGCCAGTATGGTGGATACCAAGGAAAAAATGAAGAAATTTGTGGTAAAATCCTGGGAAAATTCACCGACCAAGGGAAATGGAACAATAATGCAAAACCCCCAAAAGGGGGACCCTAAATTTCCTTCCCGCCTTCCCCCTGATAGGTGTACCCAATAATATTATT
  5   1   2       bld Ga18 5g3  in                      xlk157n18ex.5p                           TTTGAGGNTTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAGTTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGNTTTAACAACTCTGATACTGGTGGAAGAGGACGAAGAGGTGGCCGAGGTGGTGGAAGCCAGTATGGTGGATAcaaaggaagaaatgaagaagntggtgtagaatctggaaaaagtcaagaagaaggaaatgaaaaagatgaaaaaccaaaaaaGGNGANCTATATTCCTCCGCCTCCACCTGATGGTGAAGATAATATATNCCGGCAATACCAGTCTGGAATCAATTTTGATAAATATGATGAGATTCNTNNTGATGTGACAGGAAANGNTGTTCCTCCTGCCATACTGACTTTTGANGAAGCTAACCTTT
  5   1   2      seed DMZ  5g3  in                         xl333i22.5p                             TGAGGATTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAGTTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAG
  5   1   2       bld Sp1  5g                         IMAGE:5435171.5p                                TTCGTCGACCCACGCGTCCGGCTGCCTAACCTGGCCTGGATTTCCTGCATGATCTCATGAACTAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAGGACGAAGAGGTGGCCGAGGTGGTGGAAGCCAGTATGGTGGATACaaaggaagaaatgaagaagttggtgtagaatctggaaaaagtcaagaagaaggaaatgaaaaagatgaaaaaccaaaaagGTGACTTATTTCCTTCGCCTCACCTGATGGTGAGATAAATATT
  5   1   2       bld Ov1       in                    IMAGE:8328523.5p                                GGATTCAGGAGCTTTCCTGGAGTCTCGCTTGATAGTCACCTGCAAGTTGGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAAGACGAAGAGGTGGCCGAAGTGGTGGAAGCCAGTATGGTGGATACAAAGGAAGAAATGAAGAAGTTGGTGTAGAATCTGGAAAAAGTCAAGAAA
  5   1   2       bld Neu7 5g3  in                         XL044j16.5p                                                     CTCGCTTGNTAGTCACCTGCAAGTTGGGCAGNTTAAACCGNGNAATGGAGGAAAACTGGGNATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGA
  5   1   2       bld Thy  5g                         IMAGE:8547192.5p                                                                 GCCTGGATTTCCTGCATGATCTCATGAACTAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAGGACGAAGAGGTGGCCGAGGTGGTGGAAGCCAGTATGGTGGATACAAAGGAGGAAATGAAGAAGTTGGTGTAGAATCTggaaaaagtcaagaagaaaggaaatgaaaaagatgaaaaccaaaaaagGTGACCTATATTCCTCGCCTCCACCTGA
  5   1   2       bld Neu7 5g3  in                         XL039a04.5p                                                                                GGGCAGATTAAACCGAGAATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGGAGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTANTNATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAG
  5   1   2       bld Egg4      in                    IMAGE:3743362.5p                                                                                                     ATGGAGGAAAACTGGGATACTGAAATTGAAACTGAAAAACCAACTTATGTACCGAATTTCAGTACCTTGACCGAAAATACAGATAATTACAGTGCCTACTCTAACAATGATATCAACAATCAAAATTATGATTCTGAAAGAAGTTTTGGAAACCGAGGAGGTTATCGGTCTGAAAGGAGTAGGCCTAGTAATTTTAACAGAGGTAGTCGAACTGAAAGGGGAAGAGGACGAGGGTTTGGTACTAATCGAAATGATAATTATTCTTCTGAGAGAGATGTGTTTGGAGATGATGAGAGGGATCAACGCATAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAATAGGTGGGTTCAGATATGATAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGATCAGCGAATACTTGATAACAGAGGAGATTATGGCCATTCTGGTGATGTAGAGGATCTTCCACATTCTTATGGAAAAGGT
