Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-rxlk134o06ex.3                       10 END     1           1       10                (no blast hit)
     2   1.0    0Xl3.1-XL417h05ex.5                          4 END     1           1       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-XL046p05.3.5                        104 PI      75       1311     1850                widely-interspaced zinc finger motifs [Homo sapiens]
     4   0.0    0Xl3.1-IMAGE:7202912.5                      94 PI      93          1      972                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:3302549-IMAGp.5                57 PI      84       1628     1849                (no blast hit)
     6   0.0    0Xl3.1-xl312f05.5.5                         55 PI      87       1503     1657                (no blast hit)
     7   0.0    0Xl3.1-xlk154f06ex.3                        46 PI      87       1502     1711                (no blast hit)
     8   0.0    0Xl3.1-xlk118h19ex.3.5                      43 PI      76       1525     1837                (no blast hit)
     9   0.0    0Xl3.1-IMAGE:8822322.3                      42 PI      80       1509     1835                (no blast hit)
    10   0.0    0Xl3.1-XL410o20ex.3                         42 PI      76       1311     1748                (no blast hit)
    11   0.0    0Xl3.1-IMAGE:6634472.5.5                    37 PI      79       1310     1838                (no blast hit)
    12   0.0    0Xl3.1-IMAGE:8644689.5.5                    35 PI      74       1311     1660                (no blast hit)
    13   0.0    0Xl3.1-XL420a07ex.5                         28 PI      82       1510     1747                (no blast hit)
    14   0.0    0Xl3.1-XL427c12ex.5.5                       26 PI      75       1369     1661                Breast cancer metastasis-suppressor 1-like protein
    15   0.0    0Xl3.1-XL434h23ex.5.5                       25 PI      79       1363     1838                (no blast hit)
    16   0.0    0Xl3.1-xl295m02.3                           24 PI      78       1599     1838                (no blast hit)
    17   0.0    0Xl3.1-IMAGE:6634934.5                      22 PI      80       1496     1849                (no blast hit)
    18   0.0    0Xl3.1-IMAGE:8824806.5                      15 PI      75       1419     1838                (no blast hit)
    19   0.0    0Xl3.1-IMAGE:7766761.5                      14 PI      77       1496     1849                (no blast hit)
    20   0.0    0Xl3.1-IMAGE:8534530.5                      13 PI      79       1368     1793                (no blast hit)
    21   0.0    0Xl3.1-XL142c11.5                           12 PI      81       1362     1641                (no blast hit)
    22   0.0    0Xl3.1-XL087h14.5                           11 PI      75       1311     1667                (no blast hit)
    23   0.0    0Xl3.1-xl279b17.5                           10 PI      83       1599     1838                (no blast hit)
    24   0.0    0Xl3.1-IMAGE:8074657.5                      10 PI      80       1556     1793                (no blast hit)
    25   0.0    0Xl3.1-XL048k24.3                           10 PI      78       1553     1847                (no blast hit)
    26   0.0    0Xl3.1-XL189e14.5                            9 PI      82       1534     1849                (no blast hit)
    27   0.0    0Xl3.1-IMAGE:8073664.5                       9 PI      76       1538     1849                (no blast hit)
    28   0.0    0Xl3.1-XL439m12ex.5                          8 PI      82       1511     1755                (no blast hit)
    29   0.0    0Xl3.1-XL069e09.5                            8 PI      79       1311     1679                (no blast hit)
    30   0.0    0Xl3.1-XL018j04.3                            8 PI      78       1532     1849                (no blast hit)
    31   0.0    0Xl3.1-Lens-L026.5                           8 PI      78       1311     1626                (no blast hit)
    32   0.0    0Xl3.1-XL069m15.5.5                          8 PI      78       1619     1849                (no blast hit)
    33   0.0    0Xl3.1-XL158b24.5                            8 PI      77       1311     1658                (no blast hit)
    34   0.0    0Xl3.1-xl273j04.3                            8 PI      77       1346     1666                (no blast hit)
    35   0.0    0Xl3.1-IMAGE:5074551.3                       8 PI      77       1590     1838                (no blast hit)
    36   0.0    0Xl3.1-XL185e23.3                            7 PI      78       1523     1779                (no blast hit)
    37   0.0    0Xl3.1-IMAGE:8330994.5                       7 PI      75       1309     1663                (no blast hit)
    38   0.0    0Xl3.1-XL195i14.3                            5 PI      81       1525     1789                (no blast hit)
    39   0.0    0Xl3.1-IMAGE:8075725.5                       5 PI      79       1315     1606                (no blast hit)
    40   0.0    0Xl3.1-XL023a13.3                            5 PI      78       1313     1651                (no blast hit)
    41   0.0    0Xl3.1-XL417h05ex.5                          4 PI      93       1521     2172                (no blast hit)
    42   0.0    0Xl3.1-xlk154j06ex.5                         4 PI      92       1520     1656                (no blast hit)
    43   0.0    0Xl3.1-xl318l12.3                            4 PI      82       1542     1838                (no blast hit)
    44   0.0    0Xl3.1-xlk62m03ex.3                          4 PI      80       1502     1838                (no blast hit)
    45   0.0    0Xl3.1-IMAGE:8640551.3                       4 PI      80       1463     1755                (no blast hit)
    46   0.0    0Xl3.1-IMAGE:5079928.5                       4 PI      79       1419     1651                (no blast hit)
    47   0.0    0Xl3.1-IMAGE:3378555-IMAGp.5                 4 PI      78       1503     1850                (no blast hit)
    48   0.0    0Xl3.1-xlk117p02ex.3                         4 PI      78       1511     1836                (no blast hit)
