Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL409j09ex.5                         96 END     1           2        1                (no blast hit)
     2   2.0    0Xl3.1-rxlk53p03ex.3                         4 END     2           4       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xl280e12.5.5                         95 PI      82        459      846                frz7 [Xenopus tropicalis]
     4   0.0    0Xl3.1-rxlk53p03ex.3                         4 PI      75       2345     2760                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012838250 Xl3.1-IMAGE:8317666.5.5 - 45 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                       2     5     4    10     4    10     4    13     6    15     7    16     8    16     9    18    10    18    10    18    10    18    10    18    10    18    10    18    10    18    10    18    10    18    10    18    10    18    10    18    11    18    11    18    11    18    11    18    11    18    12    19    12    19    12    19    12    18    12    18    12    18    12    18    12    18    12    19     9    19    12    19    12    19    17    19    18    19    17    18    17    18    17    18    17    18    16    17    16    17    16    17    16    17    15    16    15    16    13    14    13    13    11    12    12    12    11    11     8    10     9    11     8    11     8     9     7     8     7     8     6     7     4     6     5     7     5     7     5     7     4     7     6     9     4     7     5     7     7     8     7     8     7     8     7     8     7     8     5     8     7     8     6     8     7     8     6     8     7     8     5     7     6     7     5     7     6     7     5     7     5     7     5     7     6     8     6     8     6     8     6     8     7     8     6     8     5     7     5     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     6     7     6     7     6     7     6     7     8     8     8     8     7     8     7     7     6     7     7     7     6     7     7     7     7     7     6     7     7     7     6     7     6     7     7     8     6     8     6     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     6     6     6     6     6     6     6     5     7     6     7     7     8     7     8     6     7     7     7     7     7     6     6     6     6     6     7     6     7     6     7     6     7     7     7     7     7     7     7     6     7     7     7     7     7     5     7     5     7     4     7     4     7     3     6     3     6     3     6     3     6     3     6     3     7     3     7     3     7     3     7     3     7     3     7     4     8     4     8     4     8     2     6     2     6     2     6     2     5     2     4     2     3     3     3     2     3     2     3     2     3     2     3     2     3     2     5     2     5     3     6     2     6     6     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     6     8     7     8     6     8     8     8     9     9     8     9     6     9     7     8     6     7     6     8     6     8     6     8     6     8     4     8     6     8     6     8     6     8     6     8     5     8     6     8     6     8     5     8     4     8     5     8     6     8     4     8     4     8