  5   1   2       bld Emb1                            IMAGE:5161750.5p                                                                                                                                                                                                                                                                                                                                                                     AATTATTCTTCTGAGAGNATGTGTTTGGAGATGATGAGAGGGATCAACGCAGAGGGTTTCCAGGCAGAGGTGGATATAATGGCAATGAAGATGGACAGAAACCTAATGCCTTTCGAGGAAGAGGTGGGTTCAGAAATGAGAATGAACAGCGTCGAGGCTTTGGAGAAAGAGGAGGATTTAGAAGCGAGAATGGACAGCGAAACTTTGATAACAGAGGAGATTTTGGTAATTCTGGTGAAGAAGAGGATCGTCCACGTTCTTATGGGAGAGGTGGTTTTAACAACTCTGATACTGGTGGAAGAGGAAGAAGAGGTGGCCGAGGTGGTGGAAGCCAGTATGGTGGATACAAAGGaagaaatgaagaagttggtgtagaatctggaaaaagtcaagaagaaggaaatgaaaaagatgaaaaaccaaaaaagGTGACCTATATTCCTCCGCCTCCACCTGATGGTGAAGATAATATATTCCGGCAATACCAGTCTGGAATCAATTTTGATAAATATGATGAGATTCTTGTTGATGTGACCGGAAAGGATGTTCCTCCTGCCATACTGACTTTTGAAGAAGCTAACCTTTGTGAAACACTAAGAAGAAATGTTGCTAGAGCTGGATATGTAAAGCTAACACCAGTGCAGAAACACAGCATCCCTATTATAATGGCTGGTCGTGATTTAATGGCTTGCGCACAGACTGGTTCTGGTAAAACTGCTGCTTTTCTTTTGCCAATTCTCAGTTATATGATGAATGGAAGGATTACAGCTAGTCAGTATTTACAACTTCAGGGAACAGAAGCCATAATTATTGCCCCTACCANGAGAACTTATTAACCAGATATATCTCGATGG
  5   1   2      ests                              Xl3.1-xlk157n18ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTTGAAGAAGCTAACCTTTGTGAAACACTAAGAAGAAATGTTGCTAGAGCTGGATATGTAAAGCTAACACCAGTGCAGAAACACAGCATCCCTATTATAATGGCTGGTCGTGATTTAATGGCTTGCGCACAGACTGGTTCTGGTAAAACTGCTGCTTTTCTTTTGCCAATTCTCAGTTATATGATGAATGAAGGAATTACAGCTAGTCAGTATTTACAACTTCAGGAACCAGAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCTCGAAAATTTTCATATGGAACCTGCGTGCGTCCAGTAGTTGTATATGGTGGTATACAACCTGTACATGCAATGAGGGACGTTGAAAAAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGCTGGACATAGTGAGCAAAGAAAAAATTGGCTTAAGTAAGCTAAGATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCGGAAATAGAAAAATTAATGACAAAGCCAGGAATGCCAACAAAAGAAAAGCGACAAACACTAATGTTCAGTGCTACCTATCCTGAGGAAATTCGGAGGTTGGCTTCGAATTATTTGAAATCTGAACATTTGTTTGTTGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGCACAAACAGTTCTTGAAATGCGAGAAAATGGAAAGATGGAAAAGCTACTTGAAATTCTGAAAAGCTCAGAGAAAGAGCGAACTATGATTTTTGTGAATACAAAAAAGAAGGCAGATTTTATTGCTGGTTACCTTTGTCAAGAGAAATTTTCATCAACAAGCATTCACGGTGATAGAGAACAATACCAAAGAGAGAGTGCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGTCTGCACAGCAGTTGCTGCCAGAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTTGCTTTTTCTTCCAAAACAAGCACCAATAAACCCACATCATTCTGAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012689723                