    49   0.0    0Xl3.1-IMAGE:4965476.5                       3 PI      87       1534     1693                (no blast hit)
    50   0.0    0Xl3.1-IMAGE:6868442.5                       3 PI      80       1560     1789                (no blast hit)
    51   0.0    0Xl3.1-xlk71k11ex.3                          3 PI      75       1309     1689                (no blast hit)
    52   0.0    0Xl3.1-IMAGE:8820854.3                       2 PI      85       1628     1788                Unknown (protein for IMAGE:5074688) [Xenopus laevis]
    53   0.0    0Xl3.1-IMAGE:6877886.5                       2 PI      82       1465     1793                (no blast hit)
    54   0.0    0Xl3.1-XL096h01.5                            2 PI      79       1363     1756                (no blast hit)
    55   0.0    0Xl3.1-XL091c07.5                            2 PI      79       1630     1849                (no blast hit)
    56   0.0    0Xl3.1-IMAGE:8463852.5                       2 PI      77       1496     1849                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012838339 Xl3.1-XL083d09.3.5 - 62 ESTs
                                                                       .......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL083d09.3.5                                      TGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGAGTATGCCCGACAATTAGAGATGATTGTTTAATCTATGTGGGGCAATGCCCTCCTTACCAGATATCCATTTCCCATTCCCTTTTTACTGTATGATCTACTCATTTACTTCAACGGTGGTTTTTACCAAGGGGTCTGGGCTTTTTTTTTTTTTT------------ATCCACTGTTTGCTTCATCACATTCCCCGCGCTTGTTCGCCCCTCTGGAGGGAGTGAGGTTGGAGGCTCCACGGTCCTCTGGAGTGGGGTTCCGCCGGTCTCCATTCATTTCTATGGGATTTTGAAAGGCGTATTTATCAAAGAATGAACTTATCACCTATTGATGGGTACACTTTTAACAGTCCCATGGGGGTGGGTGGAGAAGTGGGTGGAGTTTTACTCTGGAGGACTGTGGGGCCTCTGGCTTCACTCTTTGATAAATATACCCCATTATTTTTCTGATGACCTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAGTGGTCGGGTTTGTCTTCACTATTCCTCTCTCGGAATTTTTCTCCTCGTTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAGGATGTATTAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAGTGGGGAGAGACAGATGCTGAGAGAGGGATGGTGAACATGGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAGTTTGGCCAAATTTGTCACATTATTA
                                                  Xl3.1-CHK-1012722888                                            TGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGAGTATGCCCGACAATTAGAGATGATTGTTTAATCTATGTGGGGCAATGCCCTCCTTACCAGATATCCATTTCCCATTCCCTTTTTACTGTATGATCTACTCATTTACTTCAACGGTGGTTTTTACCAAGGGGTCTGGGCTTTTTTTT------------------------TGTTTGCTTCATCACATTxCxxGC------------xxxxxGxGxGxGxGxxxxxxGxxxCxxCxxxxxxCTxxxGxGxGGxxxxxxxCxxxxxTCCATTCATTTCTATGGGATTTTGAAAGGCGTATTTATCAAAGAATGAACxTxxCxxxTxxxxxxGxxxACxxTTxxxAxxxxCxx------------------------GGAGTTTTACTCTGGAGGACTGTGGGGCCTCTGGCTTCACTCTTTGATAAATATACCCCATTATTTTTCTGATGACCTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAGTGGTCxxGTTTGTCTTCACTGTTCCTCTCxxxxxxTTTxTCTCCTCGTTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAAGATGTATTAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAGCTGCTGCATGGAGAGAGAGTGGGGAGAAACAGATGCTGAGAGAGGGATGGTGAACATGGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAGTTTGGCCAAATTTGTCACATTATTAAGATCA
                                                      consensus depths                                           3     3     8     8     9    10    12    13    14    15    15    15    16    16    17    17    17    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    16    16    16    16    14    15    13    15    14    15    14    15    14    15    14    15    14    15    12    13    11    13    12    13    12    13    12    13    12    13     8    12     7    12     7    12     7    12     7    12     7    12     6    11     5    11     5    11     5    11     4     9     4     9     3     9     3     9     3     9     3     9     3     9     3     9     3     8     2     7     3     8     2     7     0     7     2     6     2     6     1     4     1     4     1     4     1     4     1     4     1     4     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     3     1     3     2     3     2     3     4     5     4     5     4     6     5     7     6     9     8    11     9    15    12    17    12    17    12    18    13    20    13    20    12    20    13    20    13    20    13    22    11    23    15    24    14    24     6    28    10    28     6    28    10    28    11    29    11    28    11    28    11    30    13    30    10    29    10    29    13    29    15    29    15    29    16    28    16    28    24    30    15    31    16    30    15    30    18    30    20    29    19    29    22    29    20    29    18    30    14    32     8    31    22    30    20    31    20    31    22    31    26    31    25    31    25    30    24    30    24    30    22    30    21    27    21    26    20    25    21    24    20    23    17    21    19    22    18    22    16    20    16    20    14    20    13    19    13    19    14    19    11    17    10    16    10    16    10    15    10    15    10    15     8    14     8    12     7    12     4    10     3     8     2     7
  5   1   2      ests                            Xl3.1-IMAGE:6640368.5                                      TGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGAGTATGCCCGACAATTAGAGATGATTGTTTAATCTATGTGGGGCAATGCCCTCCTTACCAGATATCCATTTCCCATTCCCTTTTTACTGTATGATCTACTCATTTACTTCAACGGTGGTTTTTACCAAG
  5   1   2      ests                                 Xl3.1-XL083d09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTCTGGAGGACTGTGGGGCCTCTGGCTTCACTCTTTGATAAATATACCCCATTATTTTTCTGATGACCTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAATGGTCGGGTTTGTCTTCACTGTTCCTCTCTCGGAATTTTTCTCCTCGTTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAGGATGTATTAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAATGGGGAGAGACAGATGCTGAGAGAGGGATGGTGAACATGGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAGTTTGGCCAAATTTGTCACATTATTAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTTTCCTGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTTTTAAATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATCAATTAAATATTCTGTACCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAATCAAGTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCACTATTCCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGTGGGGAGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATATTAAATTTTCGCAAACTTTC
                                                                   SNP                                                                                      -------C----
                                                                   SNP                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                              ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G-G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----G----G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----GG-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -A--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----AA------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --G---------
  5   1   2      ests                            Xl3.1-IMAGE:6640368.5                                      TGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGAGTATGCCCGACAATTAGAGATGATTGTTTAATCTATGTGGGGCAATGCCCTCCTTACCAGATATCCATTTCCCATTCCCTTTTTACTGTATGATCTACTCATTTACTTCAACGGTGGTTTTTACCAAG
                                                  Xl3.1-CHK-1012690115                                            TGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGAGTATGCCCGACAATTAGAGATGATTGTTTAATCTATGTGGGGCAATGCCCTCCTTACCAGATATCCATTTCCCATTCCCTTTTTACTGTATGATCTACTCATTTACTTCAACGGTGGTTTTTACCAAGGGGTCT
  5   1   2       bld Neu7 5g3  in                         XL031a22.5p TGCAGGCAATTCGGCACGAGGCTCAGTNTTGTGCGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGTGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTACAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATTGCAGACTGCATTGAAAAAGCTTATGGAAAA
  5   1   2       bld Oo1  5x3                        IMAGE:6859084.5p              GGTGTTGCTCAGTCATTGTGCTGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTCAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACTACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGAGTATGCCCGAACATTAGAGATGATTGGTTTAATCTATGGTGGGGCAAATGCCCTCCTTTACCAGATATCCCATTTTCCCATTCCCTTTTTTTACTGGTATGAAATCTACTCATT
  5   1   2       chi Ov1                             IMAGE:6317435.5p                              CCACGCGTCCGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACCATAAGGGATGAAATCCCCGACTGCATTGAAAAAGCTTATGGGAAAAATCCAGGTTTAATGAGGGCCACAAGGGATATTAATTTCTTTAACCACCTCCGAAAGAAAAATGACCGGAGGTATGCCCAAGCAAGCCCCGGCGCTGTGGCGGTCTGGGCCCCAAAACCAAAAAACCTACAGGGTTTGCAGGTATTGCCGGTGCCGGCCAAAAGACCGCCGAGAGGATGGTGGACCCATTGCCCCTCGCCACCGGTGGAACTTAGCCGCAGATCAAGAGTCGTTTTCCCGCAATAATGCCCCCGCTACACAATGTGACAAGCGCCTGGAATTCGCGTTCTATAAATCTGATTGTTTGCGGGGCGACATAATGGCGCGCCTTCCCTTTAGACCAGGNGAATATATTTCCCATTTGTACCCCGCGCTTGTTCGCCCCTCTGGATTGATACGCGCGGCGCGGTGGGGAAGACCTTACACCGTCAGCCACCTTCTCACCCCTGTTGCACCACCGA
  5   1   2       bld Ov1                    IMAGE:6317435-IMAGp.IMAGp                                         CGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAAGAAGC
  5   1   2       bld Em10                            IMAGE:8320365.5p                                         CGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAAATGAGGCACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAGAGCGTGGTGGGTGTTGGGTCCAACATACTACAGTTCAGTAGCAGCAGCAGACCCAGAGAGTCCCATTTCATCACGACTAGCAGCAGTCTCAGTATGCGACATAAGATATGTTATCTGGGGCATGCCTCTA
  5   1   2       bld Oo1                             IMAGE:5079541.5p                                          GCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTCAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACTACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGAGTATGCCCCGACATTAGAGATGATTGTTTAAATCCTATGTGGGGCAATGCCCCTCCTTACCAGATATCCCATTTCCCCATTCCCCTTTTTTACTGGGGATGAATCTACTCATTTACC
  5   1   2       bld Ov1                             IMAGE:5048530.5p                                           CTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTAACTTGGGGAAAGTTGGAAGCTTGGGCTCCTTTTTGGGAACANGAACTTTTTTGNNCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAA
  5   1   2       bld Emb1                            IMAGE:6637173.5p                                                 GTAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAAGAAGCGTGGGTTGTGTGTTGGGGTCCAAACAATAACTACAGTTTTCAGTAGCCAGGCAGCAGAAACCCAGAAAGGATGCCACCAATCCCCATCCACGGGAACTAACCCAAGCAAAGTCAATCGAGGTATGCCCCCACCATTTTAAAGAAGGATTGTTTAAATCTATGTGGGGGGGAAATGGCCCTCCCTTTACCAGGAAATCCCTTGATGGCCATTCCCTTTTTTAACTGGGATGGACCTACCTCCATTAACCTTCAACCGGCGGGGTTTTTTTACCCAG
  5   1   2       bld Oo1                             IMAGE:6638135.5p                                                     CTGAAGGGCTGAGGCAATTAGCTGCCATGTATGAGCAGCTCAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACTACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGGCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATGTACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATGGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCAGTCACGGGAACTAGCCAAGCAAGTCATCGAGTATGCCCGACAAATTAGAGATGATTGTTTAAATCTATGTGGGGGCAATGCCCCTCCTTACCCAGATATTCAATTTCCCATTTCCCTTTTTTACTGGAATGGACCTAACTCATTTACTTTCAACGGTGGGGTTTTTTACC
  5   1   2       bld Ga18                              xlk138p02ex.5p                                                             GCTGNGGNATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGNCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTACAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGNTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATTGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGNTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGNNNGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGANGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGANNNTNNCCGANANT
  5   1   2       bld Oo1                             IMAGE:5078951.5p                                                                  GCAATTAGCTGCCATGTATGAGCAGCTTAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTACAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATTGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGAGTATGCCCGANCATTAGAGATGATTGTTTAATCTATGTGGGGCAATGCCCTCCTTTACAGATATCCATTTCCCATTCCCTTTTTACTGTATGATCTACTCATTTACTTTCAACGGTGGTTTTTTACCAAGGGGTCTGGGGCtttttttttttttCCTGAACAA
