Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl258o07.3                           14 END     1           5        7                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:3402349-IMAGp.5.5              27 PI      85         23     1356                forkhead box I1 [Xenopus tropicalis]
     3   0.0    0Xl3.1-IMAGE:4682602-IMAGp.5                 6 PI      78        400      688                forkhead box I1 [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:4084049.5                       3 PI      83        396      576                fox factor [Xenopus laevis]

 This cluster: approximate FL confidence score = 88%

 1012838419 Xl3.1-XL504h24ex.5.5 - 18 ESTs
                                                                       ....-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-XL504h24ex.5.5                                                                                                                                                                                                                                                                                                                                               TTCCCCGGGGAGCGAGAAGCGAGATGAACCCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCACAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCTCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGCAATTTCCGCCGCAAGAGGAAGCCCAAATCCGAGTCCAACAACGCTAAAATCGCCAAGAGGGATGAGGATCACTTGAACCCAAAAGGCAAAGAAAGTCCACCCATGATTACTCCCTCCTCCTCCCCCGAGGTTCTGTCTCCCACAGGCCATAGCAAGAGCCCCTCTCCCCCAACTGTCACCTACACCCCTTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGAGTCCCCTGGGGCTTCTCAATGAATTGTCTCAGAGGAACATCACAGGCTTGAGCAGCTTCATTTCGGGCTCCGCAGTTGATCAGAGCTCAGAACATCAGGACAACAGTCTGTTCTACAACAGAAGCCCCTACTACACTAATCAGAAGCAGCCACACTTCCTTCAGCAGCTCCACCCACAGCAGCCCCCTTTGTACCAGGGAAGGTATTGACGTGTAGTTCTACATGACATTTGCAGACTGAGACTGGATATGATGATTGGGGCCCATCGCTACCCGGGACTGAAATCTCAAGAAGAACATTTTCCCATGGGAGGAAAAAAAAAAACATGAGACTACTGCAAATACCACCGTCCATAGCTGGCTGAGGATGCTGGGAATTGTAGTTCACAAGTGTAGGGTATCAGGGACGTCTGTAGCAAGAAGATTCTTTTTCTTGTTCTCAAAATGATGCAGATTTATTTTATAAGACAAAAGAAATAGCTTTTTTTTTTGCATTGTGAACGTGTAACCTGTAAATATAAATATATTGTCATTCATATGTTGTGACTTGTGTGTCACATGGTTCTTTATT
                                                  Xl3.1-CHK-1012721542                                                                                                                                                                                                                                                                                                                                                     GGGGAGCGAGAAGCGAGATGAACCCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCACAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCTCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGCAATTTCCGCCGCAAGAGGAAGCCCAAATCCGAGTCCAACAACGCTAAAATCGCCAAGAGGGATGAGGATCACTTGAACCCAAAAGGCAAAGAAAGTCCACCCATGATTACTCCCTCCTCCTCCCCCGAGGTTCTGTCTCCCACAGGCCATAGCAAGAGCCCCTCTCCCCCAACTGTCACCTACACCCCTTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGAGTCCCCTGGGGCTTCTCAATGAATTGTCTCAGAGGAACATCACAGGCTTGAGCAGCTTCATTTCGGGCTCCGCAGTTGATCAGAGCTCAGAACATCAGGACAACAGTCTGTTCTACAACAGAAGCCCCTACTACACTAATCAGAAGCAGCCACACTTCCTTCAGCAGCTCCACCCACAGCAGCCCCCTTTGTACCAGGGAAGGTATTGACGTGTAGTTCTACATGACATTTGCAGACTGAGACTGGATATGATGATTGxxGxxCATCGCTACCCGGGACTGAAATCTCAAGAAGAACATTTTCCCATGGGAGGAAAAAAAAAAACATGAGACTACTGCAAATACCACCGTCCATAGCTGGCTGAGGATGCTGGGAATTGTAGTTCACAAGTGTAGGGTATCAGGGACGTCTGTAGCAAGAAGATTCTTTTTCTTGTTCTCAAAATGATGCAGATTTATTTTATAAGACAAAAGAAATAGCTTTTTTTTTTGCATTGTGAACGTGTAACCTGTAAATATAAATATATTGTCATTCATATGTTGTGACTTGTGTGTCACATGGTTCTTTATTTATAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                    2     2     3     7     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10     9    10     9     9     8     9     8     9     8     9     6     8     6     8     4     7     3     6     3     6     3     6     4     6     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     4     2     4     2     3     2     3     2     3     2     3     2     3     3     4     2     4     2     4     3     4     3     4     3     4     2     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     4     3     4     3     4     3     4     1     3     1     2     1     2     1     2     3     4     4     4     3     4     4     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     4     3     3     2     2
  5   1   2      ests                               Xl3.1-XL504h24ex.5                                                                                                                                                                                                                                                                                                                                               TTCCCCGGGGAGCGAGAAGCGAGATGAACCCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCACAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCTCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGCAATTTCCGCCGCAAGAGGAAGCCCAAATCCGAGTCCAACAACGCTAAAATCGCCAAGAGGGATGAGGATCACTTGAACCCAAAAGGCAAAGAAAGTCCACCCATGATTACTCCCTCCTCCTCCCCCGAGGTTCTGTCTCCCACAGGCCATAGCAAGAGCCCCTCTCCCCCAACTGTCACCTACACCCCTTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGAGTCCCCTGGGGCTTCTCAATGAATTGTCTCAGAGGAACATCACAGGCTTGAGCAGCTTCATTTCGGGCTCCGCAGTTGATCAGAGCTCAGAACATCAGGACAACAGTCTGTTCTACAACAGAAGCCCCTACTACACTAATCAGAAGCAGCCACACTTCCTTCAGCAGCTCCACCCACAGCAGCCCCCTTTGTACCAGGGAAGGTATTGACGTGTAGTTCTACATGACATTTGCAGACTGAGACTGGATATGATGATTG
