Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012838360 Xl3.1-IMAGE:5515365.5.5 - 50 ESTs
                                                                       ........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:5515365.5.5                                       CCGAGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCGGACAGAATACTGGACATGGGATTTGCAGACACAATGAACGCAATCATAGAGAATCTCCCTAAGAAACGCCAGACTCTCCTCTTCTCTGCAACACAGACAAAATCTGTCAAGGATCTTGCGCGCCTCAGCTTAAAAGACCCCGAGTATGTGTGGGTGCACGAGAAAGCCAAATTCAGCACCCCTGCCACCCTGGAACAGAACTATATTGTCTGTGAGCTACAACAAAAAATAAACTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGGCATTCCGGTACTGGTTCTGCATGGCAAGCAGCAGCAAACTAAGAGAATGGAGGTTTACAATGACTTTATACGGAAGAAATCTGCGGTGCTGTTTGCTACAGACATTGCAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGCCCTGAAGATGCCAATACATACATTCACAGAGTCGGAAGAACAGCCCGATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTATTGCCCTCTGAAGTGAAAGGAATGGCCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGGCCCAGGAGCAAGACTTAAAGGAGACAGCACAAAGGTGCTTTGTCTCCTACCTGCGCTCCGTCTATTTGATGAAGAACAAGGAGGTTTTCGATGTTTTCAAGTTGCCCCTCACGCCGTACGCCCAGTCCTTAGGCCTTGCAGTTGCTCCACGGGTTAGGTTCCTCCTCAAAGCTCAGGCAACATCTGCAAGCAAAGAAGACCCTGGCACTACAAGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGGAAGAGGATGAAGCCGTGGCTTACCTTGACCGTGACGGTAGTGAAGATGAGCTTGACATCAGTGCTCTTCCTGATCCTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCATGAAGAAGAGCGCCCAAAGAAGAGACCATACCCAAGCCTTGCTGGAAACCAAGCTGAAAAGTCTGTAGGCATTAAAAAGAAGAGGGTAAAACAGAACTCCGAGGAGGACTTTGAGCCTCTTAACACTGGACTTTCTCTGGCAGAGGATGAGGAGCTTGTGCTGCACCTGCTAAGCAACAACTGATTGTCTATGTTCTAAATCACCTTCATTGATGCCACAGCTCTTTCCATATAATATATATATTAAGNCTATTTCCTGTTCAATATGTCATATCTAAAATAAATAGTCAGTAATAGCTCTGTATCCTCCATAATGTGATATGAGACAACAATAGAAGGGCAACAATAGAAGAAGGATGGATTTTGTAGAGTTAATAAGGATGGATTTTGTAGAGTTAATAGCCATTGGCATTGTCAGGCCGATATTATAGAGCCATTGCTGCATCACTTGGCCTTGTACATTGCTGCATCACCAAATTCCATTCTGAGGCTGCTGAAATGTGCCTTAGGATTTGTTATACAAATGTGCCTTAGGATTTGTTATAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTTGAAGTTCATTATCAGCATTTTCTCCATGCAATTAAAAAGA
                                                  Xl3.1-CHK-1012721528                                             CAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCGGACAGAATACTGGACATGGGATTTGCAGACACAATGAACGCAATCATAGAGAATCTCCCTAAGAAACGCCAGACTCTCCTCTTCTCTGCAACACAGACAAAATCTGTCAAGGATCTTGCGCGCCTCAGCTTAAAAGACCCCGAGTATGTGTGGGTGCACGAGAAAGCCAAATTCAGCACCCCTGCCACCCTGGAACAGAACTATATTGTCTGTGAGCTACAACAAAAAATAAACTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGGCATTCCGGTACTGGTTCTGCATGGCAAGCAGCAGCAAACTAAGAGAATGGAGGTTTACAATGACTTTATACGGAAGAAATCTGCGGTGCTGTTTGCTACAGACATTGCAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGCCCTGAAGATGCCAATACATACATTCACAGAGTCGGAAGAACAGCCCGATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTATTGCCCTCTGAAGTGAAAGGAATGGCCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGGCCCAGGAGCAAGACTTAAAGGAGACAGCACAAAGGTGCTTTGTCTCCTACCTGCGCTCCGTCTATTTGATGAAGAACAAGGAGGTTTTCGATGTTTTCAAGTTGCCCCTCACGCCGTACGCCCAGTCCTTAGGCCTTGCAGTTGCTCCACGGGTTAGGTTCCTCCTCAAAGCTCAGGCAACATCTGCAAGCAAAGAAGACCCTGGCACTACAAGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGGAAGAGGATGAAGCCGTGGCTTACCTTGACCGTGACGGTAGTGAAGATGAGCTTGACATCAGTGCTCTTCCTGATCCTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCATGAAGAAGAGCGCCCAAAGAAGAGACCATACCCAAGCCTTGCTGGAAACCAAGCTGAAAAGTCTGTAGGCATTAAAAAGAAGAGGGTAAAACAGAACTCCGAGGAGGACTTTGAGCCTCTTAACACTGGACTTTCTCTGGCAGAGGATGAGGAGCTTGTGCTGCACCTGCTAAGCAACAACTGATTGTCTATGTTCTAAATCACCTTCATTGATGCCACAGCTCTTTCCATATAATATATATATxAxxAxTATTTCCTGTTCAATATGTCATATCTAAAATAAATAGTCAGTAATAGCTCTGTATCCTCCATAATGTGATATGAGACAACAATAGAAGGGCAACAATAGAAGAAGGATGGATTTTGTAGAGTTAATxAxxxxGGATTTTGTAGAGTTAATxxxCxxTGGCATTGTCAGGCCGATATTATAxxGxxATTGxxxCATCACTTGGCCxxxxxCATTGCTxxxTxxCCAAATxxxATxCTGAGGxxGxxxAAATGTGCCTTAGGATTTGTTATAxxxxxGTGCCTTAGGATTTxxxxTAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTTGAAGTTCATTATCAGCATTTTCTCCATGCAATTA
                                                      consensus depths                                            6     9     7     9     8    10     8    10     8    10     8    10     8    11     8    11     8    11     8    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11    10    11    11    11    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    12    11    12    10    11    10    11    10    11    10    11    10    11    10    11    10    12    11    13    10    12     9    12     9    12     8    11     8    10     6     8     5     8     6     7     4     5     4     5     4     5     4     5     4     5     4     5     4     6     4     6     4     6     5     6     5     6     5     7     5     7     5     7     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     5     5     5     5     4     5     4     4     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     5     5     5     5     4     4     4     4     3     4     3     4     3     4     3     3     3     3     4     4     4     4     4     4     4     4     5     6     5     6     5     6     5     6     5     6     5     6     8     8     7     8     9     9     8     9    10    10    10    10     9    10    10    10     9    10    10    10    10    10     9    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    