  5   1   2       bld Egg3      in                    IMAGE:3377646.5p                                                                     CCGGGCTGCCATGTATGAGCAGCTCAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACTACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACAC
  5   1   2       bld Tbd7      in                         XL083d09.5p                                                                          GCTGCCTGTATGAGCAGNTCAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACCACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGTGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTACAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCT
  5   1   2       bld Tbd7      ?                          XL068c15.5p                                                                                TGTATGAGCAGCTCAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACTACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAA
  5   1   2      seed Egg3                   IMAGE:3377646-IMAGp.IMAGp                                                                                   ATGAGCAGCTCAAAGCCGAGTGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACTACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGAGTATGCCCGACAATTAGAGATGATTGTTTAATCTATGTGGGGCAATGCCCTCCTTACCAGATATCCATTTCCCATTCCCTTTTTACTGTATGATCTACTCATTTACTTCAACGGTGGTTTTTACCAAGGGGTCTGGGGCtttttttttttttttCTTGTACACAATCCACTGTTTGCTTCATCACATTTCTGGCA
  5   1   2       bld Oo1                             IMAGE:6640368.5p                                                                                                       TGGGCTAAGAAGAGCCCCAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACTACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGAGTATGCCCGACAATTAGAGATGATTGTTTAATCTATGTGGGGCAATGCCCTCCTTACCAGATATCCATTTCCCATTCCCTTTTTACTGTATGATCTACTCATTTACTTCAACGGTGGTTTTTTACCAAGGGGTCTGGGGCTTNttttttttttCTTGAACAACAAATCACTGGNTTGCTTCATCACATTTCA
  5   1   2       bld Gas6      in                    IMAGE:3438386.5p                                                                                                                        CAACCTGAGCAAGTGCGGGGATGTACTTGGGAAGTTGAAGCTGGCTCTTTTGGAACAGAACTTTTTGCCTACTACTGATGTCAAACTCACAAAGCAGCAACTAATTCTAGCCCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAGAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGAGGAACTACCGGAATCTGCTTATAAACACCAACTGTTGGGACTCAATCTTCTATTCCTTTTGTCACAAAACAGAGTAGCTGATTTCCATACAGAGCTGGAGAGGCTCCCTGCCAAAGATATCCAAACTAATGTGTATATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATACCTTCTTCATAGACATTTTGCTGGATACAATAAGGGATGAAATCGCAGACTGCATTGAAAAAGCTTATGGAAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAGATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCATACAATAACTACAGATTCAGTAGCCAGCAGCAGAACCCAGAAGAGTCA
  5   1   2       bld Ga15                               XL503o23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTTTTCTGGCTAAAGGGAATATACCAGCTGAGAGCTATANNTTCTTCNTAGACATTTTGCTGGATACAATAAGGGATGAAATTGCAGACTGCATTGAANAAGCTTATGGAAAAATCCAGTTTAATGAG
  5   1   2       chi Ga15                               XL464i12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAATCCAGTTTAATGAGGCAACAAGGATATTATTCTTTAACACTCCGAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCAGAAGATGTCACCATTCCATCCACGGAACTAGCCAAGCAAGTCATCGAGTATGCCCGACAATTAGAGATGATTGTTTAATCTATGTGGGGCAATGCCCTCCTTACCAGATATCCATTTCCCATTCCCTTTTTACTGTATGATCTACTCATTTACTTCAACGGTGGTTTTTACCAAGGGGTCTGGGCtttttttttttCTNGNACAANAATCCNCNGTTNGCTTCNTCACNTTTCNGGCAAAAANGGGGNATGTTTGTCAGGGGGNGAGGTTGGAGGCTCCNCGGCCCTCTGGAGGGGGGTTCCNCCGG
  5   1   2      ests                                 Xl3.1-XL083d09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTCTGGAGGACTGTGGGGCCTCTGGCTTCACTCTTTGATAAATATACCCCATTATTTTTCTGATGACCTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAATGGTCGGGTTTGTCTTCACTGTTCCTCTCTCGGAATTTTTCTCCTCGTTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAGGATGTATTAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAATGGGGAGAGACAGATGCTGAGAGAGGGATGGTGAACATGGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAGTTTGGCCAAATTTGTCACATTATTAAG
                                                  Xl3.1-CHK-1012686998                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGACTGTGGGGCCTCTGGCTTCACTCTTTGATAAATATACCCCATTATTTTTCTGATGACCTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAGTGGTCGGGTTTGTCTTCACTATTCCTCTCTCxxxxTTTxTCxxCTCGTTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAAGATGTATTAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAGTGGGGAGAAACAGATGCTGAGAGAGGGATAGTGAACATGGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAGTTTGGCCAAATTTGTCACATTATTAAGATCAAG
  5   1   0       chi Tad2                            IMAGE:6931743.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGTCTGGGCtttttttttttCTTGTACAACAATCCACTGTTTGCTTCATCACATTTCTGGCAGAAATGGGGTATGTTTGTCAGGGAGTGAGGTTGGAGGCTCCACGGTCCTCTGGAGTGGGGTTCCGCCGGTCTCCATTCATTTCTATGGGATTTTGAAAGGCGTATTTATCAAAGAATGAACTTATCACCTATTGATGGGTACACTTTTAACAGTCCCATGGGGGTGGGTGGAGAAGTGGNNTGGAGTTTTACTNCTGGAGGACTGTGGGGCCTCTGGCTTCACTCTTTGATAAATATACCCCATTATTTTTCTGATGACCTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAATAATCAAGTTTATCTTCACTGTTCCTCTCTAGGAATTTGTTTCTCCTCGTTCTATCTTGATTCAGGAAGTGGTTGTCAAATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAAAATGTATTAAATTCCACTCTATTATAACGCCCCACATTCTGTTCTCCAATATCCAAATGTGCAAACCTTTTTTGGTGGCCGAAATTTTTTTGGNTTATCGGACATCTGTCGCAAGGGGTTAATATGN
  5   1   2       add Tad2                            IMAGE:6931334.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGTCTGGGCtttttttttttCTTGTACAACAATCCACTGTTTGCTTCATCACATTTCTGGCAGAAATGGGGTATGTTTGTCAGGGAGTGAGGTTGGAGGCTCCACGGTCCTCTGGAGTGGGGTTCCGCCGGTCTCCATTCATTTCTATGGGATTTTGAAAGGCGTATTTATCAAAGAATGAACTTATCACCTATTGATGGGTACACTTTTAACAGTCCCATGGGGGTGGGTGGAGAAGTGGGTGGAGTTTTACTCTGGAGGACTGTGGGGCCTCTGGCTTCACTCTTTGATAAATATACCCCATTATTTTTCTGATGACCTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAATAATCAAGTTTATCTTCACTGTTCCTCTCTAGGAATTTGTTTCTCCTCGTTCTATCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTTGCCTAGAAAATGTATTAGAAGCTCACTCAATTTAAATCCCCCAAAATTTTGGTCTCCTTTATGCCaaattttgcaaaaacntttttttgttttcggaaaattttttN