  5   1   2      ests                            Xl3.1-IMAGE:8533106.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTGGGATCCCAAGCAAGTCTTTATAGTCATCGGGTGGAAGGCCCTATATAATGCCATCATCAGGTACATCCCTTTGGATTTGTGAGAAAAACTGTAAATAGTTTTTTTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACTATGAGGGGAGGCAAAAACTCTTTTTTTTCCCCTCCCCCCTACACTTTTTTTTTTTTTTTGATTCAACAGTGCCTTCTGTATAAGTGAAGTCCTATAGCCTGCAGTCCTTGGCCTGTACTTGCCCTTTAATTTTACTTGGTTCAACGTTAAACCCTGAAAAAAGTGTTATTGGTACGAAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTCTGGAGTTGCTTGTGGGAGATGATGGTCGAGCATGGGCTTTACTACTTTGGGGAGGAGGGTCCCTGGAATTCTTTGGGGTTACCCACAACTTTCATGGACTTAGCAAATCCTCGTTGCCGAACACGTTAGGGACAGACTATTGACTTGGGGAATGCAAGGGTTACATATGCAAAGTATTAGAGGGGAAATACCTTATTAACCCCTTGTTTGCTGAAGATCAACTCTTCCCTGTCCTGGTGGGTCTTCTCTAAAAACCCG
                                                                   VAR                                                              GAAGCGACTGGACCCAACTCAGAGGCTCGTCCTACA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                      ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------T---G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------C--G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --C-----G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T---------
                                               BLH ATG     387     655                                                  
                                               BLH MIN     384     339                                                  
                                               BLH MPR     342     339                                                  
                                               BLH OVR     387     377                                                  
                                               CDS MIN     387     339                                                  
                                               EST CLI     -11      13                                                  
                                               ORF LNG     387      56                                                  
  5   1   2       bld Tbd7                                 XL059k21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTGCTCCATGTATGCCCCAGTTTGCACGGTGCTGGAACAGGCCATCCCTCCGTGCCGATCTATATGTGAGCGGGCACGACATGGCTGCGAGGCCCTCATGAACAAGTTTGGCTTCCAGTGGCCAGAAAGACTAAGGTGTGAGAACTTTCCACGTCATGGAGCGGAGCAGATTTGTGTTGGGCAGAACCACTCTGAAGATGGAGGACCCACTCTGCTAACCACCAGTCCACCCCACCCTGGCACTCCTGGGCCACCTATATATGCCACACTGGACCATCCGTTTCATTGTCCTAGGGTGCTGAAAGTCCCCTCATACCTCAACTACAGGTTCTTGGGAGAGAAGGACTGTGCTGCTCCATGTGAACCTACCAAAAGCGATGGTTTTATGTTTTTCAGTCAAGATGAGATACGCTTTGCCCGCATTTGGATTCTCATCTGGTCTGTGCTGTGTTGTGCGTCCACCTTCTTCAC