11    11    11    11    11    11    12    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    13    11    13     9    12     9    11     9    10     8     9     7     8     7     8     8     9     7     8     7     8     7     8     5     8     5     8     6     8     6     8     7     9     7     9     7     9     7     9     7     9     7     9     7     9     6     7     6     7     6     6     4     5     4     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     5     6     4     6     4     6     5     6     5     7     4     7     5     7     5     7     3     8     3     8     3     6     3     6     3     6     3     6     3     6     3     6     3     6     4     8     3     8     3     9     4     9     4     9     5    11     5    11     5    11     6    13     6    13     5    13     7    15     5    15     6    14     6    14     5    14     5    14     9    16     8    16     8    16    10    16    10    16    10    16    10    16    10    16    10    16    10    16    10    16    10    15    10    15    14    15    15    15    15    15    15    15    15    15    15    15    14    15    15    15    14    15    15    15    15    15    15    15    14    15    14    15    14    15    14    14    13    13    13    13    13    13    13    13    14    14    12    14    13    14    12    14     8    14     6    10     4     7     4     5
  5   1   2      ests                            Xl3.1-IMAGE:5515365.5                         TGATCATGGCGGAACCGAGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCGGACAGAATACTGGACATGGGATTTGCAGACACAATGAACGCAATCATAGAGAATCTCCCTAAGAAACGCCAGACTCTCCTCTTCTCTGCAACACAGACAAAATCTGTCAAGGATCTTGCGCGCCTCAGCTTAAAAGACCCCGAGTATGTGTGGGTGCACGAGAAAGCCAAATTCAGCACCCCTGCCACCCTGGAACAGAACTATATTGTCTGTGAGCTACAACAAAAAATAAACTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGGCATTCCGGTACTGGTTCTGCATGGCAAGCAGCAGCAAACTAAGAGAATGGAGGTTTACAATGACTTTATACGGAAGAAATCTGCGGTGCTGTTTGCTACAGACATTGCAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGCCCTGAAGATGCCAATACATACATTCACAGAGTCGGAAGAACAGCCCGATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTATTGCCCTCTGAAGTGAAAGGAATGGCCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGGCCCAGGAGCAAGACTTAAAGGAGACAGCACAAAGGTGCTTTGTCTCCTACCTGCGCTCCGTCTATTTGATGAAGAACAAGGAGGTTTTCGATGTTTTCAAGTTGCCCCTCACGCCGTACGCCCAGTCCTTAGGCCTTGCAGTTGCTCCACGGGTTAGGTTCCTCCTCAAAGCTCAGGCAACATCTGCAAGCAAAGAAGACCCTGGCACTACAAGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGGAAGAGGATGAAGCCGTGGCTTACCTTGACCGTGACGGTAGTGAAGATGAGCTTGACATCAGTGCTCTTCCTGATCCTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCATGAAGAAGAGCGCCCAAAGAAGAGACCATACCCAAGCCTTGCTGGAAACCAAGCTGAAAAGTCTGTAGGCATTAAAAAGAAGAGGGTAAAACAGAACTCCGAGGAGGACTTTGAGCCTCTTAACACTGGACTTTCTCTGGCAGAGGATGAGGAGCTTGTGCTGCACCTGCTAAGCAACAACTGATTGTCTATGTTCTAAATCACCTTCATTGATGCCACAGCTCTTTCCATATAATATATATATAATAAGGCTATCCTGTTCAATATGTCATATCTAAAATAAATAGTCAGTAATAGCTCTGTATCCTCAATAATGTGATATGAGACAACAATAGAAGGGCAACAATAGA
  5   1   2      ests                               Xl3.1-xlk74n23ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGTCAGTAATAGCTCTGTATCCTCCATATTGTGATAATAGAAGAAGGTAGAAGGGCAACAATAGAAGAAGGATGGATTTTGTAGAGTTAATGAACTACAAGTGACGTGTCCCGCTCAGCCATTGGGATTGTCAGGCCGATATTATAGAGCCATTGGCTGCTGTCCAAGCCTTATACTGACAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCTGTGCCTTAGGATCTTGGGTAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTTGAAGTTCATTATCAGCATCTTCTCCATGCAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAACAATAGAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAACTACAAGTGACGTGTCCGCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAACTACAAGTGACGTGTCCCGCTCAGCCATTGGGATTGTCAGGCCGATATTATAGAGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGGCTGCTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGGCCTTATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTTCAGGGTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCAAATTCCATTTCTTCAGGGTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGTCTTGGGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGCAGAACAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAAAAAAAAATGAGATCAAAACCGCACATTATGTTATGTAGCAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAACTATTTGGAATTCTATTC
                                                                   SNP                                                                                                                                                                                                   --A---------
                                                                   SNP                                                                                                                                                                                                               ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                               -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                   -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----A-----G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------A--G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -C----------
                                               BLH ATG       5     516                                       
