Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:5080075.5                       8 END     5          20       62                hypothetical protein LOC734248 [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:6879503.5                       5 END     1           4       20                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012838303 Xl3.1-xlk165c15ex.3.5 - 24 ESTs
                                                                       .......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-xlk165c15ex.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTTACCAAAAGCTACTTCTCCTTCAGTCACTGATATGGATGGAGATTCCAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAGACACAACTGAGGCATTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAGATTCCCAGAACTGTTCATGAGGGTGCTTCTGGTCAGTCTTCAGCAAAGATGGAGTCCATAACAGATGTTCCACCTCCTAGACCGCCAAAGCCTCATCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTCCCAACATCTGGAATGCCTGCATCCCGTAGTAATACCGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATATGAGCTCTCAAGATTTCTATGACATTCCTCGACCATTTACAAGTGACAGATCTAGCTCGCTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGCAGTGGGAAGTTTTTCTAATGAAGAATTAGATGAAAACTATGTTCCAATGAATCCAAACTCCCCTCCACGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCGTTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCGAGGAGGTCTGTTCCATCTGCTGATTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCACCATTGGAAATAAAGCCTTTGCCTGAATGGGAGGAATTAATGCAGACGCCAGTACGTTCTCCTGTTACAAGAAGCTTTGCTCGAGATTCCTCTAGGTTCCCTATGCCTTCCAGACCGGATTCAGTACATAGTGTTGTTGGGAACAGTGACTCGTTGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACTGAAGATCCAGGTTTCTACCTGTTTTT------------CTGGTGATTTTT------------------------------------------------------------------------------------GAAGAGTGTTGGTTCTGGAAGCAGTGCTGCTGACGAAAAGGTTGATTATGTTGTCGTAGACAAACAGAAAACACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGAGCGACGCATTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAATGGCTAGCCTGTGCTTTAAAGAA
                                                  Xl3.1-CHK-1012721514                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTTACCAAAAGCTACTTCTCCTTCAGTCACTGATATGGATGGAGATTCCAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAGACACAACTGAGGCATTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAGATTCCCAGAACTGTTCATGAGGGTGCTTCTGGTCAGTCTTCAGCAAAGATGGAGTCCATAACAGATGTTCCACCTCCTAGACCGCCAAAGCCTCATCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTCCCAACATCTGGAATGCCTGCATCCCGTAGTAATACCGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATATGAGCTCTCAAGATTTCTATGACATTCCTCGACCATTTACAAGTGACAGATCTAGCTCGCTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGCAGTGGGAAGTTTTTCTAATGAAGAATTAGATGAAAACTATGTTCCAATGAATCCAAACTCCCCTCCACGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCGTTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCGAGGAGGTCTGTTCCATCTGCTGATTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCACCATTGGAAATAAAGCCTTTGCCTGAATGGGAGGAATTAATGCAGACGCCAGTACGTTCTCCTGTTACAAGAAGCTTTGCTCGAGATTCCTCTAGGTTCCCTATGCCTTCCAGACCGGATTCAGTAxATAxTGTTGTTGGGAAxxxTGACTCGTTGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACTGAAGATCCAGGTTTxTxxxx------------AGTCCACTGGTG------------------------------------------------------------------------------------------------TGTTGGTTCTGGAAGCAGTGCTGCTGACGAAAAGGTTGATTATGTTGTCGTAGACAAACAGAAAACACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGAGCGACGCATTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGTAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAATGGCTAGCCTGTGCTTTAAAGAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     4     5     5     5     4     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     3     5     4     5     4     5     3     5     3     5     3     5     3     5     3     4     