  3   1   2       bld Egg3      in                    IMAGE:3377646.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCCACTGTTTGCTTCATCACATTTCTGGCAGAAATGGGGTGTGTTTGTCGGGGAGTGAGGTTGGAGGCTCCACGGTCCTCTGGAGTGGGGTTCCGCCGGTCTCCATTCATTTCTGTGGGATTTTGAAAGGCGTATTTATCAAAGAATGAACTTATCACCTATTGATAAATGCACTTTTAACAGTCCCGTGGAGGTGGGTGGAGAGTGGTGGAGTTTTACTCTGGAGGACTGTGGGGCCTCTGGCTTCACTCTTTGATAAATATACCCCATTATTTTTCTGATGACCTAGAATGCCAAGGGGAACTTCTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCGTGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTC
  3   1   0       add DMZ                                 rxl270n03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACCTAGGCAAATAAAGAATACATAGAGGTATATTTGTCAGAGAGTGAAGTTGGATCGTCACGGTCCACTGGAGTGAAGTCCCGCCACTCTATTCATTTCCGTCGGATTTTGAAAGGCTTGTTTATCAAAGAATGAACTTTCACCCATTGATGGATACTCTTGAAAATCCCACGGGGGTGAATGGAGAGTGGCGGAGTTTCACTCTGGAGGACTGTGACGATCTCTAACTTCTTTAATAAATATACCCCATAGACATTATTGCTGGAAGATAGAAGAAAAAAACTTTATGCATTCCGATCCTTAGGGCAATCATAAATTTGGGTTTTGCAAAACTTGTCCTTGTTTTACTTTCCCTTTCATTTCTGTTGCATCTGAATTCCCATTGGCTGGATGTTCTTGTAAGAGAGAATCACTGGTACAATGGGTAATGCTCAGTAATCACTGGTGTACAATGATGATAAACGATTGTCCACATCTGTCAAATATCCTGATTCGTTGATAACGGTGTCAGTCAAAATGATGCCTATCGTCTTCTTTCTAAGTCTGGTTGTGAGACATACAGTACATCTTCTAAAACTCCTTCTGGAATAAAAAACCAGAAACTACTAAGCATTGTTGGCAA
  5  -1   2       add Tad1                            IMAGE:6940510.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAACCCGGGATTTAAGAAAAATTCGGTTCGCTTCTTTGGAAAATGGGACCCCCAGCGCAGAAATTCTGCCGGAGCAAGCACCCCCCAAACGGATGCGGTTTGACCaaaaaaaaaCATGTTTCCCCATGACAGTATCCCTTTAAGCATTTTCTAACTGAAACTAAAACAGCTTTACAATTATGTAACCTATATTACAGGAGCAACTGACCACGATTTGACGCAAGGTAACTGCAATAAGCTGCTTTGTGGCTTTGGTTAAAAGGGGAACTTAAGCGAAAATGAAATATAAGCTTCAGCATACTGAAATaaaaaaaacgtaatacatacggtacaatcaattaaaaaaaaaaTTCTGCATTATATCCAAAATTATCAAGTTTATGTTCACTATTCCTATGTATTAGAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTACATGCAGGATTTGTGCAAAATGCAGTTATTTTGTTTGTATTGGAATCCGTTATTTGAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCTATAAGATATATCTATGGATCTAACTGTCAATGAATATCTGACACCCAACTGCTGCATGAAGACAGAATGAAGAGAAACAGATGCTGAGAGAGGAATAGTGAAGATAAACTTGATTATTTCAGAAACAATGCAGAATATAATTGACAATAATTGATTGTATTTAAAATGTTTCTTATTTCAGTATGATGAAGCTTATATTAAATCC
  3   1   2       add Neu7 5g3  in                         XL031a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTGGGGGACTGTGGGGCCTCTGGCTTCGCTCTTTGATAGATATACCCCATTATTTTTCTGATGACCTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATGCAATCAATTAAATATTCTGTACCGTTTCTGAAGTGGTCGGGTTTGTCTTCACTGTTCCTCTCTAGGAGTTTGTTTCTCCTCGTTCTATCTTGGTTCAGGAGTTGGTTGTCAGATGGATGATCCACCTTATGAGGGGGCATCTTTTGCCTGGAGGATGTATTGGGGCTCACTCTGTTAGGGTCACCGGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGCAGTTATTTTGTTTGTGCTGGAATCGGTTGTTTCGGTGGGCTCTGGTGCATCTGCTGGGAGAGGAGGCCCCCCGTAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCGGCTGCTGCGGGAGAGGGAATGAGGGGAGGCGGATG
  5   1   2       add Ooc1      out                    Ooc1-db26e07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGTCGACCCACGCGTCCGATTATTTTTCTGATGACCTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATGCAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATGCAATCAATTAAATATTCTGTACCGTTTCTGAAGTGGTCGGGTTTGGCTTCACTGTTCCTCTCTAGGAGTTTGTTTCTCCTCGTTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATGAGGGGGCATCTTTTGCCTAGGGGATGTATTGGAGCTCACTCTGTTGGAGTCACCAGAGATCATGTCTCTCTATATGCAGAGTTTGTGCGGGAGGCAGTTATTTTGTTTGTACTGGAGTCGGTTGTTTCGGTGAGCTCTGGTGCATCTGCTGGGAGAGGAGGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCGGCTGCTGCATGGGGAGGGAGTG
  5   1   2       bld Skin      in                    IMAGE:8641882.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTACCCCATTATTTTTCTGATGACCTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAGATACAGTCAATTAAATATTCTGTACCGTTTCTGAAATGGTCAGGTTTGTCTTCACTGTTCCTCTCTCGGAATTTTTCTCCTCGTTCTGTCTTGATTCAGGGGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAGGATGTATTAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCGGCTGCTGCAtggagagagagtggggagagacagatgctgggagaggggTGGTGAACATGGACTTGATTGTTTTAGAGACAATGATTGTATTTGGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCACTCTGTGAGGCAGGGTTTATATGTGTCCTTAGCAGAGCT
  5   1   2       add Ga18                              xlk122b01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTATTTTTCTGATGACCTAGAATGCCAAGGGGAANTTTTTCCTGTTTTATACAAGTGATGCATTGNNTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATGCAATCAATTAAATATTCTGTACCGTTTCTGAAGTGATCAAGTTTGTCTTCACTGTTCCTCTCTAGGAGTTTGTTTCTCCTCGTTCTGTCTTGATTCAGGAGTTGGNTGTCAGATGAATGATCCACCTTGTAAGGGGGCATCTTTTGCCTGGGGGNTGTGTTGGAGCTTACTCTGTTGGAATCGCCGGGCATCATGTCTCTCTACATGCAGAATTTGTGCNNNNGGNAGTTATTTTGTTTGTACTGGAATCAGTTATGTCAGTGAGCTCTGGTGCATCTGCTGGGAAAGGAGNNCCCCCATGNNNATATTGAATCTAACTGTCAATGACTATCTGACACCCAGCTGCTGCATGGAGAGGGAATGAGGAGAGACAGATGCTGGNAGANGGANGGTGAACATGGACTTGATTGTTTTAGAAACAATGANTNNNTTTAGAAAGTTTCNNGCATCAG
  5   1   2       bld FaBN                            IMAGE:8078916.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTCTGATGACCTAGAATGCCAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAATAATCAAGTTTGTCTTCACTGTTCCTCTCTCAGAATTTTTCTCCTCATTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAAGATGTATTAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCGTGAAGAGAGAATGGGGAGAAACAGATGCTGAGAGAGGGATAGTGAACATGGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACTTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGT
  5   1   2       add DMZ                                  xl271l19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATGCAATCAATTAAATATTCTGTACCGTTTCTGAAGTGGTCGAGTTTGTCTTCGCTATTCCTCTCTCAGAGTTTTTCTCCTCGTTCTGTCTTGGTTCAGGGGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAGGATGTGTTAGCTCACTCTGTTGGAATCACCAGACATCATGTCTCTCTGTATGCAGAGTTTGTGCAGAGGGCAGTTGTTTTGTTTGTGCTGGAATCGGTTGTTTCAGTGAGCTCTAATGCATCTGCTGGGAAGGGAGGCCCCCCATAAGATATATTGAATCTGACTGTCAATGACTATCTGACACCCGGCTGCTGcatggagagagagtggggagagacagatgctgggagagggatggtgggCATGAACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCA
  5   1   2       add DMZ                                  xl285m10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAGAATGCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATGCAATCAATTAAATATTCTGTACCGTTTCTGAAGTGGTCGAGTTTGTCTTCGCTATTCCTCTCTCAGAGTTTTTCTCCTCGTTCTGTCTTGGTTCAGGGGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAGGATGTGTTAGCTCACTCTGTTGGAATCACCAGACATCATGTCTCTCTGTATGCAGAGTTTGTGCAGAGGGCAGTTGTTTTGTTTGTGCTGGAATCGGTTGTTTCAGTGAGCTCTAATGCATCTGCTGGGAAGGGAGGCCCCCCATAAGATATATTGAATCTGACTGTCAATGACTATCTGACACCCGGCTGCTGcatggagagagagtggggagagacagatgctgggagagggatggtgggCATGAACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACT
  5   1   2       add DMZ       in                         xl235o01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAGATATTCTGTACCGTTTCTGAAGTAATCGGGTTTGTCTTCACTGTTCCTCTCTAGGAGTTTGTTTCTCCTCGTTCTATCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTGGAGGATGTATTGGAGCTCGCTCTGTTGAGGTCGCCGGACGTCGTGTCTCTCTATATGCAGAATTTGTGCAGGAGCAGTTATTTTGTTTGTACTGGAGTCAGTTATTTCAGTGAGCTCTGGTACATCTGCTGGGAAAGGAGGCCCCCCATGAGATATATTGAATCTAACTGTCAGTGACTGTCTGGCACCCAGCTGCTGCGTGGGGGGAGAGTGGGGAGAGGCGGATGCTGGGAGAGGGATGGTGAACATGGACTTGATTATTTTGGAAACAATGATTGTATTTGGAAAGTTTCTTGCATCANTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAANCCTTCATTTTATGGGTCATACTGGGCACANC
  5   1   2       bld Ga12      in                         XL210m22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAGGGGAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAGATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAGTCAATTAAATATTCTGTACCGTTTCTGAAGTGGTCGGGTTTGTCTTCACTATTCCTCTCTCGGAGTTTTTCTCCTCGTTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAGGATGTATTAGCTCACTCTATTAGGGTCACCGGACATCGTGTCTCTCTGTATGCGGAATTTGTGCAAGGGGCAGTTATTTTGTTTGTGCTGGAGTCAGTTGTTTCAGTGAGCTCTAGTACATCTGCTGGGAGAGGAAGCCCCCCATAGGATATATTGAATCTGACTGTCAATGACTATCTGACACCCGGCTGCTGCATGGAGAGAGAGTGGGGGGAAACAGATGCTGAGAGAGGGATGGTGAACATGGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACA
  5   1   2       add Neu7      in                         XL032j23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAACTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAATAATCAAGTTTATCTTCACTATTCCTCTCTAGGAGTTTGTTTCTCCTCATTCTATCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAAGATGTATTAGAGCTTACTCTATTAAAATCACCAGACATCATGTCTCTCTACATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATGTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAATGAGGAGAAACAGATGCTGAGAGAGGGATAGTGAACATAAACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTCA
  3  -1   2       add Bla2                            IMAGE:7296722.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAGGTTTTAGCATGCTGTAATTTTTTAAATACAATCAATTAGATATTCTGTACCGTTTCTGAAGTAGTCAGGTTTAACTTCACTGTTCCTCTCTAGGAGTTTGTTTCTCCTCGTTCTATCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAGGGGGGCATCTTTTGCCTGGAGGATGTATTGGAGCTCGCTCTGTTAGGGTCGCCGGAGATCATGTCTCTCTATATGCAGAATTTGTGCAAGGGGCAGTTGTTTTGTTTGTACTGGAATCGGTTGTTTCAGTGAGCTCTGGTGCATCTGCTGGGAAGGGAGGCCCCCCGTAAGATATATTGAATCTAACTGTCGGTGACTGTCTGACACCCAGCTGCTGCGTGGGGAGGGAGTGAGGGGAAGCAGATGCTGGGAGAGGGATGGTGAACATGGACTTGATTATTTTAGAAACAATGATTGTATTTGGAAAGTTTCTTGCATCAGTATGATATTAAATTTTCGCAAACTTTCTCTACANCTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCAT
  5   1   2       add Ga12                                 XL180h02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTTTCCTGTTTTATACAAGTGATGCATTGGCTTATAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGNAATTTTTTAAATGCAATCAATTAAATATTCTGTACCGTTTCTGAAATANNCAGGTTTGTCTTCACTATTCCTCTCTCGGAATTTTTCTCCTCGTTCTGTCTTGATTCAGGAGTTGGTTGACAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTGGAGGATGNATTGGCTCACTCTATTGGAGTCACCANACATCATGTCTCTCTATATGCA
  5   1   2       bld Ga12      in                         XL204d09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGCTGTTTTATACAAGTGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAATAGTCAAGTTTGTCTTCACTATTCCTCTCTCGGAATTTTTCTCCTCATTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAAGATGTATTAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAATGGGGAGAAACAGATGCTGAGAGAGGGATGGTGAACATGGACTTGATTGTTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTAC
  5   1   2       bld Ga12      in                         XL161f10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATGCATTGGCTTAGAAAAGGCATTGAGTTTAATACTTAAAGGGGAACTATCATGAAAATGAAAATTTAAGTTTTAGCATACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAATAATCAAGTTTGTCTTCACTATTCCTCTCTCAGAATTTTTCTCCTCATTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAAGATGTATTAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAATGAGGAGAAACAGATGCTGAGAGAGGGATAGTGAACATAGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAG
  5  -1   2       add Ga12      out                        XL146p06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAACTATACCCCCAAAATGAATACTTTAAAGGGGAACTATTGCGAAAATGAACGTTTAACAGAAGCTTCATCAGACTTAAAAATCTGCATCATTTCTGAAATCAAGTTCATCTTCACTATTCCTCTCTCAGCATCCGTTTCTCTCCGCTCTGTCCCCACGCAGCAGTTGGGTGTCAGACATTCACTGACCGCTAGATCCAATATATCCTATAGGGGGACACCTATTGCCTAGAAGATGCATTAGAGCTCACTATTAAAATCCCCAGACATCACGTCTCTCTACATGCAGGATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGAAATCAGTTATTTGAGTGAGCTCTAATTTATCTGCTAGGAAAGGAAGCCCCCCCATAAGATATATTGGATCCAACAGTCAATGAACATCCGACACCCAACCGCTGCACGAAGAGAGAACGAAGAGAAACAGATGCTGAGTGAGGGACAGTGAAGCTAAAACGTGATTTCAGAAACTATGCTGAGTGAGGGATAGTGAAGCTAAAACGTGATTTCAGAAACTATGCAGAATATTTAATTTTCTTTAGAAAGTTTATTTTAGTATGATGAAGCTTA
  5  -1   2       add Em10                            IMAGE:7983204.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGCTAGAAAAGCATTGAGTTTATACTTGAAGGGAATATCATGAAATGAAAATTAAGTTTTAGCATACTGTAATTTTTAAATGCAGTCGATTGGATATTCTGTACCGTTTCTGAAGTGGTCGGGTTTGTCTTCACTATTCCTCTCTCGGAATTTTTCTCCTCGTTCTGTCTTGGTTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAGGATGTATTGGCTCGCTCTGTTGGAGTCACCAGGCATCGTGTCTCTCTGTATGCGGAGTTTGTGCAGAGGGCAGTTATTTTGTTTGTACTGGAATCGGTTGTTTCAGTGAGCTCTAGTGCATCTGCTGGGAAGGGAAGCCCCCCATGAGATATATTGAATCTAACTGTCAATGACTATCTGGCACCCGGCTGCTGCGTGgagagagagtggggagaggcagatgctgagagagggaTGGTGAACATGGACTTGATTATTTTAGAAACAATGATTGTATTTGGAGGGTTTCTTGCATCAGTGTGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGTCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCttttttttttatttttAAAGAAAGCA
  5   1   2       add Tad2                            IMAGE:6934009.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACTGTAATTTTTTAAATACAATCAATTAAATATTCTGTACCGTTTCTGAAATAATCAAGTTTAACTTCACTATTCCTCTCTAGGAATTTGTTTCTCCTCATTCTATCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAAGATGTATTAGAGCTCACTCTATTAAAATCACCAGAGATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAATGAAGAGAAACAGATGCTGAGAGAGGGATAGTGAACATAAACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGATATTAAATTTTCGCAAACTTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTAATTTATATAGATCttttttttattttttAAAAGAAACCAGTTTTTGTTTAACCAGTTGAGGCCTACAAACCAGACAAGTTTAATGC
  5   1   2       add Ga15                               XL416l17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATTTTTTAAATGCAATCAATTAAATATTCTGTACCGTTTCTGAAGTAGTCAAGTTTGTCTTCACTATTCCTCTCTGGGAGTTTGTTTCTCCTCGTTCTATCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGGGGATGTGTTGGAGCTTACTCTATTAAGATCGCCAGACATCATGTCTCTCTACATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAGTCGGTTATGTCAGTGAGCTCTAGTGCATCTGCTGGGAGAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAGCTGCTGCGTGGGGAGGGAGTGAGGAGGGACAGATGCTGGGAGAGGGATGGTGAACATGGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAANAGCTCTAATTTATATAANATCtttttttttattttttA
  3   1   2       bld Skin      in                    IMAGE:8641882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTATTTTTTAGATACAGTCATTAAATATTCTGTACCGTTTCTGAAATGTTCAGTTTGTCTTCACTGTTCCTCTCTCGGAATTTTTCTCCTCGTTCTGTCTGATTTCAGGGGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAGGATGTATTAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATTTGACCACCCGGCTGCTGCATGGAGAGAGAGTGGGGAGAGACAGATGCTGGGAGAGGGGTGGTGAACATGGACTTGATTGTTTTAGAGACAATGATTGTATTTGGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATTCAGACATAGATAGCCCGTCCCNNNTTTTCCC
  5   1   2       add Te2N                            IMAGE:7206030.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTTCTGTACCGTTTCTGAAATAATCAAGTTTGACTTCACTATTCCTCTCTAGGAGTTTGTTTCTCCTCGTTCTATCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAGGATGTATTGTGAGCTCACTCTATTAAAATCACCAGAGATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTGTTTCAGTGAGCTCTGGTGCATCTGCTGGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAGCTGCTGCATGGGGAGGGAATGAGGAGAGGCAGATGCTGAGAGAGGGATAGTGAACATAAACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGATATTAAATTTTCGCAAACTTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTAATTTATATAGATCttttttttattttttAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACAAGTTAATGCCATCCGTTACCTTGTTCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAAGTTTGGCCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGG
  3   1   2       add Neu7      in                         XL032j23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTTCTGAAATAATCAAGTTTATCTTCACTATTCCCTCTCTAGNAGTTTGTTTCTCCTCATTCTATCCTTGATTCAGNAGTTGGTTGTCAGATGAATGATCCCACNTNATAAGGGGGCATCTTTTGCCTAGAAGATGTATTAGAGCTTACTCTATTAAAATCACCAGACATCATGTCTCTCTACATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATGTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAATGAGGAGAAACAGATGCTGAGAGAGGGATAGTGAACATAAACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTAATTTATATAGATCTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACAAGTTAATGCCATCCGTTACCTTGTTCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAGTTTGGCCAAATTTGTCACATTATTAAGATCAGTAATGTAAGCATTACAAAATAGAAATCAC
  3   1   2       add Tbd7      in                         XL083d09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCTGAAATAATCAAGTTTGTCTTCACTATTCCTCTCTAGGAATTTGTTTCTCCTCATTCTATCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAAGATGTATTAGAGCTTACTCTATTAAAATCACCAGACATCATGTCTCTCTACATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATGTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAATGAAGAGAGACAGATGCTGGGAGAGGGATAGTGAACATAAACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTAATTTATATAGATCTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACAAGTTAATGCCATCCGTTACCTTGTTCAACTGAANCAATGTATATATACA
  3   1   2       bld DMZ       in                         xl235o01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTCTGAAGTAATCGGGTTTGTCTTCACTGTTCCTCTCTAGGAGTTTGTTTCTCCTCGTTCTATCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTGGAGGATGTATTGGAGCTCGCTCTGTTGAGGTCGCCGGACGTCGTGTCTCTCTATATGCAGAATTTGTGCAGGAGCAGTTATTTTGTTTGTACTGGAGTCAGTTATTTCAGTGAGCTCTGGTACATCTGCTGGGAAAGGAGGCCCCCCATGAGATATATTGAATCTAACTGTCAGTGACTGTCTGGCACCCAGCTGCTGCGTGGGGGGAGAGTGGGGAGAGGCGGATGCTGGGAGAGGGATGGTGAACATGGACTTGATTATTTTGGAAACAATGATTGTATTTGGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAAC
  3   1   2       bld Ga12      in                         XL210m22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTGAAGTGGTCGGGTTTGTCTTCACTATTCCTCTCTCGGAGTTTTTCTCCTCGTTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAGGATGTATTAGCTCACTCTATTAGGGTCACCGGACATCGTGTCTCTCTGTATGCGGAATTTGTGCAAGGGGCAGTTATTTTGTTTGTGCTGGAGTCAGTTGTTTCAGTGAGCTCTAGTACATCTGCTGGGAGAGGAAGCCCCCCATAGGATATATTGAATCTGACTGTCAATGACTATCTGACACCCGGCTGCTGCATGGAGAGAGAGTGGGGGGAAACAGATGCTGAGAGAGGGATGGTGAACATGGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAA
  3   1   2       bld Ga12      in                         XL161f10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATAATCAAGTTGTTTTTCCTTATNCCTNTCTCAGAATTTTTCTCCTCATTNTGTNCTGGATCCAGNAGTTGGTTTGTCAGATGAATGATCCCCCCTTATAAGGGGGCATCTTTTGCNTAGAAGATGTATTAGCTCACTNTATTAAAATCACCAGACATCATGTNTCTNTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTNGTACTGGAATCAGTTATTTCAGTGAGCTNTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAATGAGGAGAAACAGATGCTGAGAGAGGGATAGTGAACATAGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCACAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAGT
  3   1   2      seed Ga12      in                         XL204d09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCTCATTCTGTCTTGATTCAGGAGTTGGTTGTCAGATGAATGATCCACCTTATAAGGGGGCATCTTTTGCCTAGAAGATGTATTAGCTCACTCTATTAAAATCACCAGACATCATGTCTCTCTATATGCAGAATTTGTGCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTCAGTGAGCTCTAATACATCTGCTAGGAAAGGAAGCCCCCCATAAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAACTGCTGCATGAAGAGAGAATGGGGAGAAACAGATGCTGAGAGAGGGATGGTGAACATGGACTTGATTGTTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAA