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAAGCTAACCTTTGTGAAACACTAAGAAGAAATGTTGCTAGAGCTGGATATGTAAAGCTAACACCAGTGCAGAAACACAGCATCCCTATTATAATGGCTGGTCGTGATTTAATGGCTTGCGCACAGACTGGTTCTGGTAAAACTGCTGCTTTTCTTTTGCCAATTCTCAGTTATATGATGAATGAAGGAATTACAGCTAGTCAGTATTTACAACTTCAGGAACCAGAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCTCGAAAATTTTCATATGGAACCTGCGTGCGTCCAGTAGTTGTATATGGTGGTATACAACCTGTACATGCAATGAGGGACGTTGAAAAAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGCTGGACATAGTGAGCAAAGAAAAAATTGGCTTAAGTAAGCTAAGATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCGGAAATAGAAAAATTAATGACAAAGCCAGGAATGCCAACAAAAGAAAAGCGACAAACACTAATGTTCAGTGCTACCTATCCTGAGGAAATTCGGAGGTTGGCTTCGAATTATTTGAAATCTGAACATTTGTTTGTTGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGCACAAACAGTTCTTGAAATGCGAGAAAATGGAAAGATGGAAAAGCTACTTGAAATTCTGAAAAGCTCAGAGAAAGAGCGAACTATGATTTTTGTGAATACAAAAAAGAAGGCAGATTTTATTGCTGGTTACCTTTGTCAAGAGAAATTTTCATCAACAAGCATTCACGGTGATAGAGAACAATACCAAAGAGAGAGTGCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGTCTGCACAGCAGTTGCTGCCAGAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTTGCTTTTTCTTCCAAAACAAGCACCAATAAACCCACATCATTCTGAAAAAAAA
  5   1   2       bld Ga12                                 XL188i19.5p                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCTCAGTAATTCAGGTGCAGATTCTGAACTGTTACAATTTTGCAACATTTACTTGATACATTTCTCAGCATGTATCTGTGGAATATTAACAACTATTGTATCAATTCTAACAGCCGCCTGTAATGAAACTCAGGGATTTTGCTCAGCAGGGACAAATAAATGTATCAACTAAATGTATCAATTTATAACAGTTTACAGGGTCGGTGACCCCCTCCCAGAGCTGCTTTAGAAGGTGAAAAATTACACTTTTCACTTCAATATTAGAAAAACGGTGACACATAGAAAATAGGAAGCAATTGGGAAAAAGTTATTTCTGGTGAAATATTTCTATCTGAAAACTAGTTGTTTGAAACCTGATGGGAGCTACGTAGAGTTTGGGTCACAACTTAAGCATGGATTAAACATTTTGCGAAAGTTACAATGTTCAAAGTCATGTTTATTGAAATCTTTTAAAATAAAGTTTTAACGATATGTCTAAAAACTGACATTTTCTCCAACTTACGTAGACTTTTGAAGAAGCTAACCTTTGTGAAACACTAAGAAGAAATGTTGCTAGAGCTGGATATGTAAAGCTAACACCAGTGCAGAAACACAGCATCCCTATTATAATGGCTGGTCGTGATTTAATGGCTTGCGC
  3   1   2       bld Ov1       in                    IMAGE:8328523.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTATATTCCTCCGCTTCCACCTGATGGTGAAGATAATATATTCCGGCAATACCAGTCTGGAATCAATTTTGATAAATATGATGAGATTCTTGTTGATGTGACAGGAAAGGATGTTCCTCCTGCCATACTGACTTTTGAAGAAGCTAACCTTTGTGAAACACTAAGAAGAAATGTTGCTAGAGCTGGATATGTAAAGCTAACACCAGTGCAGAAACACAGCATCCCTATTATAATGGCTGGTCGTGATTTAATGGCTTGCGCACAGACTGGTTCTGGTAAAACTGCTGCTTTTCTTTTGCCAATTCTCAGTTATATGATGAATGAAGGAATTACAGCTAGTCAGTATTTACAACTTCAGGAACCAGAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCTCGAAAATTTTCATATGGAACCTGCGTGCGTCCAGTAGTTGTATATGGTGGTATACAACCTGTACATGCAATGAGGGACGTTGAAAAAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGCTGGACATAGTGAGCAAAGAAAAAATTGGCTTAAGTAAGCTAAGATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCGGAAATAGAAAAATTAATGACAAAGCCAGGAATGCCAAAAAAAAAAAAAAAG
  5   1   2       bld Ov1                             IMAGE:5072932.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACCCACCCGCCCGTGAACACTAAGAAGAAATGCTGCTAGAGCTGGATATGTAAAGCTAACACCAGTGCAGAAACACAGCATCCCTATTATAATGGCTGGTCGTGATTTAATGGCTTGCGCACAGACTGGTTCTGGTAAAACTGCTGCTTTTCTTTTGCCAATTCTCAGCTATATGATGAATGAAGGAATTACAGCTAGTCAGTATTTACAACTTCAGGAACCGGAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCTCGAAAATTTTCATATGGAACCTGCGTGCGTCCAGT