                                               BLH OVR       5      43                                       
                                               EST CLI       5      28                                       
                                               ORF LNG       5      12                                       
  5   1   2      ests                            Xl3.1-IMAGE:5515365.5                         TGATCATGGCGGAACCGAGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCGGACAGAATACTGGACATGGGATTTGCAGACACAATGAACGCAATCATAGAGAATCTCCCTAAGAAACGCCAGACTCTCCTCTTCTCTGCAACACAGACAAAATCTGTCAAGGATCTTGCGCGCCTCAGCTTAAAAGACCCCGAGTATGTGTGGGTGCACGAGAAAGCCAAATTCAGCACCCCTGCCACCCTGGAACAGAACTATATTGTCTGTGAGCTACAACAAAAAATAAACTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGGCATTCCGGTACTGGTTCTGCATGGCAAGCAGCAGCAAACTAAGAGAATGGAGGTTTACAATGACTTTATACGGAAGAAATCTGCGGTGCTGTTTGCTACAGACATTGCAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGCCCTGAAGATGCCAATACATACATTCACAGAGTCGGAAGAACAGCCCGATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTATTGCCCTCTGAAGTGAAAGGAATGGCCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGGCCCAGGAGCAAGACTTAAAGGAGACAGCACAAAGGTGCTTTGTCTCCTACCTGCGCTCCGTCTATTTGATGAAGAACAAGGAGGTTTTCGATGTTTTCAAGTTGCCCCTCACGCCGTACGCCCAGTCCTTAGGCCTTGCAGTTGCTCCACGGGTTAGGTTCCTCCTCAAAGCTCAGGCAACATCTGCAAGCAAAGAAGACCCTGGCACTACAAGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGGAAGAGGATGAAGCCGTGGCTTACCTTGACCGTGACGGTAGTGAAGATGAGCTTGACATCAGTGCTCTTCCTGATCCTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCATGAAGAAGAGCGCCCAAAGAAGAGACCATACCCAAGCCTTGCTGGAAACCAAGCTGAAAAGTCTGTAGGCATTAAAAAGAAGAGGGTAAAACAGAACTCCGAGGAGGACTTTGAGCCTCTTAACACTGGACTTTCTCTGGCAGAGGATGAGGAGCTTGTGCTGCACCTGCTAAGCAACAACTGATTGTCTATGTTCTAAATCACCTTCATTGATGCCACAGCTCTTTCCATATAATATATATATAATAAGGCTATCCTGTTCAATATGTCATATCTAAAATAAATAGTCAGTAATAGCTCTGTATCCTCAATAATGTGATATGAGACAACAATAGAAGGGCAACAATAGA
                                                  Xl3.1-CHK-1012687686                               AGGCGGAACCGAGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCGGACAGAATACTGGACATGGGATTTGCAGACACAATGAACGCAATCATAGAGAATCTCCCTAAGAAACGCCAGACTCTCCTCTTCTCTGCAACACAGACAAAATCTGTCAAGGATCTTGCGCGCCTCAGCTTAAAAGACCCCGAGTATGTGTGGGTGCACGAGAAAGCCAAATTCAGCACCCCTGCCACCCTGGAACAGAACTATATTGTCTGTGAGCTACAACAAAAAATAAACTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGGCATTCCGGTACTGGTTCTGCATGGCAAGCAGCAGCAAACTAAGAGAATGGAGGTTTACAATGACTTTATACGGAAGAAATCTGCGGTGCTGTTTGCTACAGACATTGCAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGCCCTGAAGATGCCAATACATACATTCACAGAGTCGGAAGAACAGCCCGATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTATTGCCCTCTGAAGTGAAAGGAATGGCCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGGCCCAGGAGCAAGACTTAAAGGAGACAGCACAAAGGTGCTTTGTCTCCTACCTGCGCTCCGTCTATTTGATGAAGAACAAGGAGGTTTTCGATGTTTTCAAGTTGCCCCTCACGCCGTACGCCCAGTCCTTAGGCCTTGCAGTTGCTCCACGGGTTAGGTTCCTCCTCAAAGCTCAGGCAACATCTGCAAGCAAAGAAGACCCTGGCACTACAAGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGGAAGAGGATGAAGCCGTGGCTTACCTTGACCGTGACGGTAGTGAAGATGAGCTTGACATCAGTGCTCTTCCTGATCCTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCATGAAGAAGAGCGCCCAAAGAAGAGACCATACCCAAGCCTTGCTGGAAACCAAGCTGAAAAGTCTGTAGGCATTAAAAAGAAGAGGGTAAAACAGAACTCCGAGGAGGACTTTGAGCCTCTTAACACTGGACTTTCTCTGGCAGAGGATGAGGAGCTTGTGCTGCACCTGCTAAGCAACAACTGATTGTCTATGTTCTAAATCACCTTCATTGATGCCACAGCTCTTTCCATATAATATATATATAATAAGGCTATxxxxTTCAATATGTCATATCTAAAATAAATAGTCAGTAATAGCTCTGTATCCTCAATAATGTGATATGAGACAACAATAGAAGGGCAACAATAGAAGAAGG
  5   1   2       bld Ga18                                xlk7b14ex.5p GNCAGAAACAAGACCTTGCTGGGGANTGATCATGGCGGAACCGAGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAANNNNACAGGAAGCAGAACAAGAAGCCCGAGTGGNAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAATACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGNTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAACGTTTGAGGNTCTGAGGAAAGNTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGNATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTNCAACACATGGATGAAACGNCTTTCTTTCATGCATCTAATCNTNCATATGCTGGTNNTTGATGAAGCGGACAGAATACTGGACATGGGATTTNCAGACACAATGAACGCA
  5   1   2       bld Ov1                             IMAGE:8331431.5p   GAAACAAGACCTTGCTGGGGACTGATCATGGCGGAACCGAGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGNCACACATGGATGAAACGTCTTTCT
  5   1   2       bld Emb4                            IMAGE:5515365.5p                         TGATCATGGCGGACCCTTGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCACGTACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAAACCATCAACCGGCTGGAGGGGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGGTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAACTGGCGTATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCGGACAGAATACTGGACATGGGATTTGCAGACACAATGAACGCAATCATAGAGAAT
  5   1   2       bld Ga12      in                         XL189g14.5p                              GAGGCGGAACCGAGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGACAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCAGACAGAATACTGG
  5   1   2       bld Ga12      in                         XL218h01.5p                               AGGCGGAACCGAGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGACAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTA
  5   1   2       bld Emb4                            IMAGE:5514091.5p                                 GCGGAACCGAGCCACATAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATTGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACATCAGACGATGGACTTGGGGTCCTGATCATATCGCCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATATTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCAGACAGAATACTGGACATGGGATTTGCAGNACACATGAAACGCATCATAGAGAATCTCCCTAN
  5   1   2       bld DMZ       in                         xl338f18.5p                                 GCGGAACCGAGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAAACCATCAACCGGCTGGAGGGGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGGTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAACTGGCGTATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCGGACAGAATACTGGACATG
  5   1   2       bld DMZ       in                         xl333k07.5p                                  CGGAACCGAGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAAACCATCAACCGGCTGGAGGGGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGGTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAACTGGCGTATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCGGACAGAATACTGGACATGG
  5   1   2       bld Ga18      in                      xlk157k17ex.5p                                     CGNNCCNAGCCAGAAAGAGACCAAGAAGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCACAGGAAGCAGAACAAGAAGCCCGAGTGGNAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAATACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATAGGCTTGGCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGNCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTNCTTGATGAAGCGGACAGAATACTGGACATGGGATTTGCAGACACAATGAACGCAATCATAGAGAATCTCCCTNAGAAACGCCAGANTCTCCTCTTCTCTGCAACACAGACAAAATCTGTCAAGNATCTTGCGCNCCTCAGNTTAAAAGANCCCGAGNATGTNTGGGTNCNCGAGAAAGCCAAATTCAGCACCCCTGCCACCCTGGANNAGNACTATATTNNCTGTGAGCTANNCAAAAANAAACTTGCTCTATTCTTTNTAC
  5   1   2       bld Tbd7      in                         XL109m05.5p                                                             AGAAGCCGCTGATCAACAGCAGGAACGACCCCGTGAAGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGGAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATTGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACATCAGACGATGGACTTGGGGTCCTGATCATATCGCCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATATTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCAGACAG
  5   1   2       bld Tbd7      in                         XL072b08.5p                                                                                                            GNAAGAAGNAAATACAGCAAGNAAGNAAGGATAAGTGCAAGGCCCACAGGNAAGCAGAACAAGAAGCCCGAGTGGCAGGTGGAGAAGGAGACCATCAACCGGCTGGAGGAGCGATACTCGGAGATCAACACCAGCGAAATTGAGAGATTCTCAGATTTTCCTTTGTCCAAAAAGACCCTGAGAGGTTTGGTGGAAGCCCAGTACCGCTTACCTACAGAGATCCAGAAACAGACAATTGGCTTGGCCTTACAGGGGAAGGATGTTCTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTT
  5   1   2       bld DMZ       in                         xl284f06.5p                                                                                                                                                                                                                                                                                                                                                                                    CTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCAGACAGAATACTGGACATGGGATTTGCAGACACAATGAACGCAATCATAGAGAATCTCCCTAAGAAACGCCAGACTCTCCTCTTCTCTGCAACACAGACAAAATCTGTCAAGGATCTTGCGCGCCTCAGCTTAAAAGACCCCGAGTATGTGTGGGTGCACGAGAAAGCCAAATTCAGCACCCCTGCCACCCTGGAACAGAACTATATTGTCTGTGAGCTACAACAAAAAATAAACTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGGCATTCCGGTACTGGTTCTGCATGGCAAGCAGCAGC
  5   1   2       bld DMZ       in                         xl329l06.5p                                                                                                                                                                                                                                                                                                                                                                                    CTTGGTGCTGCCAAAACTGGTTCTGGGAAAACCCTGGCCTTCATTATTCCAGCTTTGGAATGTTTGTACCGCCAGCAGTGGACGTCCGACGATGGACTTGGGGTCCTGATCATATCACCCACTCGAGAGCTGGCATATCAAACGTTTGAGGTTCTGAGGAAAGTTGGGCGGAACCATGAATTCTCAGCTGGGCTTGTCATTGGTGGAAAGGATTTAAAGCAAGAGACAGCGTGCATCCACAGGACAAACATACTGATTTGTACCCCTGGACGGCTCTTGCAACACATGGATGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCAGACAGAATACTGGACATGGGATTTGCAGACACAATGAACGCAATCATAGAGAATCTCCCTAAGAAACGCCAGACTCTCCTCTTCTCTGCAACACAGACAAAATCTGTCAAGGATCTTGCGCGCCTCAGCTTAAAAGACCCCGAGTATGTGTGGGTGCACGAGAAAGCCAAATTCAGCACCCCTGCCACCCTGGAACAGAACTATATTGTCTGTGAGCTACAACAAAAAATAAACTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGGCATTCCGGTACTGGTTCTGCATGGCAAGCAGCAGCAA