  5   1   2       add Te2                             IMAGE:7392077.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTGTGACCGAGCCCGACAGGGTTGCGAGGCGCTAATGAACAAGTTCGGCTTCCAGTGGCCCGAGAGCCTCCGCTGCGAGAAGTTTCCCATCAACGGGGCCGGGGAGTTGTGCGTGGGGCAGAACACTACTGAGAGCGGGACACCCACCCCCGCGGTGCCCGAGACCTGGACCAGCAACAGCAGGACTTACTACCGCGACAAATTCATGTGCCCCAGGGCGCTAAAAGTGCCTGCCTACGTTAACTACCACTTCTTGGGGGAGAAGGACTGCGGGGCCCCTTGTGAAGTGGGAAAGGTGCACGGGCTGATGTATTTTGCCCCCGAGGAGCTGAACTTTGCCCGTATCTGGATTGGGATCTGGTCGGTGCTCTGTTGTGCCTCTACTCTTTTCACCGTGCTCACCTACCTGGTAGACATGAAGCGCTTCAGCTACCCAGAGAGACCCATCATCTTCCTCTCGGGCTGCTACACCATGGTGGCCATAGCCTACATCGCTGGCTTTCTGTTGGAGGACAAAGTGGTGTGCAACGAGAGGTTTGCAGAAGATGGCTACAAAACTGTAGCCCAGGGCACCAAGAAGGAGGGCTGCACCTTTCTCTTCATGATGCTTTACTTCTTCAGCATGGCCAGCTCCATCTGGTGGGTTATCCTTTCCTTGACTTGGTTTTTGGCAGCTGGCATGAAGTGGGGGCATGAAGCCATTTGAGCCAATTCCCATAT
  5   1   2       bld Neu7      in                         XL034p04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTAAGGTGTGAGAACTTTCCCGTCATGGNAGCGGAGCAGATTTGTGTTGGGCAGAACCACTCTGAAGATGGAGGTCCTACTCTTCTAACCACCAGTCCACCCCATCATGGCACTCCTGGGCCACCCATCTATGCCACACTGGACCACCCGTTTCATTGTCCTAGGGTGCTGAAGGTCCCCTCTTACCTCAACTACAGGTTCTTGGGAGAGAAGGACTGTGCTGCTCCATGTGAACCAACCAAAAGCGATGGTTTTATGTTTTTCAGTCAAGATGAGATCCGCTTCGCCCGCATTTGGATTCTCATCTGGTCTGTGCTGTGTTGTGCATCCACCTTCATTACTGTGACCACCTACTTGGTGGACATGCAGAGGTTCCGCTATCCAGAAAGGCCCATCATATTCCTGTCTGGGTGCTACACCATGGTGTCCGTGGCCTACATTGCAGGGTTTGTACTGGGCGACAAGGTGGTCTGCAATGAAGGTTTTTCAGAGGACGGCTACAAAACTGTCGTACAGGGGACTAAGAAGGAAGGTTGCACGATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATCCTCTCTTTGACTTGGTTTCTGGCCGCTGGTATGAAATGGGGGCATGAGGCCA
  5   1   2       bld Neu7                                 XL037n22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTGAGTAACTTTCCACGTCATGGNAGCGGNAGCAGNATTTGTGTTGGGCAGAACCACTCTGAAGATGGAGGTCCTACTCTTCTAACCACCAGTCCACCTCACCATGGCACTCCTGGGCCACCCATCTATGCCACACTGGACCACCCGTTTCATTGTCCTAGGGTGCTGAAGGTCCCCTCTTACCTCAACTACAGGTTCTTGGGAGAGAAGGACTGTGCTGCTCCATGTGAACCAACCAAAAGCGATGGTTTTATGTTTTTCAGTCAAGATGAGATCCGCTTCGCCCGCATTTGGATTCTCATCTGGTCTGTGCTGTGTTGTGCATCCACCTTCATCACTGTGACCACCTACTTGGTGGACATGCAGAGGTTCCGCTATCCAGAAAGGCCCATCATATTCCTGTCTGGGTGCTACACCATGGTGTCCGTGGCCTACATTGCAGGGTTTGTACTGGGCGACAAGGTGGTCTGCAATGAAGGTTTTTCAGAGGACGGCTACAAAACTGTCGTACAGGGGACTAAGAA
  5   1   2       bld Tbd7                                 XL087m02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCGGAGCAGATTTGTGTTGGGCAGAACCACTCTGAAGATGGAGGACCCACTCTGCTAACCACCAGTCCACCCCACCCTGGCACTCCTGGGCCACCTATATATGCCACACTGGACCATCCGTTTCATTGTCCTAGGGTGCTGAAAGTCCCCTCATACCTCAACTACAGGTTCTTGGGAGAGAAGGACTGTGCTGCTCCATGTGAACCTACCAAAAGCGATGGTTTTATGTTTTTCAGTCAAGATGAGATACGCTTTGCCCGCATTTGGATTCTCATCTGGTCTGTGCTGTGTTGTGCGTCCACCTTCTTCACTGTAACCACCTACTTGGTGGACATGCAGAGGTTCCGCTATCCAGAAAGGCCCATCATATTCCTGTCTGGGTGCTACACCATGGTGTCCGTGGCCTACATTGCTGGGTTTGTGCTGGGCGACAAAGTGGTCTGCAATGAAAGTTTTTCAGAGGACGGCTACAAAACTGTCGTACAGGGGACTAAGAAGGAAGGTTGCACGATCCTCTTCATGATGCTTTATTTATTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCTTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCA
  5   1   2       bld Ga15      in                       XL478m20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGTTTTTCAGTCAAGATGAGATCCGCTTCGCCCGCATTTGGATTCTCATCTGGTCTGTGCTGTGTTGTGCATCCACCTTCATTACTGTGACCACCTACTTGGTGGACATGCAGAGGTTCCGCTATCCAGAAAGGCCCATCATATTCCTGTCTGGGTGCTACACCATGGTGTCCGTGGCCTACATTGCAGGGTTTGTACTGGGCGACAAGGTGGTCTGCAATGAAGGTTTTTCAGAGGACGGCTACAAAACTGTCGTACAGGGGACTAAGAAGGAAGGTTGCACGATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATCCTCTCTTTGACTTGGTTTCTGGCCGCTGGTATGAAATGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTATTTTCATCTGGCAGCGTGGGCTGTACCTGCTGTGAAGACCATCACCATACTGGCAATGGGTCAAATTGATGGAGACCTCCTGAGCGGGGTTTGCTTTGTGGGCCTTAATAATATTGATCCACTTAGAGGTTTTGTGTTGGCTCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTCCTCTTGGCTGGCTTTGTGTCTCTCTTCANGATCANAACCATCATGAAACACGATGGCACCAAGACGGAGAAACTGGAAAGGCTCATGGTGCGCATTGGGGTCTTCANCGTCCTCTACACAGTTCCTGCCACTATTGTTATCGCGTGCTACTTC
  5   1   2       bld Neu7      out                        XL038a13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCTACACCATGGTGTCCGTGGCCTACATTGCTGGGTTTGTGCTGGGCGACAAAGTGGTCTGCAATGAAAGTTTTTCAGAGGACGGCTACAAAACTGTCGTACAGGGGACTAAGAAGGAAGGTTGCACGATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCTTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTATTTTCATCTGGCAGCGTGGGCTGTGCCTGCTGTGAAGACCATCACCATACTGGCAATGGGTCAAATCGATGGAGACCTCCTGAGCGGGGTTTGCTTTGTGGGCCTAAATAATATTGACCCACTTAGAGGTTTTGTGTTGGCTCCACTTTTTGTCTACCTCTTCATTGGAACCTCTTTTCTCTTGGCTGGTTTTGTGTCCCTCTTCAGGATCAGAACCATCATGAAACACGATGGCACCAAGACGGAGAAATTGGAGAGGCTCATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACAGT
  5   1   2       bld Emb3      out                   IMAGE:3399141.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAATGAAAGTTTTTCAGAGGACGGCTACAAAACTGTCGTACAGGGGACTAAGAAGGAAGGTTGCACGATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCTTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTATTTTCATCTGGCAGCGTGGGCTGTGCCTGCTGTGAAGACCATCACCATACTGGCAATGGGTCAAATCGATGGAGACCTCCTGAGCGGGGTTTGCTTTGTGGGCCTAAATAATATTGACCCACTTAGAGGTTATGTGTTGGCTCCACTTTTTGTCTACCTCTTCATTGGAACCTCTTTTCTCTTGGCTGGTTTTGTGTCCCTCTT
  5   1   2       bld Bone                            IMAGE:8740025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCATGAGGCCATAGAAGCCAACTCGCAGTATTTTCATCTGGCAGCGTGGGCTGTACCTGCTGTGAAGACCATCACCATACTGGCAATGGGTCAAATTGATGGAGACCTCCTGAGCGGGGTTTGCTTTGTGGGCCTTAATAATATTGATCCACTTAGAGGTTTTGTGTTGGCTCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTCCTCTTGGCTGGCTTTGTGTCCCTCTTCAGGATCAGAACCATCATGAAACACGATGGCACCAAGACGGAGAAACTGGAGAGGCTCATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACAGTTCCTGCCACTATTGTTATCGCGTGCTACTTCTACGAGCAGGCGTTTCGTGAGCACTGGGAGCGTAGCTGGGTCAGCCAAAATTGCAAGAGCCTGGCCATCCCCTGCCCTCTCCAGTATACCCCACGTATGACCCCGGATTTTACTGTATACATGATCAAATATCTCATGACCCTCATCGTTGGCATCACATCAGATTCTGGATCTGGTCAGGCAGACTCTACACTCCTGGAGAAGTTCTACACCAGCTCACCAACAGCAAACATGGAGACACAGTGTGAGCAGGAAATGATGACACCGCTCCTTATCATGACTACACTGACTGTGACGTATTTTCGTCGTATTCTGGATCAGCAGTCTTAGTCATCGTTGAGCTATATATGCATACAGGTACTTCTGATTGGAACGTATGTCTTTGCCTACGTATAAATCATGATG