  5   1   2       bld Tbd3      out                   IMAGE:3548595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTAGAGCTGGATATGTAAAGCTAACACCAGTGCAGAAACACAGCATCCCTATTATAATGGCTGGTCGTGATTTAATGGCTTGCGCACAGACTGGTTCTGGTAAAACTGCTGCTTTTCTTTTGCCAATTCTCAGTTATATGATGAATGAAGGAATTACAGCTAGTCAGTATTTACAACTTCAGGAACCAGAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCTCGAAAATTTTCATATGGAACCTGCGTGCGTCCAGTAGTTGTATATGGTGGTATACAACCTGTACATGCAATGAGGGACGTTGAAAAAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGCTGGACATAGTGAGCAAAGAAAAAATTGGCTTAAGTAAGCTAAGATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCGGAAATAGAAAAATTAATGACAAAGCCAGGAATGCCAACAAAAGAAAAGCGACAAACACTAATGTTCAGTGCTACCTATCCTGAGGAAATTCGGAGGTTGGCTTCGAATTATTTGAAATCTGAACATTTGTTTGTTGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGCACAAACAGTTCTTGAAATGCGAGAAAATGGAAAGATGGAAAAGCTACTTGAAATTCTGAAAAGCTCAGAGAGAGAGCGAACTATGATT
  5   1   2       bld Tad2                            IMAGE:6934403.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCAATTCTCAGTTATATGATGAATGAAGGAATTACAGCTAGTCAGTATTTACAACTTCAGGAACCAGAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCTCGAAAATTTTCATATGGAACCTGCGTGCGTCCAGTAGTTGTATATGGTGGTATACAACCTGTACATGCAATGAGGGACGTTGAAAAAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGCTGGACATAGTGAGCAAAGAAAAAATTGGCTTAAGTAAGCTAAGATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCGGAAATAGAAAAATTAATGACAAAGCCAGGAATGCCAACAAAAGAAAAGCGACAAACACTAATGTTCAGTGCTACCTATCCTGAGGAAATTCGGAGGTTGGCTTCGAATTATTTGAAATCTGAACATTTGTTTGTTGTGGTCGGATTAGTTGGGAGAGCTTGTAGTGATGTGGCACAAACAGTTCTTGAAATGCGAGAAAATggaaagatgggaaaagctactttgaaaattctgaaaaagctccgaaaaaaagagcgaactaagaattttttgtggaattcccaaaaaagaaaGGCAGAATTGTAATTGGCGGGTTTACCCTTTTTGTCAAGAAAAAAATTTTTCATTCCACCAAGGCCATTTCCCGGTGGGATAGAGGAAAAAATTTCCCCAAAAGAGGAGGAGTTGC
  5   1   2       bld Tbd7      in                         XL097o16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGATCGCATGTTGGATATGGGATTTGCCCCGGAAATAGAAAAATTAATGACAAAGCCAGGAATGCCAACAAAAGAAAAGCGACAAACACTAATGTTCAGTGCTACCTATCCTGAGGAAATTCGGAGGTTGGCTTCGAATTATTTGAAATCTGAACATTTGTTTGTTGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGCACAAACAGTTCTTGAAATGCGAGAAAATGGAAAGATGGAAAAGCTACTTGAAATTCTGAAAAGCTCAGAGAAAGAGCGAACTATGATTTTTGTGAATACAAAAAAGAAGGCAGATTTTATTGCTGGTTACCTTTGTCAAGAGAAATTTTCATCAACAAGCATTCACGGTGATAGAGAACAATACCAAAGAGAGAGTGCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGTCTGCACAGCAGTTGC
  3   1   2       bld Ga18 5g3  in                      xlk157n18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATCGCANNNNANANGGGATTTNCCCNNAAANNNAAAAANNNNNNCAAAGCCAGNAATNCCANCAAAAGAAANNNNACAAACNCTNNTGTTCAGTGCTNNNTATCCTGNGGAAATTCGNANNTTGGCTTCGAATTATTTGAANTCTGNACATTTGTTTGTTGTGGTCGGATTAGTNGGAGNAGCTTGTAGTGATGNNGNACAAACAGTTCTTGAAATGCGAGAAAATGGAAAGATGGAAAAGCTACTTGAAATTCTGAAAAGCTCAGAGAAAGAGCGAACTATGATTTTTGTGAATACAAAAAAGNAGGCAGATTTTATTGCTGGTTACCTTTGTCAAGAGAAATTTTCATCAACAAGCATTCACGGTGATAGAGAACAATACCAAAGAGAGAGTGCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGNNNGNACAGCAGTTGNNNNANAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATTAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAANCCAAGTTTTGTTTNNTTTCTCCAAAAC