  5   1   2      ests                            Xl3.1-IMAGE:3430351.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCATGGGAGGAAAAAAAAAAACATGAGACTACTGCAAATACCACCGTCCATAGCTGGCTGAGGATGCTGGGAATTGTAGTTCACAAGTGTAGGGTATCAGGGACGTCTGTAGCAAGAAGATTCTTTTTCTTGTTCTCAAAATGATGCAGATTTATTTTATAAGACAAAAGAAATAGCTTTTTTTTTTGCATTGTGAACGTGTAACCTGTAAATATAAATATATTGTCATTCATATGTTGTGACTTGTGTGTCACATGGTTCTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                       ----TT------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                   -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------CG----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----C-----G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------T----
                                               BLH ATG      23     247                                                                                                                                                                                                                                                                                                                                               
                                               BLH MIN      23     144                                                                                                                                                                                                                                                                                                                                               
                                               BLH OVR      23      70                                                                                                                                                                                                                                                                                                                                               
                                               EST CLI       8      33                                                                                                                                                                                                                                                                                                                                               
                                               ORF LNG      23       5                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 2e-032     NP_496411.1 UNCoordinated locomotion UNC-130, forkhead box D1 (37.3 kD) (unc-130)[Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 3e-036     NP_524202.1 crocodile CG5069-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 2e-049     XP_001181648.1 PREDICTED: similar to forkhead transcription factor I [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 1e-060     NP_001071713.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Bt ---- 6e-081     XP_587178.2 PREDICTED: similar to forkhead box I1 isoform 1 [Bos taurus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ---- 4e-081     NP_076396.2 forkhead box I1; forkhead homolog 10 (Drosophila) [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Gg ---- 5e-082     XP_425185.1 PREDICTED: similar to Hypothetical protein MGC75815 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 7e-083     NP_036320.2 forkhead box I1 isoform a; forkhead (Drosophila)-like 10; Forkhead, drosophila,homolog-like 10; forkhead-related activator 6; hepatocyte nuclear factor 3forkhead homolog 3; HNF-3/fork-head homolog-3 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Cf ---- 2e-086     XP_546245.2 PREDICTED: similar to forkhead box I1 isoform a isoform 1 [Canis familiaris] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Dr ==== 3e-097     XP_001918833.1 PREDICTED: hypothetical protein [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 0          CAJ81516.1 forkhead box I1 [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 0          NP_001081619.1 fork head protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xl3.1-XL504h24ex.5.5                                                                                                                                                                                                                                                                                                                                                                      ATG---------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------ATGATG---------------------------------------------------ATG------------------TGA------------------------TAG------------------------------------TAG------------------------------------------------ATGATG---------------------------TAG---------------------------------------------------------ATG---TGA------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2      ests                               Xl3.1-XL504h24ex.5                                                                                                                                                                                                                                                                                                                                               TTCCCCGGGGAGCGAGAAGCGAGATGAACCCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCACAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCTCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGCAATTTCCGCCGCAAGAGGAAGCCCAAATCCGAGTCCAACAACGCTAAAATCGCCAAGAGGGATGAGGATCACTTGAACCCAAAAGGCAAAGAAAGTCCACCCATGATTACTCCCTCCTCCTCCCCCGAGGTTCTGTCTCCCACAGGCCATAGCAAGAGCCCCTCTCCCCCAACTGTCACCTACACCCCTTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGAGTCCCCTGGGGCTTCTCAATGAATTGTCTCAGAGGAACATCACAGGCTTGAGCAGCTTCATTTCGGGCTCCGCAGTTGATCAGAGCTCAGAACATCAGGACAACAGTCTGTTCTACAACAGAAGCCCCTACTACACTAATCAGAAGCAGCCACACTTCCTTCAGCAGCTCCACCCACAGCAGCCCCCTTTGTACCAGGGAAGGTATTGACGTGTAGTTCTACATGACATTTGCAGACTGAGACTGGATATGATGATTG