2     3     2     3     1     2     2     3     2     3     2     3     2     3     2     4     2     4     1     4     0     5     1     4     0     5     0     5     0     5     0     5     0     5     0     5     0     5     4     7     5     7     6     8     5     8     6     7     6     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     8     9     8     9     6     9     8     9     9     9    10    10     9    10    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    11    14    11    14    11    15    12    15    11    15    12    15    12    15    12    15    12    15    11    15    10    15     9    15     8    11     7    10     6     6     6     6
  5   1   2      ests                                 Xl3.1-xl331a03.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTTACCAAAAGCTACTTCTCCTTCAGTCACTGATATGGATGGAGATTCCAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAGACACAACTGAGGCATTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAGATTCCCAGAACTGTTCATGAGGGTGCTTCTGGTCAGTCTTCAGCAAAGATGGAGTCCATAACAGATGTTCCACCTCCTAGACCGCCAAAGCCTCATCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTCCCAACATCTGGAATGCCTGCATCCCGTAGTAATACCGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATATGAGCTCTCAAGATTTCTATGACATTCCTCGACCATTTACAAGTGACAGATCTAGCTCGCTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGCAGTGGGAAGTTTTTCTAATGAAGAATTAGATGAAAACTATGTTCCAATGAATCCAAACTCCCCTCCACGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCGTTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCGAGGAGGTCTGTTCCATCTGCTGATTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCACCATTGGAAATAAAGCCTTTGCCTGAATGGGAGGAATTAATGCAGACGCCAGTACGTTCTCCTGTTACAAGAAGCTTTGCTCGAGATTCCTCTAGGTTCCCTATGCCTTCCAGACCGGATTCAGTACATAG
  5   1   2      ests                              Xl3.1-xlk165c15ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGTTGGTTCTGGAAGCAGTGCTGCTGACGAAAAGGTTGATTATGTTGTCGTAGACAAACAGAAAACACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGAGCGACGCATTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAATGGCTAGCCTGTGCTTTAAAGAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----T-------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dr ---- 9e-063     NP_998522.1 zgc:56412 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Mm ---- 6e-166     NP_067331.2 growth factor receptor bound protein 2-associated protein 1 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                      PREDICTED - Cf ---- 6e-166     XP_540929.2 PREDICTED: similar to GRB2-associated binding protein 1 isoform a [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Bt ---- 2e-170     NP_001094671.1 GRB2-associated binding protein 1 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PREDICTED - Gg ---- 1e-171     XP_420422.2 PREDICTED: similar to GRB2-associated binding protein 1 isoform 2 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Hs ---- 1e-171     NP_002030.2 GRB2-associated binding protein 1 isoform b [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PREDICTED - Xl ---- 0          NP_001089201.1 hypothetical protein LOC734248 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-xlk165c15ex.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------ATG---------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------TAA---------------------------------ATG------ATG---------------ATG------------TAA------TGA------------------------------TGA------------------------------------TAA---ATG---------------------------------------------------------------TAGTAG------------------------------------------ATG---------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------TAG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2      ests                                 Xl3.1-xl331a03.