Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 90%

 1012838367 Xl3.1-IMAGE:6950559.5.5 - 21 ESTs
                                                                       .....-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6950559.5.5                                                                                                                    AACAGGACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCCAAAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTACTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAGAAACGTGGTCTGGCCCTAGATGGCAAACTGAAACACGGCGATACCAACCTTGCATCATCTACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTTTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGAAACGCCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATACATATGCATACTTGTTTACTTGTGGTATGAGATGTGTTCTGTAGGTCTAATAAACATTGCCAGACTAATACTTAAAAATAAACAGTAAATAAAAAATCTTGCTATGTCAAAAAAA
                                                  Xl3.1-CHK-1012721529                                                                                                                          ACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCCAAAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTACTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAGAAACGTGGTCTGGCCCTAGATGGCAAACTGAAACACGGCGATACCAACCTTGCATCATCTACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTTTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGAAACGTCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATACATATGCATACTTGTTTACTTGTGGTATGAGATGTGTTCTGTAGGTCTAATAAACATTGCCAGACTAATACTTAAAAATAACCAGTAAATAAAAAATCTTGCTATGTCAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                         5     7     6     8     6     8     6     8     6     8     6     7     7     8     7     8     7     8     8     8     8     8     8     8    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    12    11    12    11    13    11    13    11    14    12    14    12    14    12    14    13    16    13    16    13    16    13    16    12    16    12    16    11    16    13    16    13    16    12    16    11    16    10    15    10    15     8    15    10    15    10    15     9    15     9    15     9    15     9    15     9    15     9    14     8    13     8    12     8    12     7    12     7    10     5     8     4     7     4     6     4     5     5     6     6     7     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     6     6     5     6     5     6     5     6     5     6     2     4     2     3
  5   1   2       e50                            Xl3.1-IMAGE:6950559.5                                                                                                                    AACAGGACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCCAAAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTACTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAG
  5   1   2       e50                            Xl3.1-IMAGE:6956245.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAGAAACGTGGTCTGGCCCTAGATGGCAAACTGAAACACGGCGATACCAACCTTGCATCATCTACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTTTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGAAACGTCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATACATATGCATACTTGTTTACTTGTGGTATGAGATGTGTTCTGTAGGTCTAATAAACATTGCCAGACTAATACTTAAAAATAACCAGTAAATAAAAAATCTTGCTATGTCAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                        -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----T-------
                                               BLH ATG      42     548                                                                                                                    
                                               BLH MIN      33     194                                                                                                                    
                                               EST CLI     -31       1                                                                                                                    
                                                                                                                                                PREDICTED - Sp ---- 1e-083     XP_001195887.1 PREDICTED: similar to beta-arrestin 1, putative [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                     PROTEIN --- Ce ---- 4e-085     NP_508183.1 ARRestin, beta 1, Drosophila kurtz homolog (48.5 kD) (arr-1) [Caenorhabditiselegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PROTEIN --- Ag ==== 1e-098     XP_317960.1 ENSANGP00000004989 [Anopheles gambiae str. PEST] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                              PREDICTED - ?? ---= 1e-098     XP_001255589.2 PREDICTED: similar to Beta-arrestin-2 (Arrestin beta 2) (Arrestin-3) [Bos taurus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                      PROTEIN --- Dm ---- 8e-101     NP_524988.1 kurtz CG1487-PA [Drosophila melanogaster] --------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                           PROTEIN --- Ci ---- 3e-107     NP_001041447.1 arrestin [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PROTEIN -== Mm ==== 3e-139     NP_796205.1 arrestin, beta 1 isoform A [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PROTEIN -== Hs ==== 1e-139     NP_004032.2 arrestin beta 1 isoform A [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                           PREDICTED - Cf ---- 6e-140     XP_549059.2 PREDICTED: similar to arrestin 3, retinal (X-arrestin) [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PROTEIN -== Bt ==== 4e-140     NP_776668.1 arrestin, beta 1 [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PREDICTED = Dr ==== 3e-141     XP_001337184.1 PREDICTED: arrestin, beta 1 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                    PROTEIN === Gg ==== 6e-157     NP_001091002.1 arrestin 3, retinal [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                    PREDICTED = Xt ==== 5e-160     NP_001096287.1 hypothetical protein LOC100124859 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                    PROTEIN === Xl ==== 0          NP_001081780.1 cone arrestin [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:6950559.5.5                                                                                                                                                              ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------TGA---------------TGA------------------------ATG------------------------------------------TGA------------TGA---------------------------------------------------------ATG---------------------------------------------------TAA---------------ATG
                                                                   ORF                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2       e50                            Xl3.1-IMAGE:6950559.5                                                                                                                    AACAGGACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCCAAAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTACTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAG
                                                  Xl3.1-CHK-1012692431                                                                                                                          ACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCCAAAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTACTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAAC
  5   1   2       add Brn1                            IMAGE:6953716.5p CCACACGACGCGCGACGACACCGGGGAAAGAGGCTGGTACGGTCCGGAATTCTCCGGATTGCANACTGAAATCCAACAGGACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCTAAGAAACCACAACCCCCAGGATTAACTTTTCTTGATTTTTCAGAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTACTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCCGAAAGAAAAGCGTTCAGCTCATAATCCGGAAAGTGCAGTTTGCTCCAGAAACCACAGGAACTGCCTCATGTGTCCAAACAACACGCCCAATTTCTGGATGTCAGAAAAAACCACTACAGGGGGGAGGTCTCACTGGGCCAAAGAGATTTTATTATTCTGGGGGGAGCCAGGTTGGGCCTCTAAATTTAAAAATAAACCCACGcccccccccGCGAAGAATTGGGTGAACAAAGATCCACAAATTAACCCNGTGGGAACCACTTTGACCCGAAGGTGGGGTTCTCTTTATTTCACCTGGGGCGAAGGGTAccccccccAAAAATTTGTTCTTGCGCTGGTGCGTGCGGCAGAATAAAAATTGGAGGAACCGGGTCGCCGCGAAGCACCAATAATTGGGCC
  5   1   2       bld Brn1 5g                         IMAGE:6950216.5p                                                                                GTACCGGGTCCTGGAATTCCCTGCGATCTGAAATCCAACAGGACTGTTACTGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCCAAAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTGCTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAAATTAAAATAAACAACAACACCCGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGAACCGATGGTGGTTCTTTATTCACTGGGACAAGTTCCCCCAAAATTGTCTGCTGGTGAAGGAGATAAAATGGAGACGGG
  5   1   2       bld Brn1 5g3  in                    IMAGE:6950559.5p                                                                                     GACCGGTCCGGAATTTTCGGGATCTGAAATCCACAGGACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCCAAAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTAACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTGCTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATGTGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAAGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCGGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGGAGAAATAAATGAGAACGTCGCAGCCAATGCCAATTTCTCAGGGTCATATTTCGCTGAAC
  5   1   0       chi Brn1                            IMAGE:7018599.5p                                                                                                           CTGAAATCCAACAGGACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCTAAAGTATTTATTAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTACTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGGAAGAAATGTGGAAGTTGAATTTTGAGGTGAAAAGGTTTCTGGGGCAAATAATGGTGGAAAGAAGAAAATATTCCCGAAAAGGAAACAACCGGTTTCAGCCTCCCTTAATTCCAGGGAAAAAGTGGCCAAGTTTTTGGCCTCCCCAAAAAAccccccccGGGGAAACTTGGCCCCTCTTGTGGGTTCCCAAAAACCAAACACCGCCCCAAATTTTCCAGGGAAGGGTCCAGAAACAAAACCCCCCCTTTCCCGGGGTGGGAAAGGGCCTTCCACCTGGGaaaaaaaaagaaaaatttttatttaaacccctggggggggAGAACCCCCGTTTTGGGCCCTCCCCAATTTTATAAAAATTTTTACCCCCTCNTcccccccccccAAAAAAATTT