  5   1   2       bld Neu7      in                         XL047f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTTGCAACACATGGNTGAAACGTCTTTCTTTCATGCATCTAATCTTCATATGCTGGTGCTTGATGAAGCGGACAGAATACTGGACATGGGATTTGCAGACACAATGAACGCAATCATAGAGAATCTCCCTAAGAAACGCCAGACTCTCCTCTTCTCTGCAACACAGACAAAATCTGTCAAGGATCTTGCGCGCCTCAGCTTAAAAGACCCCGCGTATGTGTGGGTGCATGAGAAAGCCAAATTCAGCACCCCTGCCACCCTGGAACAGAACTATATTGTCTGTGAGCTACAACAAAAAATAAACTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGGCATTCCGGTACTGGTTCTGCGTGGCAAGCAGCAGCAAACTAAGAGAATGGAGGTTTACAATGACTTTATACGGAAGAAATCTGCGGTGCTGTTTGCTACAGACATTGCAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGCCCTG
  5   1   2       bld Gas6      in                    IMAGE:3474192.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAACTTCGAGAAGTGGAAGAAGAAATACAGCAAGAAGAAGGATAAGTGCAAGGCCCACAGAATACTGGACATGGGATTTGCAGACACAATGAACGCAATCATAGAGAATCTCCCTAAGAAACGCCAGACTCTCCTCTTCTCTGCAACACAGACAAAATCTGTCAAGGATCTTGCGCGTCTCAGCTTAAAAGACCCCGAGTATGTGTGGGTGCACGAGAAAGCCAAATTCAGCACCCCTGCCACCCTGGAACAGAACTATATTGTCTGTGAGCTACAACaaaaaaataaaaCTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGNCATTCCGGTACTGGTTCTGCATGGCAAGCAGCAGCAAACTAAGAGAATGGAGGTTTACAATGACTTTATACGGAAGAAATCTGCGGTGCTGTTTGCTACAGACATTGCAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGCCCTGAAGATGCCAATACATACATTCACAGAGTCGGAAGAACAGCCCGATACA
  5   1   2       bld Neu7      in                         XL022c02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTCAGCTTAAAAGACCCCGCGTATGTGTGGGTGCATGAGAAAGCCAAATTCAGCACCCCTGCCACCCTGGAACAGAACTATATTGTCTGTGAGCTACAACAAAAAATAAACTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGGCATTCCGGTACTGGTTCTGCATGGCAAGCAGCAGCAAACTAAGAGAATGGAGGTTTACAATGACTTTATACGGAAGAAATCTGCGGTGCTGTTTGCTACAGACATTGCAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGCCCTGAAGATGCCAATACATACATTCACAGAGTCGGAAGAACAGCCCGATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTATTGCCCTCTGAAGTGAAAGGAATGGCCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGGCCCAGGAGCAAGACTTAAAGGAGACAGCACAAAGGTGCTTTGTCTCCTACCTGCGC
  5   1   2       bld Neu7      in                         XL020a05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCACCCCTGCCACCCTGGAACAGAACTATATTGTCTGTGAGCTACAACAAAAAATAAACTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGGCATTCCGGTACTGGTTCTGCATGGCAAGCAGCAGCAAACTAAGAGAATGGAGGTTTACAATGACTTTATACGGAAGAAATCTGCGGTGCTGTTTGCTACAGACATTGCAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGCCCTGAAGATGCCAATACATACATTCACAGAGTCGGAAGAACAGCCCGATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTATTGCCCTCTGAAGTGAAAGGAATGGCCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGG
  5   1   2       bld Neu7      in                         XL015i01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTACAACAAAAAATAAACTTGCTCTATTCTTTTATACGAAACCACCTGAAGAAGAAGAGCATTGTTTTCTTTTCAAGCTGCAAGGAGGTGCAGTACTTGTTCCGTGCGTTCTGCAGGCTGCGCCCTGGCATTCCGGTACTGGTTCTGCATGGCAAGCAGCAGCAAACTAAGAGAATGGAGGTTTACAATGACTTTATACGGAAGAAATCTGCGGTGCTGTTTGCTACAGACATTGCAGCCAGAGGGTTAGATTTCCCAGCCGTCAGCTGGGTGCTTCAGCTCGATTGCCCTGAAGATGCCAATACATACATTCACAGAGTCGGAAGAACAGCCCGATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTATTGCCCTCTGAAGTGAAAGGAATGGCCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGGCCCAGGAGCAAGACTTAAAGGAGACAGCACAAAGGTGCTTTGTCTCCTACCTGCGCTCCGTCTATTTGATGAAGAACAAGGAGGTTTTTCGATGTTTTCAAGTTGCCCCTCACGCCGTACGCC
  3   1   2       bld Ga18      in                      xlk157k17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GNTTACNATGNCTTNNNNCGNANNAAATCTNNNNGCTNTTTGCTACAGACATTNNANCAGANGGTTAGNTTTNCCAGCCGTCAGCTGGGTGCTTCAGCTCGACTGNCTGAAGATGCCAATACATACATTCACAGAGTCGGAANNACANCCCGATACAAGGAAGGAGGAGAANCCCTGCTTGTTCTATTGCCCTCTGAAGTGAAAGGAATGNNCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGGCCCAGGAGCAAGACTTAAAGGAGACAGCACAAAGGTGCTTTGTCTCCTACCTGCGCTCCGTCTATTTGATGAAGAACAAGGAGGTTTTCGATGTTTTCAAGTTGCCCCTCACNCCGTACGCCCAGTCCTTAGNCCTTGCAGTTGCTCCACGGGTTAGGTTCCTCCTCAAAGCTCAGGCAACATCTGCAAGCAAAGAAGACCCTGGCACTACAAGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCAGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAATGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTANNAAAGNCAAAAGANNNNCTGNCCGAGGAGGA
  5   1   2       bld DMZ       in                         xl321m08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTATTGCCCTCTGAAGTGAAAGGAATGGCCAAGCAACTAGAGGAAAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAGAAGCTGTTGGACGTGCAGGGCCGTTTGGAAGCTTTCTTGGCCCAGGAGCAAGACTTAAAGGAGACAGCACAAAGGTGCTTTGTCTCCTACCTGCGCTCCGTCTATTTGATGAAGAACAAGGAGGTTTTCGATGTTTTCAAGTTGCCCCTCACGCCGTACGCCCAGTCCTTAGGCCTTGCAGTTGCTCCACGGGTTAGGTTCCTCCTCAAAGCTCAGGCAACATCTGCAAGCAAAGAAGACCCTGGCACTACAAGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCA
  3   1   2       bld Gas6      in                    IMAGE:3474192.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGTGCTTTGTCTCCTCCTGGCGCTCCGTCTATTTGATGAAGAACAAGGAGGTTTTCGATGTTTTCAAGTTGCCCCTCACGCCGTACGCCCAGTCCTTAGGCCTTGCAGTTGCTCCACGGGTTAGGTTCCTCCTCAAAGCTCAGGCAACATCTGCAAGCAAAGAAGACCCTGGCACTACAAGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATTGGGGCCCGAATGACGGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGG
  5   1   2       bld Tbd7      in                         XL074k22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTTGCAGTTGCTCCACGGGTTAGGTTCCTCCTCAAAGCACAGGCAACATCTGCGAGCAAAGAAGACCCTGGCACTTCCAGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGAAACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCTAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGAC