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTTACCAAAAGCTACTTCTCCTTCAGTCACTGATATGGATGGAGATTCCAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAGACACAACTGAGGCATTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAGATTCCCAGAACTGTTCATGAGGGTGCTTCTGGTCAGTCTTCAGCAAAGATGGAGTCCATAACAGATGTTCCACCTCCTAGACCGCCAAAGCCTCATCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTCCCAACATCTGGAATGCCTGCATCCCGTAGTAATACCGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATATGAGCTCTCAAGATTTCTATGACATTCCTCGACCATTTACAAGTGACAGATCTAGCTCGCTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGCAGTGGGAAGTTTTTCTAATGAAGAATTAGATGAAAACTATGTTCCAATGAATCCAAACTCCCCTCCACGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCGTTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCGAGGAGGTCTGTTCCATCTGCTGATTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCACCATTGGAAATAAAGCCTTTGCCTGAATGGGAGGAATTAATGCAGACGCCAGTACGTTCTCCTGTTACAAGAAGCTTTGCTCGAGATTCCTCTAGGTTCCCTATGCCTTCCAGACCGGATTCAGTACATAG
                                                  Xl3.1-CHK-1012699971                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTTACCAAAAGCTACTTCTCCTTCAGTCACTGATATGGATGGAGATTCCAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAGACACAACTGAGGCATTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAGATTCCCAGAACTGTTCATGAGGGTGCTTCTGGTCAGTCTTCAGCAAAGATGGAGTCCATAACAGATGTTCCACCTCCTAGACCGCCAAAGCCTCATCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTCCCAACATCTGGAATGCCTGCATCCCGTAGTAATACCGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATATGAGCTCTCAAGATTTCTATGACATTCCTCGACCATTTACAAGTGACAGATCTAGCTCGCTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGCAGTGGGAAGTTTTTCTAATGAAGAATTAGATGAAAACTATGTTCCAATGAATCCAAACTCCCCTCCACGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCGTTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCGAGGAGGTCTGTTCCATCTGCTGATTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCACCATTGGAAATAAAGCCTTTGCCTGAATGGGAGGAATTAATGCAGACGCCAGTACGTTCTCCTGTTACAAGAAGCTTTGCTCGAGATTCCTCTAGGTTCCCTATGCCTTCCAGACCGGATTCAGT
  5   1   1       add Ooc3                            IMAGE:3472415.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGAATCCTCAAATAGCCAAGATCCCCAGGACTATCTTTTACTAATAAACTGCCAGAGCAAAAAACCTGAACCGTTGAGATCTCAAGGAGATTCCACCAGGACAGCCACAGCCGAAACAGACTGCAATGACAATGTTGCTACTCACAAAGGTTCCTCGGCCCAAAAACCTGCAGTGAATGGACACATTCAGCAGTCTAGCAATTATGACTCTCCATCCCGTGGTGGATCATTCTCTACAGAATCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTTACCAAAAGCTACTTCTCCTTCAGTCACTGATATGGATGGAGATTCAAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAAACACAGCTGAGGCATTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAAATTCCCAGAACTGTTCATGAGGGTGCTTCTGGTCAGTCTACAGCTGCAGATGTTGCTCCTCCTAGACCGCCAAAGCCTCATCAGTCTTCAGAACGTTCTCCAATTGAATCTGGTCTTACGCGGACTGTTTCAGAGACTGATAGC
  5   1   2      skin Oo1                             IMAGE:6640345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCTACAGAATCTAGTTTCTACAGTCTTCCTAGAAGCTACTCACAAGATGTTTTACCAAAAGCTACATCACCTTCAGTCACTGATATGGATGGAGATTCCAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAGACACAACTGAGGCATTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAGATTCCCAGAACTGTTCATGAGGGTGCTTCTGGTCAGTCTTCAGCAAAGATGGAGTCCATAACAGATGTTCCACCTCCTAGACCGCCAAAGCCTCATCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTCCCAACATCTGGAATGCCTGCATCCCGTAGTAATACCGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATATGAGCTCTCAAGATTTCTATGACATTCCTCGACCATTTACAAGTGACAGATCTAGCTCGCTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGCAGTGGGAAGTTTTTCTAATGAAGAATTAGATGANAACTATGTTCCAATGAATCCAAACTCCCCTCCACGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCGTTTGGAATGCAGGTCCCACCNTCAGCCCACATGGGCTTTCAGGTCAGTCCAAAGACCCCTCCCNAGGAGGTCTGTTCCATCTGCTGATTGTGAACCCCCAACAGTCGATCGTAATCTCAACCCAGATAGGAAAGTAAGGGCAGCACCATTGGAAATAAAGCTTTGGCTGAATGGGNAGGAATAATGCAGAACGCCAGAACGTTCTTCTGGTTACAGAAGCTTTGCTCGAAAATTCTCTAGGTTCCCTA