  5   1   2       bld Egg1                               PBX0023D02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGACAAACACTAATGTTCAGTGCTACCTATCCTGAGGAAATTCGGAGGTTGGCTTCGAATTATTTGAAATCTGAACATTTGTTTGTTGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGCACAAACAGTTCTTGAAATGCGAGAAAATGGAAAGATGGAAAAGCTACTTGAAATTCTGAAAAGCTCAGAGAAAGAGCGAACTATGATTTTTGTGAATACAAAAAAGAAGGCAGATTTTATTGCTNGGTACCTTTGTCAAGAGAAATTTTCATCAACAAGCATTCACGGTGATAGAGAACAATACCAAAGAGAGAGTGCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGTCTGCACAGCAGTTGCTGCCAGAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGA
  3   1   2       bld Ga18 5g3  in                      xlk153g02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TNCTTNAANTNNNNNAAAATNNAAANNTNNNAAAGCTNNTGAANTNCNNAAAAGCTCANAGAAAGAGCGNACTATGATTTNNNGAATACAAAAAAGNAGNCAGATTTTATTGCTNNTTACCTTTGTCAAGAGAAATTTTCATCAACAAGNATTCACGGTGATAGAGAACAATNCCAAAGAGAGAGTGCTCTCTGGGATTTCAGNNCTGGAAAGTGTACTGTTATTGNNNNACAGCAGTTGNNNNNNAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAANNAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAANCCAAGTTTT
  3   1   2       bld DMZ  5g3  in                         xl333i22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGTCAAGAGAAATTTTCATCAACAAGCATTCACGGTGATAGAGAACAATACCAAAGAGAGAGTGCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGTCTGCACAGCAGTTGCTGCCAGAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTGCTTT
  3   1   2       bld Tbd7                                 XL093c07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAAATTTTCATCAACAAGCATTCACGGTGATAGAGAACAATACCAAAGAGAGAGTGCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGTCTGCACAGCAGTTGCTGCCAGAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCT
  3   1   2       bld Tbd7      in                         XL097o16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAAGCATTCNCGGTGATAGAGANCAATACCAAAGAGAGAGTGCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGTCTGCACAGCAGTTGCTGCCAGAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTATAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGT
  3   1   2       bld Ga18      in                      xlk166g09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGAGAGTGCTCTCTGGGATTTCAGNACTGGAAAGTGTACTGTTATTGNNNNACAGCAGTTGNNNNNNAGGCTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAANCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAANCCAAGTTTTGTTTNNNNTCTCCAAANC
  5   1   2       bld Ga18      in                      xlk166g09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGAGAGTNCTCTCTGGGATTTCAGAACTGGAAAGTGTACTGTTATTGTCTGCACNGNGNTGCTGCCAGAGNTTGGATATTGAAAATGTTCAACACGTGATAAATTATGACGTTCCTAAGGAAGTTGATGAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCANNNNNGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGNCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTTGCTTTTTCTTCCAAAACAAGCACCAATAAACCCACATCATTCTGAAAANNNaaaaaaaaa