  5   1   2       bld Bone                            IMAGE:8740029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCATGAGGCCATAGAAGCCAACTCGCAGTATTTTCATCTGGCAGCGTGGGCTGTACCTGCTGTGAAGACCATCACCATACTGGCAATGGGTCAAATTGATGGAGACCTCCTGAGCGGGGTTTGCTTTGTGGGCCTTAATAATATTGATCCACTTAGAGGTTTTGTGTTGGCTCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTCCTCTTGGCTGGCTTTGTGTCCCTCTTCAGGATCAGAACCATCATGAAACACGATGGCACCAAGACGGAGAAACTGGAGAGGCTCATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACAGTTCCTGCCACTATTGTTATCGCGTGCTACTTCTACGAGCAGGCGTTTCGTGAGCACTGGGAGCGTAGCTGGGTCAGCCAAAATTGCAAGAGCCTGGCCATCCCCTGCCCTCTCCAGTATACCCCACGTATGACCCCGGATTTTACTGTATACATGATCAAATATCTCATGACCCCTCATCGTTGCATCACATCAGATTCTGGATCTGGTCAGCCAGACTCTACACTCCTGGAGAAGTTCTACACAAGCTCACCACAGCAACATGGGGAGAACCACATGTGGAGCAGGAATGAATGACACGCCTCTTATCATGACTACCACTGACTGTGGACGGTATTCCGTCAATTCTTGGGATTCAGCCAGTCTTTAAAGTCATGGTTGAGCCTATATTGGCATATCAGGAATTCCTGATTGAACCTGTAAGATTTTGGCCTAGGATAATCCT
  5   1   2       bld Bone                            IMAGE:8740141.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCATGAGGCCATAGAAGCCAACTCGCAGTATTTTCATCTGGCAGCGTGGGCTGTACCTGCTGTGAAGACCATCACCATACTGGCAATGGGTCAAATTGATGGAGACCTCCTGAGCGGGGTTTGCTTTGTGGGCCTTAATAATATTGATCCACTTAGAGGTTTTGTGTTGGCTCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTCCTCTTGGCTGGCTTTGTGTCCCTCTTCAGGATCAGAACCATCATGAAACACGATGGCACCAAGACGGAGAAACTGGAGAGGCTCATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACAGTTCCTGCCACTATTGTTATCGCGTGCTACTTCTACGAGCAGGCGTTTCGTGAGCACTGGGAGCGTAGCTGGGTCAGCCAAAATTGCAAGAGCCTGGCCATCCCCTGCCCTCTCCAGTATACCCCACGTATGACCCCGGATTTTACTGTATACATGATCAAATATCTCATGACCCTCATCGTTGCATCCACATCAGGATTCTGGATTCTGGTCAGGCAGGACTCTCTAACACTCCTGGAGAAGTTCTACACAGGCTCCACCCAACAGCCAACATGGGGGAGACACCATGTGTGAGGCAAGAGATGATGACAACCCGCTCCTTATACATTGGAACATACACTGACGTGGACGTATTTCTGGTCGAATTCTTGGATCAGCCAAGCCTTATGTCATCGTGAGCCTATATGCCTACGAATTCCTTGATTGAACGGAGCTCTGCCAGGATAATCCATAAATGCGCGA
  5   1   2       bld Neu7                                 XL040k04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGGCAGCGTGGGCTGTGCCTGCTGTGAAGACCATCACCATACTGGCAATGGGTCAAATCGATGGAGACCTCCTGAGCGGGGTTTGCTTTGTGGGCCTAAATAATATTGACCCACTTAGAGGTTTTGTGTTGGCTCCACTTTTTGTCTACCTCTTCATTGGAACCTCTTTTCTCTTGGCTGGTTTTGTGTCCCTCTTCAGGATCAGAACCATCATGAAACACGATGGCACCAAGACGGAGAAATTGGAGAGGCTCATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACAGTTCCTGCCACTATTGTTATCGCGTGCTACTTCTACGAGCAGGCGTTTCGAGAGCACTGGGAGCGTAGCTGGGTTAGCCAAAATTGCAAGAGCCTGGCCATTCCCTGCCCTCTCCAGTATACCCCACGTATGACCCCAGATTTTACTGTATATATGATTAAATATCTCATGACCCTCATTGTTGGCATCACATCAGGATTCTGGATCTGGTCAGGCAAGACTCTACACTCCTG