  5   1   2      skin Emb4      in                    IMAGE:4202160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACCTTCAGTCACTGATATGGATGGAGATTCCAATGTTTTTAACATGTCTGGAGCCTCTTCTCTAGAGACACAACTGAGGCATTTTTCATTAAGCTATGACATTCCTCCATCATCTGGAAGCACTTATCAGATTCCCAGAACTGTTCATGAGGGTGCTTCTGGTCAGTCTTCAGCAAAGATGGAGTCCATAACAGATGTTCCACCTCCTAGACCGCCAAAGCCTCATCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTCCCAACATCTGGAATGCCTGCG
  5   1   2      seed DMZ       in                         xl331a03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGATGGAGTCCATAACAGATGTTCCACCTCCTAGACCGCCAAAGCCTCATCAGTCTTCAGAACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTCAGAGACTGATAGCAACTACTGTGTCCCAACATCTGGAATGCCTGCATCCCGTAGTAATACCGTTTCAACTCTAGAGTTAAGTAAATATAAGAAAGATATGAGCTCTCAAGATTTCTATGACATTCCTCGACCATTTACAAGTGACAGATCTAGCTCGCTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGCAGTGGGAAGTTTTTCTAATGAAGAATTAGATGAAAACTATGTTCCAATGAATCCAAACTCCCCTCCACGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCGTTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCGAGGAGGTCTGTTCCATCTGCTGATTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCACCATTGGAAATAAAGCCTTTGCCTGAATGGGAGGAATTAATGCAGACGCCAGTACGTTCTCCTGTTACAAGAAGCTTTGCTCGAGATTCCTCTAGGTTCCCTATGCC
  5   1   2       bld Ga15      in                       XL411c05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACGATCTCCAAGTGAATATGGTCTTACACGGACTGTTTTCANAGACTGATAGCAACTACTGNGTCCCAGCATCNGGAATGCCTGCATCCCGTANTAATACCGTTTCAGCTCTAGAGTTAAGTNAATATAAGAAAGATATGANCTCTCAAGATTTCTATGACATTCCTCNACCATTTACNNGTGACAGATCTNGCTCGCTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGCAGTGGGAAGTTTTTCTNATGANGAATTAGATGANAACTATGTTCCNATGAATCCNAACTCCCCTCCACGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCGTTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCGAGGAGGTCTGTTCCATCTGCTGATTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCACCATTGGAAATAAAGCCTTTGCCTGAATGGGAGGAATTAATGCAGACGCCAGTACGTTCTCCTGTTACAAGAAGCTTTGCTCGAGATTCCTCTAGGTTCCCTATGCCTTCCAGACCGGATTCAGTACATAGCACTGCTTCTAGCAGTGACTCGTTGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACTGAAGATCCAGGTTTGTTTGGGGAACAGCAGCCTTGATGA
  5   1   2       bld Egg1                               PBX0086A01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTTGAGGGCTTTCATGGCCATTTTAAAAATAAAAGCTTGTTGGCAGTGGGAATTTTTTCTAATGAAGAATTAGATGAAAACTATGTTCCAATGAATCCAAACTCCCCTCCACGACAGCATTCCAACAGCTGTACTGAACCAGTTCAAGAAACCAACTATGTTCCTATGACTCCTGGCATGTTTGACTTCTCATCGTTTGGAATGCAGGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCGAGGAGGTCTGTTCCATCTGCTGATTGTGAACCCCCACCAGTCGATCGTAATCTCAAACCAGATAGGAAAGTAAGGCCAGCACCATTGGAAATAAAGCCTTTGCCTGAATGGGAGGAATTAATGCAGACGCCAGTACGTTCTCCTGTTACAAGAAGCTTTGCTCGAGATTCCTCTAGGTTCCCTATGCCTTCCAGACCGGATTCAGTACATAGCACT
  3   1   2       add Egg1                               PBX0001G12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGACTTCTCATCATTTGGAATGCAAGTCCCACCTCCAGCCCACATGGGCTTCAGGTCCAGTCCAAAGACCCCTCCCAGGAGGTCTGTTCCATCTGCTGACTGTGAACCCCCACCAGTTGATCGTAATCTCAAACCAGATAGGAAAGATCAGTGAATATCTGCTCAGAAGAAAGGGAAATTTGCATGTAACCAAGAATTTGGAATTTTCTCTATCACGATAAGAGACTTAAAAACATTCAATATGAAGTATTGCTGTCCTATAAATAGTATTAGACATTTCTTAAATAATGTTGTTGGGAATGATGACTGCTCTTAATAGGCACAGTTTTGGTTTTTTGCAGCATTGACTTGACGTTAAACATGATTAACTACCTACCTGTTTTTTGTTGGAGTCCACTGGTGATTTTTTTAAATGGAAATGCTCCCATTTATCTTTTTTTTATTCATTTTTTTTTAAATCCACATTTGAATGCATACCCATACTCATTTGTAATTCTGTAATTAAAAATGGTGACCCAAAAGAAAAAAAAAAAAAAAAAAGATTC
  5   1   2      ests                              Xl3.1-xlk165c15ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGTTGGTTCTGGAAGCAGTGCTGCTGACGAAAAGGTTGATTATGTTGTCGTAGACAAACAGAAAACACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGAGCGACGCATTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAATGGCTAGCCTGTGCTTTAAAGAAAAAAA