  5   1   2       bld Brn1 5g                         IMAGE:6953001.5p                                                                                                            TGAAATCAACAGGACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCTAAAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTACTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGGAGCCAGTTGGCAATCAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGGAGCAGTTGACAAATGTGGTTCTTTTATTCACTGGACAAGTACACCAAAATTGGTCTGCTGTGAAGGAGATTAAATGAAAACCGTTCGCAGCCAAAAGCCAAATTTCTTCAGGGGTCATATTTCCCTGGACACCGGCTTTCTGGCCCAACAAACAA
  5   1   2       bld Brn1 5g3  in                    IMAGE:6956245.5p                                                                                                            TGAAATCCAACAGGACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCCAAAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTGCTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGNGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCANAATAACAGTGGAGCAGTTTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTNGCTGTGNAGGAGATAAAATGAGACGGGGTCGCAGCAAATGGCCAATTTTCTCAAGGGTCATAT
  5   1   2       bld Brn1 5g                         IMAGE:6954715.5p                                                                                                             TGAAATCCACAGGACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCCAAAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTGCTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCCGTTGGCATCAAATTAAAAATAAACCACAACCCCGGCAAGATTGTGAAAAAGATCCAAATAACAGTGGAGCAGTTGACCGAATGTGGTTCTTTATTCACTGGACAAGTACACCAAAAATTGTTCTGCTGTGAGGA
  5   1   2       bld Brn1 5g3  in                    IMAGE:6951277.5p                                                                                                                       AGGACTGTTACAGGTAAAAGTTCTGTTGCAGCAGTAAACATGGCAGAAAGTTCTAAAGTATTTAAGAAGTCCAGTGGTGATGGGAAGCTGGCCATCTATCTTGCCAAGCGAGACTATGTGGACCACGTGGACCATGTTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTACTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACCCCCGCAAGATTGTGAAAAAAGATCCAAATACCCGTGGGAGCAGTTGAAAAAGGTGGTTTCTTTTTTTCCCGGGACAAGTTACACCCAAAATTGTCTGCTGTGAGGAAAATAAATGAAAACGGGTCCCCACCAAATGGCCATTTTTTTGAGGGTCATATTTCCCCGGAA
  5   1   2       bld Brn1                            IMAGE:6954350.5p                                                                                                                                                                                                                                                               TTGAACCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTGCTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGTTCATATTCGCTGACACCGCTTCTGGCCCACAACAAAGGAGAAACGTGGTCTGGCCCTAGATGGCCAAACTGAAAACACGGGCGATACCAAACCTTTGCATCATTCTACCAATCCCTACCGACCAAGGGGATGGAATAAAAGAAGGTGCCTAAGGAAATGGTTGGTGGTTCCTTAAAAAAGTTTCA
  5   1   2      seed Brn1      in                    IMAGE:4740601.5p                                                                                                                                                                                                                                                                    CCTGTAGATGGAATGATCATAATTGACCCTGAATATCAAAAGGACAAGAAAGTCTTTGTGACCCTCGCTTGTACTTTTCGTTATGGACGAGATGACCATGAGCTCATTGGCTTGAGCTTTAAGAAGGAACTGTACTTTCTGCATTGTCAGGTGTACCCCCCACTGCCTGAAGATAAGAAGCCCCTCACACCACTACAGGAAAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGC
  5   1   2       bld Brn1      in                    IMAGE:4740951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAGTTATCTAAAAAGCTGGGAGTGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCA
  5   1   2       bld Eye1      in                    IMAGE:4743386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAATGCATTTCCCTTCTGTTTTAATATGACCACGGATTTGCCATGCTCGGTGACACTTCAGCCAGGACCAGAGGATACTGGGAAGAAATGTGGAGTTGATTTTGAGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATATCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAGA
  5   1   2       bld Brn1      in                    IMAGE:4740779.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGTGAAAGGTTTCTGGGCAGATAATGTGGAAGAGAAAATTCCAGAAAGAACAGCGTTCAGCTCATAATCAGGAAAGTGCAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAAT
  5   1   2       bld Brn1                            IMAGE:6954965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTTTGCTCCAGAAGCCACAGGAACTGCCTCATGTGTCCAAACAACACGCCAATTCATGATGTCAGACAAACCACTACAGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAGAAACGTGGTCTGGCCCTAGATGGCAAACTGAAACACGGCGATACCAACCTTGCATCATCTACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTTTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGGAAACGCCGGCAATGCAGATTTTGGATATGGGGTTGTACCCATAATTGCAACTGTACTTTTAACACCTAAGttttttttCCTGAACATTATAAACCCTTTGNTGGAGTGGTGGTTGGAATTT