  3  -1   2       bld Ga11                            IMAGE:3474992.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGATTTCAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCATTTCTGCATTCCCCGGGCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGTGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTATAATCATATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCATATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTTGCTTTTTCTTCCAAAACAAGCACCAATAAACCCACATCATTCTGAAAAAAAAAAAAAAAAAAAAAGAAAGA
  3   1   2       bld Egg4      in                    IMAGE:3743362.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTTGCTTTTTCTTCCAAAACAAGCACCAATAAACCCACCCCCCCCCCCA
  3   1   2      seed Ov1  5g3  in                    IMAGE:5073797.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTACGTCCATAGAATTGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTTGCTTTTTCTTCCAAAACAAGCACCAATAAACCCACATCATTCTGAAAAAAAAAAAAAAAG
  5   1   2       bld Egg1                               PBX0066B07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGTCGTACCGGTCGCTGTGGTAACACCGGAAAGGCAACATCATTTTTCAATGTTCAGGATGACCATGTGATTGCTCGTCCCCTTGTGAAAATTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTTGCTTTTTCTTCCAAAACAAGCACCAATAAACCCACATCATTCTGAGAACCGaaaaaaaaaaaaaaaaaaaGATTCGCG
  3   1   2       bld Neu7 5g3  in                         XL044j16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCTTACCGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCATGGAGCTTTGAATAGCTTTTATGCAGCGGACTCTATGGGCGAACAGGCCGGAGGAAATGCCGTCACTACTCCTTCATTCGCACAAGAAGAAGAGGCTAGCTGGGATTAAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTGTCAATCGCAAGCAGAGCAAGTTATTTGATTTAGTTTGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATNATTAAACCAAGTTTTGTTTGCTTTTCTTCCAAAACAAGCACCAATAAACCCACAT
  3   1   2       add Ooc2                            IMAGE:3745570.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCACACAACGGACTCTATGGATGACCAGGCCGCAGCAAATACCGTCACTAATCCTTCATTCGCACAACAACAAGAGGCTAGCTGGGATTCAATAGTAGAATCAAATTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGAAATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATGACGAAAAAACTCCTTATGTGAGAATTATCAATCGCAAGCAGAGCAAGTTATTTGATTCACCTCGAACCTTTAAGAGAATGTGTTTACATTCAACTTGGCCATCATTTATTTCATTAAAACCTTTATTGTTTAACTGCAACTGAAAGTTTGACTTGTATAATTATTAAACCAAGTTTTGTTTGCTTTTCTTCCAAAACAAGCACCAATAAACCCAC
  3   1   2       bld Neu7 5g3  in                         XL039a04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTAGCTGGGATTAAATAGTAGAATCAAANTGCAGAATTCAAATATTGTTAAAATGTTTAAAAAGNNATCTTGTTTTATAACATCTTTTCCAAGAGCTGAAATNNCGAAANAACTCCTTATGTNAGNANTGTCAATCGCAAGCAGANCNAGTTATTTGATTTAGTTTGCACCTTTAAGAGAATGTGTTTACATNCAACTTGGCCATCATCTTATCTTCACCTAAANCCTCCTATTGNTTAACTGCAGCTGAAAGNNTGACNTGNATNATTATTAAACCAAGTTNNGTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)