                                                  Xl3.1-CHK-1012690718                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTCTGGAAGCAGTGCTGCTGACGAAAAGGTTGATTATGTTGTCGTAGACAAACAGAAAACACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGAGCGACGCATTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAATGGCTAGCCTGTGCTTTAAAGA
  3   1   2       bld Neu7      out                        XL040l24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTAGCAGTGACTCGTTGGATAGTGAAGAAAACTATGTAGCCATGAACCCAAGTCTCTCCACTGAAGATCCAGGTTTGTTTGGGAACAGCAGCCTTGATGAAGGCCACAGTCCTATGATAAAGCCTAAGGGAGACAAGCAAGTGGAATATTTAGACTTGGATTTAGACTCTGGAAAATCAACACCACCAAGAAAGAAGAAGAGTGTTGGTTCTGGAAGCAGTGCTGCTGACGAAAAGGTTGATTATGTTGTCGTAGACAAACAGAAAACACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGAGCGACGCATTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACATACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACAC
  3   1   2       bld Ga18 5g3  out                     xlk153n05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GNACCCAAnnnnnnnnCCANNGANNNNCNANNTTTGTTNGGNACAGCAGCCTTGATGAAGGCNACAGNCCTATGANAAGCCNANGGGANNCAAGCAAGTGNANNNTNAGNCTTGGATTTAGNCTCTGGAAAATCAACACCACCAAGAAAGANNNGAGTGTTGGTTCTGGAAGCAGTGCTGCTGACGAAAAGNTNGATTATGTTGTCGTAGACAAACAGAAANNACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCANCCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATTATCACAAGGGTGCAACTTGGANNGACGCATTCTGATNCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTATATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTANCTTCCATTTATATACTGTTGTGATAAATnnnnnnnnCCA
  5   1   2       bld Ga18      in                      xlk165c15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAATCAACACCACCAAGAAAGGGTTACCCCCAGTCCAAGGGTTTTTCAAATTTTTGGGAGAATACAAAACATTCAGATGTGGTTAGAGGTCATCCAGCAGTAAAGCAGTATCCAAGAAGAAGAGTGTTGGTTCTGGAAGCAGTGCTGCTGACGAAAAGGTTGATTATGTTGTCGTAGANNACAGAAAACACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGAGCNNNNNNTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGNTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGANTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAANAGAGAGTCTGTANGTNTATTNTAATGTACAAGAGCTCNAGGNCTCTAATA
  3   1   2      seed Ga18      in                      xlk165c15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCAGNCNANNGGTTTTTCAANTTTTTGGGAGNATACAAAACATTCAGATGTGGTTAGAGGTCATCCAGCAGTNAAGCAGTATCCNAGANGAAGAGTGTTGGTTCTGGAAGCAGTGCTGCTGACGAAAAGGTTGATTATGTTGTCGTAGACAAACAGAAAACACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCANCCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGANNGACGCATTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGTAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATG
  3   1   2       bld Ga12 5g3  out                        XL167g19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGAAGAGTGTTGGTTCTGNAAGCAGTGCTGCTGACGAAAAGGTTGATTATGTTGTCGTAGACAAACAGAAAACACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGAGCGACGCATTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTNCCCTGTATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAAT
  3   1   2       bld Ga12 5g3  out                        XL219h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGAAGAGTGTTGGTTCTGGAAGCAGTGCTGCTGACGAAAAGGTTGATTATGTTGTCGTAGACAAACAGAAAACACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGAGCGACGCATTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTNCAGGAA
  3   1   2       bld Ga12 5g3  out                        XL189h15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAAGCAGTGCTGCTGACGAAAAGGTTGATTATGTTGTCGTAGACAAACAGAAACCACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGAGCGACGCATTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTNCCCTGTATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAA
  3   1   2       bld DMZ       in                         xl331a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAACAGAAAACACTAGCACTGAAAAGTACCAGAGAAGCATGGACTGATGGAAGACAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGAACTGTTGCTTTTATAATCACAAGGGTGCAACTTGGAGCGACGCATTCTGATGCCTTCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGTAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACCTGTTGTGATAAATGCATT
  3   1   2       bld Ga15      in                       XL411c05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAAAGTNCCAGAGAAGCATGGANTGATGGAAGNCAGTCAACTGAAACGGAAACTCCAACCAAGAATATCAAATGAACGCCCTTCGTATTTGANCTGNTGCTTTTATTATCACAAGGGTGCAACTTGGAGCGACGCATTCTGATGCCTTCTATGCCAGATTNTGCAGAGATGGAACCTACGTNNTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGNAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTNGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTATATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTNATATAGCTGTTGTGATAAATGCATTA
  3   1   2       bld Tbd7                                 XL089a06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTATGCCAGATTCTGCAGAGATGGAACCTACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGTAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTANGCTTAACTTCCATTTATATACTGTTGTNATAAATGCATTTATCTCCAGGGACTCAGGA
  3   1   2       bld Neu3                                 AW783933.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGTAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAACGGCTAGCCTGTGCTTTAAAGAAAAAAAA
  3   1   2       bld Neu7                                 XL039d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGTTTTAATCTTGCTGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGTAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCANAGCAACTCGTGTGCCTATTTAAGATCCGNTATGCTTAACTTCCATTTANATACTGTTGTNATAAATGCATTTATCTCCAGGGACTTCAGGA
  3   1   2       bld Emb4      in                    IMAGE:4202160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAATATTTCCGATAGATCAGCGAGGCAGAGACTGAATTGTGCACTGTGCTATCTGTAGATTTAAACCCCTGTAAATAATGCGTTATGTAAAAAGATTACCATCTAACAAGAACCATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTTGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAATGGCTAGCCTGTGCTTTAAAGAA
  5   1   2       bld Ga12      out                        XL193b22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAATGGCTAGCCTGTGCTTTAAAGaaaaaaaaaa
  5   1   2       bld Ga12                                 XL193g22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGTTTAACACATCTAGCCATGTTTTGTAGTAGTATTATTATTATTATGTTTATGCACTTTTTGTGGTTCAGGCAATGGTTCTGCCATTTAATACCTTAATCCTTTTTGTTATTAACATAGATTATTTTTAGTGGGATTTTATCATCTGCATTTTTAATACACTAAGATCCAGATTTTCCCTGTATGGAATAGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAATGGCTAGCCTGTGCTTTAAAGaaaaaaaaaa
  5   1   2       bld Egg1                               PBX0125F08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGAGGAGAGTCTGCAAGTGTATTATAATGTACAAGAGCTCAAGGTCTCTAATATCACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAATGGCTAGCCTGTGCTTTAAAGaaaaaaaaaaaagaaaaTATGGCCCAGAACTTCAAACCTAAAGGAAGAAATATCCCCATCTCTGGCATAAACTCACTCAAAAACAATGCATAAACACTGAACTGGCAAACAGTTGTTTGTGTATAATATAAATATTAAacacacacacacacaTGTATTCATTAGGGCTCTTGCGCGGGAGCGCAGGAAAGGCCGCCAGCGTATAGGAGCCCTTAAACAAATAATTTAAATAATTAAAAAAGAAACAGCAGCTTGTAGTTGATGGTACCTAAGCTGCATGAATCCATATTGGTGGCAAAACAGTACTTTTTAGGGTCCAAACATTCTAGatatatatatctatataGTC
  5   1   2       bld Tbd7                                 XL077g11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCTAATAACACACCATAGCAACTCGTGTGCCTATTTAAGATCCGTTATGCTTAACTTCCATTTATATACTGTTGTGATAAATGCATTTATCTCCAGGGACTTCAGGAATGGCTAGCCTGTGCTTTAAAGaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)