  5   1   2       add Emb3                            IMAGE:3400064.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGACGGAGAAACTGGAGAGGCTCATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACAGTTCCTGCACTATTGTTATCGCGTGCTACTTCTACGAGCAGGCGTTTCGTGAGCACTGGGAGCGTAGCTGGGTCAGCCAAAATTGCAAGAGCCTGGCCATCCCCTGCCCTCTCCAGTATACCCCACGTATGACCCCGGATTTTACTGTATACATGATCAAATATCTCATGACCCTCATCGTTGGCATCACATCANGATTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGGGAAGTCTACACAAGGCTCACCAACAGCAAACATGGGGAGACCACAGTGTGAGGCAGGAGATGATGGACAACCCGCTCCTTTATCATTGGACTACCACTGACTGTGACATATTTTCTGTCCCATATTCCTGGGATCCCAAGCAAGTCTTTATAGTCATCGGGTGG
  5   1   2       add Emb3                   IMAGE:3400064-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTCGGGGTCTTCAGCGTCCTCTACACAGTTCCTGCCACTATTGTTATCGCGTGCTACTTCTACGAGCAGGCGTTTCGTGAGCACTGGGAGCGTAGCTGGGTCAGCCAAAATTGCAAGAGCCTGGCCATCCCCTGCCCTCTCCAGTATACCCCACGTATGACCCCGGATTTTACTGTATACATGATCAAATATCTCATGACCCTCATCGTTGGCATCACATCAGGATTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGGAAGTTCTACACAAGGCTCACCAACAGCAAACATGGGGACACCACAGTGTGAGGCAGGAGATGATGGACAACCCGCTCCTTTATCATTGGACTACCACTGACTGTGACATATTTTCTGTCCCATATTCCTGGGATCCCAAGCAAGTCTTTATAGTAATCGG
  5   1   2      ests                            Xl3.1-IMAGE:8533106.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTGGGATCCCAAGCAAGTCTTTATAGTCATCGGGTGGAAGGCCCTATATAATGCCATCATCAGGTACATCCCTTTGGATTTGTGAGAAAAACTGTAAATAGTTTTTTTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACTATGAGGGGAGGCAAAAACTCTTTTTTTTCCCCTCCCCCCTACACTTTTTTTTTTTTTTTGATTCAACAGTGCCTTCTGTATAAGTGAAGTCCTATAGCCTGCAGTCCTTGGCCTGTACTTGCCCTTTAATTTTACTTGGTTCAACGTTAAACCCTGAAAAAAGTGTTATTGGTACGAAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTCTGGAGTTGCTTGTGGGAGATGATGGTCGAGCATGGGCTTTACTACTTTGGGGAGGAGGGTCCCTGGAATTCTTTGGGGTTACCCACAACTTTCATGGACTTAGCAAATCCTCGTTGCCGAACACGTTAGGGACAGACTATTGACTTGGGGAATGCAAGGGTTACATATGCAAAGTATTAGAGGGGAAATACCTTATTAACCCCTTGTTTGCTGAAGATCAACTCTTCCCTGTCCTGGTGGGTCTTCTCTAAAAACCCG
                                                  Xl3.1-CHK-1012696124                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATCCCAAGCAAGTCTTTATAGTCATCGGGTGGAAGGCCCTATATAATGCCATCATCAGGTACATCCCTTTGGATTTGTGAGAAAAACTGTAAATAGTTTTTTTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACTATGAGGGGAGGCAAAAACTCTTTTTTTTCCCCTCCCCCCTACACTTTTTTTTTTTTTTTGATTCAACAGTGCCTTCTGTATAAGTGAAGTCCTATAGCCTGCAGTCCTTGGCCTGTACTTGCCCTTTAATTTTACTTGGTTCAACGTTAAACCCTGAAAAAAGTGTTATTGGTACGAAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTCTGGAGTTGCTTGTGGGAGATGATGGTCGAGCATGGGCTTTACTACTTTGGGGAGGAGGGTCCCTGGAATTCTTTGGGGTTACCCACAACTTTCATGGACTTAGCAAATCCTCGTTGCCGAACACGTTAGGGACAGACTATTGACTTGGGGAATGCAAGGGTTACATATGCAAAGTATTAGAGGGGAAATACCTTATTAACCCCTTGTTTGCTGAAGATCAACTCTTCCCTGTCCTGGTGGGTCTTCTCTAAAAACCCGTCAGCG