  5   1   2       bld Neu7      in                         XL032g23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACATCTGCAAGCAAAGAAGACCCTGGCACTACAAGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCANGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAG
  3   1   2       bld Ga12      in                         XL218h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAAGCAAAAGAAGACCNTGGCATTACAAGTGATCAAGAAATAGAAGCGTTCAAGTCAAAGCTTGGTGGTAAGGGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCNTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGAAGAAAAGAACCCTGCTGATCCTTGTAGGACCCCTCCCCATTTATTTACCGAAGCCAGAGAGGCTTCAGGTCAGATGAGGAGGTGGTGCTCCGCTGCCAATGGGAAAATATCACGTATTACGCTTAATTGCTAAGCCGGCTGTATTGTGCGCACAAAGC
  3   1   2       bld Neu7      in                         XL047f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGAGGATGACCAAAGCAGAGATGATACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCGACCGAGGAGGATAGGTTNACAAAGAAGCT
  3   1   2       bld Neu4                            IMAGE:3557989.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGAGGATGACCAAAGCAGAGTTGATTCTGNCAAAGTAAATTCTTCAACGGAAGAGAGTGTCCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAAAAAACTAAGAAAGTCCTCCACAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCATTTAACTACAGTGAATGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGGCCTAGGAGGATAGGTTTGACAAAAAAGCTTACAGGACAAAAAAAA
  5   1   2       bld DMZ       in                         xl310h21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGAAACTGACAAAGTAAATTCTTCAGCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTCTCAGACAGCCTAAAGCAAACCAGTTCGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGGAAGAGGATGAAGCCGTGGCTTACCTTGACCGTGACGGTAGTGAAGATGAGCTTGACATCAGTGCTCTTCCTGATCCTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCA
  3   1   2       bld Ga12      in                         XL189g14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGGAAGAGAGTGATCCAGAAGAGGATGATGAGCAAGAGCTNTCAGACAGCTTAAAGCAAACCAGTTTGCAGTTTATGAATGAGGATGAGGACGACGATGACTGTCGAGATGTTGACATCCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGAAGAAAAGAACCCTGCTGATCCTTGTAGGACCCCTCCCCATTTATTTACCGAAGCCAGAGAGGCTTCAGGTCAGATGAGGAGGTGGTGCTCCGCTGCCAATGGGAAAATATCACGTATTACGCTAATTGCTAAG
  3   1   2      seed DMZ       in                         xl329l06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGACGACGATGACTGTCGAGATGTTGACATNCTCACAGTGAAACGGAGAGATGTTTTTGGCATCGAGGATGGCAGCTTCACACTGGAAAATGAGATGACAAAATCCAAGCTGAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGGAAGAGGATGAAGCCGTGGCTTACCTTGACCGTGACGGTAGTGAAGATGAGCTTGACATCAGTGCTCTTCCTGATCCTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCATGAAGAAGAGCGCCCAAAGAAGAGACCATACCCAAGCCTTGCCGGAAACCAAGCTGAAAAGTCTGTAGGCATTAAAAAGAAGAGGGTAAAACAGAACTCCGAGGAGGACTTTGAGCCTCTTAACACTGGACTTTCTCTGGCAGAGGATGAGGAGCTTGTGCTGCACCTGCTAAGCAACAACTGATTGTCTATGGTCTAAATCACCTTCATTGATGCCACAGCTCTTTCCATATAATATATATATAATAAGGCTATTTCCTGT
  3   1   2       bld DMZ       in                         xl284f06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAAAAAACCGAGAAAGTAACCAAAGCAAAGGAGGCTAAGAAAGTCCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGGAAGAGGATGAAGCCGTGGCTTACCTTGACCGTGACGGTAGTGAAGATGAGCTTGACATCAGTGCTCTTCCTGATCCTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCATGAAGAAGAGCGCCCAAAGAAGAGACCATACCCAAGCCTTGCCGGAAACCAAGCTGAAAAGTCTGTAGGCATTAAAAAGAAGAGGGTAAAACAGAACTCCGAGGAGGACTTTGAGCCTCTTAACACTGGACTTTCTCTGGCAGAGGATGAGGAGCTTGTGCTGCACCTGCTAAGCAACAACTGATTGTCTATGGTCTAAATCACCTTCATTGATGCCACAGCTCTTTCCATATAATATATATATAATAAGGCTATTTCCTGT
  5   1   2       bld Emb4                            IMAGE:4679977.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTGGCCCCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGGAAGAGGATGAAGCCGTGGCTTACCTTGACCGTGACGGTAGTGAAGATGAGCTTGACATCAGTGCTCTTCCTGATCCTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCATGAAGAAGAGCGCCCAAAGAAGAGACCA
  5   1   2       bld Ga18      in                       xlk74n23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATTTCAAGTTAACACCAAAATTGTCTTTGCCGATGATGGAGAGGTGATGCAGCAGTNNNNCAAATGCAGAAAACTACAGTGAACGACACAGAAGAGGAGGATGAATCCAGTGGCATCAATCTAGCAAAGGCAAAAGAGCGCCTGACCGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGAAAAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGGAAGAGGATGAAGCCNNNNNTACCTTGACCGTGACGGTAGNGAAGATGAGCTTGACATCAGTGCTCTTCCTGATCCTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCATGAAGAAGAGCGCCCAAAGAAGAGACCATACCCAAGCCTTGCTGGAAACCAAGCTGAAAAGTCTGTAGGCATTAAAAAGAAGAGGGTAAAACAGAACTCCGAGGAGGACTTTGAGCCTCTTAACACTGGACTTTCTCTGGCAGAGGATGAGGAGCTTGTNCTGCACCTGCTAAGCAACAACTGATTGTCTATGTTCTAAATCACCTTCATTGATGCCACAGCTCTTTCCATATAATATATATNATAAGNCTATTTCCTGTTCAATATGTCATATCTAAAATAAATAGTCAGTAATAGCTCTGTATCCTCCATAATGTGATATGAGACAACAATAGAAGGGCAACAATAGAAGANGGNNGGNATTTTNTAGAGTTAATGAACTACA