  5  -1   0       chi Ga15      in                       XL512a08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ttttttttNTAATTGAAAAAAGTCTTTATTTCTGGGGAACAATCTGAAAACAATTGAACAGAAAAAAGTGTTTGTAAGGTGAACAACCCCTTTAAATCCCTAGAAATCCTGTCTCTCTACATGTAGAATTTGTTCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTGAGTGAGCTCTAATGCATCTGCTAGGAAAGGAAAACCCCCCTATAAGATATATTGGGTTTAACGTTTGATGAATATCTGACACCTAACTGCTGCATGAAGACAGAATAAAGAGAAACAGACGCTGAGAGAGGGATAGTGAATATAAACTTGATTATTTCAGAAATGATGCAGAATATATAATTGATTGTATTTAGAAAGTTTCTTACTTCAGTATGAGGAAGCTTATATTACATTTTCATGTTCGCAATAGTTCCCCTTTAACTAACTACAGAGTGGTTTTTAGGTACCGGTAGGCCTAGAGCAAATATTTAATTGGTTGTCTCCCACTTCCCCAAAACATTTATGATAGAACAACT
  3   1   2       add Neu7                                 XL001k19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGTTAGATTCNATATATCTTGTANGGGGGCTCCTTTTGCCTAGTTGNATATATTAGAGCTCATTTTATTAANATCACCAGACATCATGTCTCTCTACATGCAGGATTTGTCCAAAGTTTATTTTGTACTGGAATTGGTTATTTGAGTGAGCTCTAATACATCTACTAGGAAAGGAGCCCCCCTGTAAGATATATTGGATCTAACTGTCAATGAATATCTGACACCCAACTCCTGAATGAAGACAGAATGAAGAGAAACAGATGCTGAGAGAGGGATAGTGAAGATAAACTTGATTATTTCAGAAACGATGCAGAATATTTAATTGTATTTAG
  3  -1   0       chi Ga15      in                       XL512a08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCTGAAACATTGAACAGAAAAAAGTGTTTGTAAGGTGAACAACCCCTTTAAATCCCTAGAAATCCTGTCTCTCTACATGTAGAATTTGTTCAAAAGGCAGTTATTTTGTTTGTACTGGAATCAGTTATTTGAGTGAGCTCTAATGCATCTGCTAGGAAAGGAAAACCCCCCTATAAGATATATTGGGTTTAACGTTTGATGAATATCTGACACCTAACTGCTGCATGAAGACAGAATAAAGAGAAACAGACGCTGAGAGAGGGATAGTGAATATAAACTTGATTATTTCAGAAATGATGCAGAATATATAATTGATTGTATTTAGAAAGTTTCTTACTTCAGTATGAGGAAGCTTATATTACATTTTCATGTTCGCAATAGTTCCCCTTTAACTAACTACAGAGTGGTTTTTAGGTACCGGTAGGCCTAGAGCAAATATTTAATTGGTTGTCTCCCACTTCCCCAAAACATTTATGATAGAACAACT
  3   1   2       bld Ga18      in                      xlk156h08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CNNNNGTCNGCCNNNNNGTCCGCCCNNNNTCCGCCCACGCGTCCGGGGAAGGGAGNCCCCCCGTAGGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAGCTGCTGCATGGGGGGGGAGTGAGGAGAGACAGATGCTGGGAGAGGGATGGTGAACATGGACTTGATTGTTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACNGNNCAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAGTTTGGCCAAATTTGTCACATTATTAAGATCAGTAATGTAAGCATTACAAAATAGAAATCACTGAAGTCCGTTCCATTTTTGTGNA
  5   1   2       add Ga18      in                      xlk156h08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGGGAGGNCCCCCGTAGATATATTGAATCTAACTGTCAATGACTATCTGACACCCAGCTGCTGCATggggggggAGTGAGGAGAGACAGATGCTGGGAGAGGGATGGTGAACATGGACTTGATTGTTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCTNACAATTGGATGGTGGCATTGCCNNTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCtttttttttattttttAAAGAAACCAGTTTTGTTTAACAGTTGAGGNCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAGTTTGGNCAAATTTGTCACATTATTAAGATCAGTAATGTAAGCATTACAAAATAGAAATCACTGAAGTCCGNTCCATTTTTGTGCATGTATTATATAGTGTTTGGGGNGGNTTGAAATNNNNA
  5   1   2      skin Egg1                               PBX0071D04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCACGAGGGACACCCGGCTGCTGCATGGGGAGAGAATGGGGAGAAACAGATGCTGAGAGGGGGATGGTGAACATAGACTTGATTATTTTAGAAACAATGATTGTATTTAGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCtttttttttattttttAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAATAATAGCGCCAGTTTGGCCAAATTTGTCACATTATTA
  5   1   2       bld Ga15      in                       XL453n19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCTGCTGCGtggggagggaatggggagaggcggatgctgggagggggatggTGAACATGGACTTGATTGTTTTAGAAACAATGATTGTATTTGGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCtttttttttattttttAAAGAAACCAGTTATGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAGTTTGGCCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL453n19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCTGCTGCGTGGGGAGGGAATGGGGAGAGGCGGATGCTGGGAGGGGGATGGTGAACATGGACTTGATTGTTTTAGAAACAATGATTGTATTTGGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCAAACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTATGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCCTTGTGCAACTGAAANCAATG
  3   1   2       add Ga12                                 XL150g14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGNTGGGAGAGGGATGGTGAACATGAACTTGATTATTTTAGAAACAATGATTGTATTTGGAAAGTTTCTTGCATCAGTATGAGGAAGCTTATATATTAAATTTTCGCNAACGTTCTCTACACTGGTGGTGGTTTCACTGTNCTGGCACCAAGCCTTCATTTTATGGGTCATCCTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTNAGGCAGGGTTTNATATGTGNCCNTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTANAGAAACCNG
  3   1   2       bld Gas6      in                    IMAGE:3438386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCATCAGTATGAGGAGGCTTGTATATTGAATTTTCGCANACGTTCTCTACACTGGTGGTGGTTTCACTGTGCTGGCACCAAGCCTTCATTTTATGGGTCATACTGGGCACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTTTTTTTTATTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCCAGTTTGGCCAAATTTGTCACATTATTAAGATCAAGTAATGTAAGCATTACAAAATAGAAATCACTGAAGTCCGTTCCATTTTTGTGCATGTATTATATAGTGTTTGGGGTGTTTTTTTTTTATTTATTTTTTTAAGCAGCTGACCAGCTATGCTACCTACTGATTGGTTGGTATGGGTTATGAGACCAGTAGCTAACGAGACCATTTACTACATAAACCCAATAGTCAGGCGATGTAGAGCAAAGGCTGGCACAAATCTGACAAATCTCCGTAAAAAAAGAATGCAGCTTAAAAATGTTTTATTATCAATATTGTATAAAGAATAAAAACAA
  5   1   2       bld Ga15      in                       XL436h16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACAGCCCTCACAATTGGATGGTGGCATTGCCACTCTGTGAGGCAGGGTTTTATATGTGTCCTTAGCCAGAGCTCTGTAATTTATATAAATCTTAttttttattttttAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTACAAACAGACTACAAGTTAATGCCATCTGTTACCTTGTGCAACTGAAACAATGTGTATATATACAGACAATAAGAATAAAGCGCCAGTTTGGCCAAATTTGTCACATTATTAAGATCAGTAATGTAAGCATTACAAAATAGAAATCACTGAAGTCCGTTCCATTTTTGTGCATGTATTATATAGTGTTTGGGGTGtttttttttttatttttttttttAANCANCNGACCANCTANGCTACCTACNGATNGGNNGGNANGGTTATGAAACCAGNANCTAACGAAACCNTTTACTACNTAANCCCAA
  3   1   0       add Ga15      in                       XL436h16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGGGTTTGGGGGGNTTTTTTTTTTATTTTTTTTTTTAAGCAGCTGACCAGCTATGCTACCTACTGATTGGTTGGTATGGTTATGAGACCAGTAGCTAACGAGACCATTTACTACATAAACCCACTAGTCCACGGCGACGTACAGCAAAGGCTGGCACAAATCTGACAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)