  5   1   1       add Ga18                               xlk74a08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAGCACTGGGAGCNNNNNGGTCAGCCAAAATTGCAAGANCCTNNNNTCCCCTGCCCTCTCCAGTATACCCCACGTATGACCCCGGATTTTACTNTATACATGATCAAATATCTCATGACCCTCATCGTTGGCATCACATCAGGATTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGGAAGTTCTACACAAGGCTCACCAACAGCAAACATGGGGAGACCACAGTGTGAGGCAGGAGATGATGGACAACTCGCTCCTTTATCATTGGACTACCACTGACTGTGACGTATTTTCTGTCCCATATTCCTGGGATCCCAAGCAAGTCTTTATAGTCATCGGGTGGAAGGNCCTATATAATGCCATCATCAGGTACATCCCTTTGGATTTGTGAGAAAAACTGTAAATAGtttttttttttttGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAANTGAGAAACTACGAGGGGAGGNAAAAACTCttttttttcccctcccccctacactttttttttttttGATTCAACAGTGCCTTCTGTATAAGTGAAGNCCTATAGCCTGCAGTCCTTGGNCTGTACTTGCCCTTTAATTTTACTTGGGTNNAACATTAAANCCTGAAAAAGGNGTTNTTGGNACGAAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAANCAAAGAACTCTGGAGNTGCTTNTGG
  5   1   2       add Brn3                            IMAGE:8540103.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACAGTGTGAGGCAGGAGATGATGGACAACCCGCTCCTTTATCATTGGACTACCACTGACTGTGACATATTTTCTGTCCCATATTCCTGGGATCCCAAGCAAGTCTTTATAGTCATCGGGTGGAAGGCCCTATATAATGCCATCATCAGGTACATCCCTTTGGATTTGTGAGAAAAACTGTAAATAGtttttttttttGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACTATGAGGGGAGGCAAAAACTCttttttttcccctcccccctacactttttttttttttttGATTCAACAGTGCCTTCTGTATAAGTGAAGTCCTATAGCCTGCAGTCCTTGGCCTGTACTTGCCCTTTAATTTTACTTGGTTCAACGTTTAACCCTGAAAAAAGTGTTATTGGTACGAAATTTCCTCTTGAACTTGAAGGTTTCCTTTAAAAGACCACCATAAAACTCTGGAGTTGCTTGTGGGAGACGATTGTCGGTCATGAGCTTTTTCTTGTTTGGGAGTAAGGAAATGAAAATCTTTGGGTTACCTAATATTAAATGTATAATCTTTTCCTCTATCAAACTAAATGCGGAATAATATAATTTCGAATATCAATTATTTAATCCATGTTATTAGGATTACTCTAATCTGTTAATTTGAAAAACATTTATCAAATTTAAAGTGTTATTCACAATTTTTATATAAACTTCCTTTTCACTTGAATATAAAAttttcttttttttATT
  5   1   2       bld Lmb1                            IMAGE:8533106.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTTTCTGTCCATATTCCTGGGATCCCAAGCAAGTCTTTATAGTCATCGGGTGGAAGGCCCTATATAATGCCATCATCAGGTACATCCCTTTGGATTTGTGAGAAAAACTGTAAATAGttttttttttttGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACTATGAGGGGAGGCAAAAACTCttttttttcccctcccccctacactttttttttttttttGATTCAACAGTGCCTTCTGTATAAGTGAAGTCCTATAGCCTGCAGTCCTTGGCCTGTACTTGCCCTTTAATTTTACTTGGTTCAACGTTAAACCCTGAAAAAAGTGTTATTGGTACGAAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTCTGGAGTTGCTTGTGGGAGATGATGGTCGGGCACGGGCTTTACTACTTTGGGGAGGAGGGTCCCTGGAATTCTTTTGGGTTACCCACAACTTTCATGGACTTAGCAAATCCTCGTTGCCGAACACGTTAGGGACAGACTATTGACTTGGGGAATGCAAGGGTTACATATGCAAAGTATTAGAGGGGAAATACCTTATTAACCCCTTGTTTGCTGAAGATCAACTCTTCCCTGTCCTGGTGGGTCTCTCTAAAACCCGTCAGGTTGTTGATGATGTGACCGGTTTCTTTGTGtttttttttttCAAAGGAACTAAAATAAAATATTTTGCCCCTTGaaaaaaaaaaaattttgtttagaaaaaaaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl240d08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGNAAATTNGGGGGGGGGnnAAAAnTnTTTTTTTTTCCCnnCCCCCnnCnnTTTTTTTTTTTTTGATTCAACAGTGCCTTCTGTATAAGTGAAGTCCTATAGCCTGCAGTCCTTGGCCTGTACTTGCCCTTTAATTTTACTTGGTTCAACATTAAACCCTGAAAAAGGTGTTATTGGTACGAAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTCTGGAGTTGCTTGTGGGAGATGATGGTCGAGCACGGGCTTTACCCACAACTTTCATGGATTTAGCAAATCCTCGTTGCCGAACACGTTAGGGACAGACTATTGACTTGGGGAATGCAAGGGTTACATATGCAAAGTATTAGAGGGGAAATACCTTATTAACCCCTTGTTTGCTGAAGATCAACTCTTCCCTGTCCTGGTGGGTCTTCTCTAAAAACCCGTCAGGTTGTTGATGATGTTGACGTGTTTCT