  5   1   2       bld Tad1                            IMAGE:6938761.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGAAGAGGCTTAAAGAGAAGGCGGCCAGAAGAGCAGCCAACAAGAAAGAATCCGAGGAAGAGGATGAAGCCGTGGCTTACCTTGACCGTGACGGTAGTGAAGATGAGCTTGACATCAGTGCTCTTCCTGATCCTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCATGAAGAAGAGCGCCCAAAGAAGAGACCATANCNCAAGCCTTGCTGGAAACCAAGCTGAAAAGTNTGTAGGCATTAAAAAGAAGAGGGTAAAACAAAACTCCGAGGAGGACTTTGAGCCTCTTAACACTGGACTTTCTCTGGCAGAGGATGAGGAGCTTGTGCTGCACCTGCTAAGCGACAACTGATTGGCTATGGTCTAAATTTACCCTTCATTGATGCCANAGCCTCTTTCCATATAATATATATAGAAGAGGCTAATTTCCTGTTTCAAAATGTCNCATCCTAAAATAAATAAGTTAAGTAAGTAGCTCCTGTATCCCTCCCATATTTGGTGAGTATGGAGAGCANACAATTAGGAAGGGGGGAACCTATTANNAAGAAAGGGAAGGGGATTTTTTGTAGGAGNTTGTATGGAANCNTACAAGGTGGGCGTTGTTNCCGNNTCCGGCNCATTTGGGNATTTGGNCTATGGGCGCGGATATTTATTAGAAGCCCNATTGGGTGGCAATGCACNTTGTGGCCNTTGTTACNGGAGGGGCTTGCTTGTTCCNAACTTTCNCTTNTTTTNNTNCGGGGTGTCCAAATATGTGGCNCNTTAAGGAATTGTGTTNAAAAAGGCGAGNAAACAACACTTTGTNNCTTTGGGGNTNAAAANAATACGGAGGATTNCACAGACCGGCN
  3   1   2       bld Neu7      in                         XL020a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGATGAGCTTGACATCAGTGCTCTTCCTGATCNTGACAAATACAAAGACATGGAGGAAAGTGATGTTGGATCTGCAGAGGAAAGTGCAAGTGACCATGAAGAAGAGCGCCCAAAGAAGAGACCATACCCAAGCCTTGCTGGAAACCAAGCTGAAAAGTCTGTAGGCATTAAAAAGAAGAGGGTAAAACAGAACTCCGAGGAGGACTTTGAGCCTCTTAACACTGGACTTTCTCTGGCAGAGGATGAGGAGCTTGTGCTGCACCTGCTAAGCAACAACTGATTGTCTATGTTCTAAATCACCTTCATTGATGCCACAGCTCTTTCCATATAATATATATAATAAGGCTATTTCCTGTTCAATATGTCATATCTAAAATAAATAGTCAGTAATAGCTCTGTATCCTCAATAATGTGATATGAGACAACAATAGAAGGGCAACAATAGAAGAAGGATGGATTTTGTAGAGTTAATGAACTACAAGTGACGTGTCCGCTCAGCCATTGGCATTGTCAGGCCGATATTATAGAGCCATTGCTGCATCACTTGGCCTTGTACTGAGGCTGCTGTCCAAATTCCATTTCTTCAGGGTCCNAATGTG
  5   1   2      ests                               Xl3.1-xlk74n23ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGTCAGTAATAGCTCTGTATCCTCCATATTGTGATAATAGAAGAAGGTAGAAGGGCAACAATAGAAGAAGGATGGATTTTGTAGAGTTAATGAACTACAAGTGACGTGTCCCGCTCAGCCATTGGGATTGTCAGGCCGATATTATAGAGCCATTGGCTGCTGTCCAAGCCTTATACTGACAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCTGTGCCTTAGGATCTTGGGTAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTTGAAGTTCATTATCAGCATCTTCTCCATGCAAT
                                                  Xl3.1-CHK-1012691273                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTAATAGCTCTGTATCCTCCATATTGTGATAxxAGAAGAAGGxxGxAxGGCAACAATAGAAGAAGGATGGATTTTGTAGAGTTAATGAACTACAAGTGACGTGTCCCGCTCAGCCATTGGGATTGTCAGGCCGATATTATAGAGCCATTGxxxxxTGTCCAAxxxxxATACTGAxxxxGxCCAAATGTGCCTTAGGATTTGTTATxxxxxTGTGCCTTAGGATxTxxxGTAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTTGAAGTTCATTATCAGCATTTTCTCCATGCAATTAAAAA
  3   1   2       bld Ga18      in                       xlk74n23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGCTGGNAANCCAAGCTGAAAAGTCTGTANGCATTAAAAAGAAGAGGGTAAAACAGANCTCCGAGGAGGNCTTTGANCCTCTTAACNCTGGACTTTNTCTGGCAGAGGATGNGGAGNTTGTGCTNNACCTGCTAAGCAACAACTGATTGTCTATGTTCTAANTCNCCTTNATTGATNCCACAGCTCTTTCCATATNATATATATAATAAGNCTATTTCCTGTTCAATATGTCATATCTAAAATAAATAGTCAGTAATAGCTCTGTATCCTCCATAATGTGATATGAGACAACAATAGAAGGGCAACAATAGAAGAAGGATGGATTTTGTAGAGTTAATGAACTACAAGTGACGTGTCCGCTCANCCATTGGCATTGTCAGGCCGATATTATAGAGCCATTGCTGCATCACTTGGCCTTGTACTGAGGCTGCTGTCCAAATTCCATTTCTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCAGAACACACTTGTCTTGGGTAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATNCCACTATTTATGTCTCGGTTTTGTATTTTNCCTTTTGAAGTTCATTATCA
  3   1   2       bld Spl                             IMAGE:8463087.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACTCTTGCAGAGAGAGAGCTGGTGCACTGCTAGCACACTGATGTCTTGTCTAATCACTTCATGATGCACAGCTCTTTCATATATATATATATAAGGCTGTTCCTGTCAATATGTCATATATCTAAATAAATAGTCAGTAATAGCTCTGTATCCTCCATATTGTGATATGAGACAACAATAGAAGGGCAACAATAGAAGAAGGATGGATTTTGTAGAGTTAATGAACTACAAGTGACGTGTCCCGCTCAGCCATTGGGATTGTCAGGCCGATATTATAGAGCCATTGCTGCATCACTTGGCCTTATACTGAGGCTGCTGTCCAAATTCCATTTCTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCAGAACACACTTGTCTTGGGTAAAAAAAAAATGAGATCAAAACCGCACATTATGTTATGTAGCAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAACTATTTGGAATTCTATTCCCCTTTACCGTATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTCATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTTGAAGTTCATATCAGCTCTTTCCAGCAATAAAAATC
  3   1   2       bld DMZ       in                         xl310h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCTTCATTGATGCCACAGCTCTTTTCCATATAATATATATAATAAGGCTGTTTCCTGTTCAATATGTCATATATCTAAAATAAATAGTCAGTAATAGCTCTGTATCCTCCATATTGTGATATGAGACAACAATAGAAGGGCAACAATAGAAGAAGGATGGATTTTGTAGAGTTAATGAACTACAAGTGACGTGTCCCGCTCAGCCATTGGGATTGTCAGGCCGATATTATAGAGCCATTGCTGCATCACTTGGCCTTATACTGAGGCTGCTGTCCAAATTCCATTTCTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCAGAACACACTTGTCTTGGGTAAAAAAAAAATGAGATCAAAACCGCACATTATGTTATGTAGCAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAACTATTTGGAATTCTATTCCCCTTTACCGTATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTCATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTTGAAGTTCATATCAGC
  3   1   2       bld DMZ       in                         xl333k07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGGGAAACNATNGAAGAAGGATGGATTTTGTAGAGTTAATGAACTACAAGTGACATGTCCGCTCAGCCATTGGGATTGTCAGGCCGATATTATAGNGCCNTTGNTGCATCNCTTGGCCTTATACTGNGGNTGCTGTCCAAATTCCNTTTNTTCAGGGTCCAAATGTGCCTTAGGNTTTGTTATAAGGCNGAAAACNCTTGTNTTGGGTAAAAAAAAAAATGAGATCAAAACCGCACATTATGTTATGTAGCAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGATATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTGAAGTTCATATCAGC
  3   1   2       bld DMZ       in                         xl338f18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAAGGGCNCCAATAGAAGAAGGATGGATTTTGTAGAGTTAATGAACTACAAGTGACGTGTCCGCTCAGCCATTGGCATTGTCAGGCCGATATTATAGAGCCATTGCTGCATCACTTGGCCTTGTACTGNGGNTGCTGTCCAAATTCCNTTTNTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCAGAACNCNCTTGTCTTGGGTAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTTGAAGTTCATTATCAGCATTTC
  3   1   2       bld Tbd7      in                         XL109m05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGAAGGGCAACAATAGAAGAAGGATGGATTTTGTAGAGTTAATGAACTACAAGTGACGTGTCCCGCTCAGCCATTGGGATTGTCAGGCCGATATTATAGAGCCATTGCTGCATCACTTGGCCTTATANTGAGGCTGCTGTCCAAATTCCATTTNTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCAGAACACACTTGTNTTGGGTAAAAAAAAAATGAGATCAAAACCGCACATTATGTTATGTAGCAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAACTATTTGGAATTCTATTCCCCTTTACCGTATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTCATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTGAAGTTCATTATCAGCATCTTTT
  3   1   2       bld Tbd7      in                         XL072b08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGAAGGATGGATTTTGTAGAGTTAATGAACTACAAGTGACGTGTCCCGCTCAGCCATTGGGATTGTCAGGCCGATATTATAGAGCCATTGCTGCATCACTTGGCCTTATACTGAGGCTGCTGTCCAAATTCCATTTNTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCAGAACACACTTGTNTTGGGTAAAAAAAAAATGAGATCAAAACCGCACATTATGTTATGTAGCAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAACTATTTGGAATTCTATTCCCCTTTACCGTATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAGCATTCATAACGCCACTATTTATGTACTCGGTTGTTGTATTTNACCTTNTANAGTTCATTATCAGCATC
  3   1   2       bld Tbd7      in                         XL074k22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCTCAGCCATTGGCATTGTCAGGCCGATATTATANAGCCATTGCTGCATCACTTGGCCTTGTACTGAGGCTGCTGTCCAAATTCCATTTTTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCAGAACACACTTGTNTTGGGTAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTGAAGTTCATTATCAGCATCTTCTCCATACAATTAAAAAGAAAAG
  3   1   2       bld DMZ       in                         xl321m08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCAGCCATTGGCATTGTCAGGCCGATATTATAGAGCCATTGCTGCATCACTTGGCCTTGTACTGAGGCTGCTGTCCAAATTCCATTTCTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCAGAACNCNCTTGTCTTGGGTAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTGAAGTTCATATCAG
  3   1   2       bld Neu7      in                         XL015i01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTGGGATTGTCAGGCCGATATTATAGAGCCATTGCTGCATCACTTGGCCTTATACTGAGGCTGCTGTCCAAATTCCATTTCTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCAGAACACACTTGTNTTGGGTAAAAAAAAAATGAGATCAAAACCGCACATTATGTTATGTAGCAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAACTATTTGGAATTCTATTCCCCTTTACCGTATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTCATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTTGAAGTTCATTATCAGCATCTTTTCCATGCAATTAAAAAGAA
  3   1   2       bld Neu7      in                         XL032g23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTGCTGCATCACTTGGCCTTGTACTGAGGCTGCTGTCCAAATTCCATTTNTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCAGAACNCNCTTGTNTTGGGTAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGNNAAGGCTTCCTTTTAGCATCGTTTNAACNAATTGATATCACACAGGAGCTACACGTGCAAATATGATCATTGNTNCCTTTCTATGNAGCACAAGTTTGTTCAAGGTGTT
  3   1   2       bld Neu7      in                         XL022c02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCTGCTGTCCAAATTCCATTTTTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCANAACACACTTGTTTTGGGTAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTTGAAGTTCATTATCAGCATTTTCTCCATGCAATTAAAAAGAA
  3   1   2       bld Tbd7                                 XL089h11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAATTCCATTTNTTCAGGGTCCAAATGTGCCTTAGGATTTGTTATAAGGCAGAAAACACTTGTNTTGGGTAAAAAAAAAAATGAGATCAAAACCGCACATTATGTTATGTAGCAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGATATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGATAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAGTACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTNCTCGGTTTTGTATTTTACCTTTGAAGTTCATTATCAGCATCTTCTCCATACAATTAAAAAG
  3   1   2      seed Tbd7                                 XL089d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TNTTGGGTAAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTTGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGACGTCTGACAGTTGCCAATGCTGAGTAAATACGTGTGAAGTGTGACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGGTTTTGTATTTTACCTTTTGAAGTTCATTATCAGCATTTTCTCCATGCAATTAAAAAGAAAA
  3   1   2       bld Ooc2                            IMAGE:3746898.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGTAAAAAAAAAACGAGATCAAAACCGCACATTGTTATGTAGAAATTTCCAAATATTATAGCTTATAAATGAAGTATGTCCAACTGGCAGACATCACATAGTTGTGAGAATAAAACTCGCCAATTATTTGGAATTCTATTTTGGAATTTTTCTCCCTCCCCTTAGCCATATCTATCACCCGTACTTGATGTAAGGTCTTCCAGCAAAAGGCACTGAGTGTTAGGAAAGAGGGAAAGGCTTCCTTTTAGCATCGTTTAAACTAATTGATATTACACAGGAGCTACACGTGCAAATATGATCATTGTTTCCTTTCTATAAATACAAGTTTGTTCAAGGTGTTATTCTCGAGA
  3   1   2       bld Neu7                                 XL007g02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACACAGAGAGAAAACATTTATAATGCCACTATTTATGTCTCGTTTTTGTATTTTACCTTTTGAAGTTCATTATCAGCATCTTCTCCATACAATTAAAAAGAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)