  5   1   2       e50                            Xl3.1-IMAGE:6956245.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAGAAACGTGGTCTGGCCCTAGATGGCAAACTGAAACACGGCGATACCAACCTTGCATCATCTACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTTTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGAAACGTCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATACATATGCATACTTGTTTACTTGTGGTATGAGATGTGTTCTGTAGGTCTAATAAACATTGCCAGACTAATACTTAAAAATAACCAGTAAATAAAAAATCTTGCTATGTCAA
                                                  Xl3.1-CHK-1012699324                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAGAAACGTGGTCTGGCCCTAGATGGCAAACTGAAACACGGCGATACCAACCTTGCATCATCTACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTTTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGAAACGCCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATACATATGCATACTTGTTTACTTGTGGTATGAGATGTGTTCTGTAGGTCTAATAAACATTGCCAGACTAATACTTAAAAATAAACAGTAAATAAAAAATCTTGCTATGTCAAAAAAAA
  3   1   2       bld Brn1 5g3  in                    IMAGE:6951277.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAACATAAAAAAAATGGGTTAGGGGAATTAAATGAATTCAAAGGAAGAGGGGGCCGGTTTGGTGTTCTGGAAGGGGCCTTAGTAAAGTTGGTGTACCAGTGCTTCCCAGAAAGTACACGTGGCAAATTCAATGTCTGTCAAGTCAAAAATCCGGTTATACGGGTGGGGGGTTTTTCCCTCGGACAAAGGGGGATTGTATTATCCATGAGGGAACCCCGGTTGGGCTTCAAAATTTGAAAAATAGACCAACAACCCCCAGCAAGGATTGTGAAAAAGAATCAAAGTTAACCGGGGGAGCAGTTTGACAGATGTGGTTCTTTATTCACTGGACAAGTACCCCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAGAAACGTGGTCTGGCCCTAGATGGCAAACTGAAACACGGCGATACCAACCTTGCATCATCTACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTCTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGAAACGTCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATACATATGCATACTTGTTTACTTGTGGTATGAGATGTGTTCTGTACCTCTATTTTAGATGCCACGGNANNAGTGTCATACCCATATACGACAAGAAGGGATGATANGNGNAGAACGGAAC
  3   1   2       bld Brn1 5g3  in                    IMAGE:6950559.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTCCAAGAAAAGAAACAGGGTTTCAGCTTATAATTCAGGAAAGTGCCAGTTTGGTTCAGAAAGCCCCCAGGAACTGCCTTCAAGTGTTCAAACAAACACGCCAATTCATGATGTTCGGACAAACCATTACAGGTGGAGGTTTCACGGACAAAAGAGATTATTTTCCAGGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAGAAACGTGGTCTGGCCCTAGATGGCAAACTGAAACACGGCGATACCAACCTTGCATCATCTACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTTTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGAAACGCCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATCCATATGCATAACTTGTTTACCTGTGGGAGTA
  3   1   2      seed Brn1 5g3  in                    IMAGE:6956245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   NGCAGTTTGCCTCCAGAAGCCCACAGGAAACTGCCTCAATGTGTCCAAACAACCACGCCAAATTCATGATGTCAGACAAACCACTACAGGGTGGAGGTCTCACTGGACAAAGAGATTTATTATCATGGGGAGCCAGTTGGCATCAAATTAAAAATAAACAACAACACCAGCAAGATTGTGAAAAAGATCAAAATAACAGTGGAGCAGTTGACCGATGTGGTTCTTTATTCACTGGACAAGTACACCAAAATTGTCTGCTGTGAGGAGATAAATGAGACGGTCGCAGCAAATGCCAATTTCTCAGGGTCATATTCGCTGACACCGCTTCTGGCCAACAACAAGGAGAAACGTGGTCTGGCCCTAGATGGCAAACTGAAACACGGCGATACCAACCTTGCATCATCTACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTTTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGAAACGCCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATCCATATGCATACTTGTTTACTTGTGGTATGAGATGTGTTCTGTAGGTCTAATAAACATTGCCAGACTAATACTTAAGAATAAACAGTAAATAAAAAATCT
  3   1   2       bld Brn1      in                    IMAGE:4740601.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAACGGGCGATACCAACCTGGCATCATTTACAATCCTACGACCAGGGATGAATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTCTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGAAACGTCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATACATATGCATACTTGTTTACTTGTGGTATGAAATGTGTTCTGTAGGTCTAATAAACATTGCCAGACTAATACTTAAAAATAACCAGTAAATAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye1      in                    IMAGE:4743386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCAACCTTGCATCATCTACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTCTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGAAACGTCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATACATATGCATACTTGTTTACTTGTGGTATGAGATGTGTTCTGTAGGTCTAATAAACATTGCCAGACTAATACTTAAAAATAAACAGTAAATAAAAAAAAAA
  3   1   2       bld Brn1      in                    IMAGE:4740951.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCATCTACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTTTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGTTGAAACGCCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATACATATGCATACTTGTTTACTTGTGGTATGAAATGTGTTCTGTAGGTTTAATAAACATTGCCAGACTAATACTTAAAAATAACCAGTAAATAAAAAATCTTGCTATGTCAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn1      in                    IMAGE:4740779.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAATCCTACGACCAGGGATGGATAAAGAGGTGCTAGGAATGTTGGTGTCTTATAAAGTTCGAGTCAGTCTGGTGGTGGCCAGAGGAGGAATTTTGGGAGACCTGACATCAAGTGATGTGTCGGTGGAGCTGCCATTTACCTTGATGCATCCCAAACCATCACCGGACCAGACAAACATCGAGGATGTGGTGATAGAGGAATTCGCCAGGCAAAAGCTACAGGGAGCAGAGGGTGAAGATGACAAGGATGATGCATGAAGCAAAAGTAGCAGCTGAAACGCCGGCAATGCAGATTTGGATATGGGTTGTACCATATTGCACTGTACTTTAACACTAGTTTTTTCCTGACATATAACCTTGTGAGTGTGTGAATTGGTTACTGGTCCATACATATGCATACTTGTTTACTTGTGGTATGAGATGTGTTCTGTAGGTCTAATAAACATTGCCAGACTAATACTTAAAAATAAACAGTAAATAAAAAATCTTGCTATGTCAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)