  3   1   2       add DMZ       out                        xl235p19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CNNTGGGGGGGGGnnAAAAnTTTTTTTTTnCCCnCCCCCCnACCCTTTTTTTnTTTTATGATTCAACAGTGCCTTCTGTATAAGTGAAGTCCTATAGCCTGCAGTCCTTGGCCTGTACTTGCCCTTTAATTTTACNTGGTTCAACGTTAAACCCTGAAAAAAGTGTTATTGGTACGAAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTCTGGAGTTGCTTGTGGGAGATGATGGTCGAGCATGGGCTTTACTACTTTGGGGAGGAGGGTCCCTGGAATTCTTTGGGGTTACCCACAACTTTCATGGACTTAGCAAATCCTCGTTGCCGAACACGTTAGGGACAGACTATTGACTTGGGGAATGCAAGGGTTACATATGCAAAGTATTAGAGGGGAAATACCTTATTAACCCCTTGTTTGCTGAAGATCAACTCTTCCCNGTCCTGGTGGGTCTTCTNTAAAAACCCGTC
  3   1   2       add Neu7 5g3  in                         XL027h23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTTTCCCCCCCCCCCAnnCnTTTTTTTTTTTTTGATTCAACAGTGCCTTNTGTATAAGTGAAGTCCTATAGCCTGCAGTCCTTGGCCTGNACTTGCCCTTTAATTTTACTTGGTTCAACGTTAAACCCTGAAAAAAGTGTTATTGGTACGAAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAANAACTCTGGAGTTGCTT
  3   1   2      seed Neu7      in                         XL034p04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTTGATTCAACAGTGCCTTCTGTATAAGTGAAGTCCTATAGCCTGCAGTCCTTGGCCTGTACTTGCCCTTTAATTTTACTTGGTTCAACGTTAAACCCTGAAAAAAGTGTTATTGGTACAAAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTCTGGAGTTGCTTGTGGNAGATGATGGTCGAGCATGGGCTTTACTACTTTGGGGAGGAGGGTCCCTGGAATTCTTTGGGGTTACCCACAACTTTCATGGACTTAGCAAATCCTCGTTGCCGAACACGTTAGGGACAGACTATTGACTTGGGGAATGCAAGGGTTACATATGCAAAGTATTAGAGGGGAAATACCTTATTAACCCCNTGTTTGCTGAAGATCAACTCTTCCCTGTCCTGGTGGGTCTTCTCTANAAACCCGTCAGCGTTGTTGATGATGTTGACGTGNTTCNATGTGTTATTGTTTTTT
  3   1   1       add Neu7 5g3  in                         XL031o09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCTATAGCCTGCAGTCCTTGGCCTGTACTTGCCCTTTAATTTTACTTGGTTCAACGTTAAACCCTGAAAAAAGTGTTATTGGTNCGAAATTTCCTCTTGAACTTGAAGGTTTCATTTANAAGACAACCAAAGAACTNTGAAGTTGCTTGTGGGAGATGATGGTCGAGCATGGGCTTTACTACTTTGGGGAGGAGGGTCCCTGGAATTCTTTGGGGTTACCCNCAACTTTCATGGNCTTAGCAAATCCTCGTTGCCGAACACGTTAGGGACAGACTATTGACNTGGGGAATGCAAGGGTTACATATGCAAAGTATTANAGGGGAAANACCTTATTAACCCCTTGTTTGCTGAAGATCAACTCTTCCCTGTCCTGGTGGGTCTTCTCTAAAAACCCGTCAGGNTGTT
  3   1   1       add Neu7 5g3  in                         XL046n07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTCTGGAGTTGCTTGTGGNAGATGATGGTCGGGCACGGGCTTTACTACTTTGGGNAGGAGGGTCCCTGGAATTCTTTTGGGTTANCCACAACTTTCATGGACTTAGCAAATCCTCGTTGCCGAACACGTTAGGGACAGACTATTGACTTGGGGAATGCAAGGGTTACATATGCNAAGTATTAGAGGGNAAATACCTTATTAACCCCNTGTTTGCTGAAGATCAACTCNNCCCTGNCCTGGGGGGTCNTCTCTAAAAACCCGTCAGG
  3   1   1       add Ga15      in                       XL478m20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGAGCATGGGCTTTACTACTTTGGGGAGGAGGGTCCCTGGAATTCTTTGGGGTTACCCACAACTTTCATGGACTTAGCAAATCCTCGTTGCCGAACACGCTAGGGACAGANTATTGACTNGGGGAATGCAAGGGTTACATATGCAAAGTATTAGAGGGGAAATNCCNTATTAACCCCTNGTTTGCTGAAGATCTAACTCTTCCCTGTCCTGGTGGGTCTT

In case of problems mail me! (