                                                  Xl3.1-CHK-1012692723                                                                                                                                                                                                                                                                                                                                                     GGGGAGCGAGAAGCGAGATGAACCCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCACAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCTCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGCAATTTCCGCCGCAAGAGGAAGCCCAAATCCGAGTCCAACAACGCTAAAATCGCCAAGAGGGATGAGGATCACTTGAACCCAAAAGGCAAAGAAAGTCCACCCATGATTACTCCCTCCTCCTCCCCCGAGGTTCTGTCTCCCACAGGCCATAGCAAGAGCCCCTCTCCCCCAACTGTCACCTACACCCCTTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGAGTCCCCTGGGGCTTCTCAATGAATTGTCTCAGAGGAACATCACAGGCTTGAGCAGCTTCATTTCGGGCTCCGCAGTTGATCAGAGCTCAGAACATCAGGACAACAGTCTGTTCTACAACAGAAGCCCCTACTACACTAATCAGAAGCAGCCACACTTCCTTCAGCAGCTCCACCCACAGCAGCCCCCTTTGTACCAGGGAAGGTATTGACGTGTAGTTCTACATGACATTTGCAGACTGAGACTGGATATGATGATTGCAGGGC
  3  -1   2       bld Ga11                            IMAGE:3475015.3p                                                                                                                                                                                                                                                                                  CAAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGTTTATCCCAATTCCCCGGGGAGCGAGAAGCGAGATGAATTCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGATTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCACAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCTCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAG
  3  -1   2       bld Ga11                            IMAGE:3474984.3p                                                                                                                                                                                                                                                                                                           AGCTCAGAATAAACGCTCAACTTTGGCAGATCTCAATTCCCCGGGGAGCGAGAAGCGAGATGAATTCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGATTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCACAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCTCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAATCTGTCCCTCAAT
  5   1   2      seed Ga15 5g3  in                       XL504h24ex.5p                                                                                                                                                                                                                                                                                                                                                 AGCGATTAGCCAGTGAGCGAGATGAACCCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCCGAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCGCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCACTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGCAATTTCCGCCGCAAGAGGAAGCCCAAATCCGAGTCCAA
  5   1   2       bld Em10 5g                         IMAGE:8320252.5p                                                                                                                                                                                                                                                                                                                                                   CGATTAGCCAGTGAGCGAGATGAACCCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCCGAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCGCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCACTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCANGCACAACCTGTCCCTCAATGACTGCTTNCAGAAGATGCCAAGGGATGAGAATGATCCNAGGAAAGGAAACTACTGGACTCTGGACTCCACTGCGAGAGATGTTTGACATGGCATTTCCGCGCAAGAGAGCCCAATCGAGTCAACACGCTAAATCGCCAGAGGATGAGATCCTTGAACCAAAGCAAGAAGTCACCTGATACTCTCTCTCCCGAGTCGTCCCAAGCTAGAGAGCCTCTCCATGCCTACCCTGTGACAT
  5   1   2       bld Emb1 5g3  in                    IMAGE:3401780.5p                                                                                                                                                                                                                                                                                                                                                       CACGCGTCCGGCGAGATGAACCCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCATCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCACAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCTCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAATCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAGGAAACTACTGGACTCTGGACT
  5   1   2       bld Ga12 5g3  in                         XL215k15.5p                                                                                                                                                                                                                                                                                                                                                        TCGGGCACGAGGAGATGAACCCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCCGAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCGCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCACTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAA
  5   1   2       bld Ga15 5g3  in                       XL448j13ex.5p                                                                                                                                                                                                                                                                                                                                                           CGAGAAGCGAGATGAACCCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCATCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTTTCTCAGCAGAACCTGCACCCGAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCGCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAATCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGCAATTTCCGCCGCAAGAGGAAGCCCAAATCCGAGTCCAACAACGCTAAAATCGCCAAGAGGGATGAGGATCACTTGAACCCAAAAGGCAAAGAAAGTCCACCCATGATTACTCCCTCCTCC
  5   1   2       bld Emb1 5g                         IMAGE:5156829.5p                                                                                                                                                                                                                                                                                                                                                            GAGAAGCGAGATGAATTCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGATTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCACAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCTCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAATCTGTCCCTCAATGACTGCTTCAAGAAGATGCCCAAGGGATGAGAATGATCCAGGAAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGCAATTTCCGCCGCAAGAGGAAGCCCAAATCCGAGTCCAACAACGCTAAAATCGCCAAGAGGGATGAGGATCACTTGAACCCCAAAGGCAAAGAAAGTCCACCCATGATTACTcccttctcctccccccgaggttctgtctccccacaggccatagcaagagccccctctccccccaactggtcacctacacccccttgtctaccccACTTTCATTGGGCAGCATGAACTGCCCGTGGACTCAGCCTACCATGGAACAGAACCGAGTCCCCCTGTG
  5   1   2       bld Ga12 5g                              XL145n17.5p                                                                                                                                                                                                                                                                                                                                                                      GTGAACCCCGTGCAACAACCGGCCCAGCACAGGTCTCCGGCCTCCCTCCTGCACCTGCCTCACCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCCGAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCGCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCACTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGACTCACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGG
  5   1   2       bld Bla1                            IMAGE:3379571.5p                                                                                                                                                                                                                                                                                                                                                                                                               CTCCCTCCTGCACCTGCCTCATCCTAAACGCGCCCAGGAGGCTCCAGACATGGGACTTTATTGTGACAACTTCATGTTCTCTCAGCAGAACCTGCACCACAGCCAGAGGGCCCCCAACTTCAGCATCGGGGGGGAATTCACCCCTCCAGCTAATCCTTACCTGTGGCTGGGGGGTCCTGGGATGAATAACGCCCCCAATTACAGCCCTGCCCCTGCTCCTTACATTCCCTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAAGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTTCAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGAC
  5   1   2       bld DMZ       out                        xl232i05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTGCTTTCAGCGCCCCCCAGCGGCAGTTCATGGCCAACTCTGCAGCCTTTGGTGGAGCCGATTTGGGTTGGATGTCGGCGGCTTCCCAGGAGGAGCTTCTCAAGATGGTGAGACCCCCTTACTCGTACTCTGCCCTCATCGCCATGGCCATCCAGAATGCCTCAGACAAGAGGCTCACCCTGAGTCAGATTTACCAATATGTGGCAGAAAACTTCCCTTTCTACAAGAAGAGCAAAGCAGGCTGGCAGAACTCCATCAGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGATGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACTCCAACTGCGAGAAGATGTTTGACAATGGCAATTTCCGCCGCAAGAGGAAGCCCAAATCCGAGTCCAACAACGCTAAAATCGCCAAGAGGGATGAGGATCACTTGAACCCAAAAGGCAAAGAAAGTCCACCCATGATTACTCCCTCCTCCTCCCCCGAGGTTCTGTCTCCCACAGGCCATAGCAAGAGCCCCTCTCCCCCAACTGTCACCTACACCCCCTGTCTGACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGAGTCCCCTGGGGCTTCTCAATGAATTATCTCAGAGGAACATCACAGGCTTGAGCAGCTTCATTTCGGGCTCCGCAGTTGATCAG
  5   1   2       bld Ga12                                 XL176c18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTCCAACTGCGAGNAAGATGTTTGACAATGGCAATTTCCGCCGCAAGNAGGAAGCCCAAATCCGAGTCCAACAACGCTAAAATCGCCAAGAGGGATGAGGATCACTTGAACCCAAAAGGCAAAGAAAGTCCACCCATGATTACTCCCTCCTCCTCCCCCGAGGTTCTGTCTCCCACAGGCCATAGCAAGAGCCCCTCTCCCCCAACTGTCACCTACACCCCTTGTCTAACCAACTTCATTGGCAGCATGACTGCCGTGGACTCAGCTACAATGAACAGACAGAGTCCCCTGGGGCTTCTCAATGAATTGTCTCAGAGGAACATCACAGGCTTGAGCAGCTTCATTTCGGGCTCCGCAGTTGATCAGAGCTCAGAACATCAGGACAACAGTCTGTTCTACAACAGAAGCCCCTACTACACTAATCAGAAGCAGCCACACTTCCTTCAGCAGCTCCACCCACAGCAGCCCCCTTTGTACCAGGGAAGGTATTGACGTGTAGTTCTACATGACATTTGCAGACTGAGACTGGATATGATGATTGCAGGGCCCGGG
  3   1   1       add Emb1 5g3  in                    IMAGE:3401780.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTAACTTAATGGGTAGTATGATGCTGTGGAATCTAGCTACAATGAACAGACAGAGTCCCTGGGGGCTTTTCAATGAATTGTTTCAGAGGAACATCACAGGTTTGAGCAGTTTCATTTCGGGGTCCGCAGTTGATCAGAGNTCAGAGCATCAGGACAACAATCTGTTCTACAACAGAAGCCCCTACTACANTAATCAGAAGCAGCCACACTTCCTTCAGCAGCTCCACCCACAGCAGCCCCCTTTGTACCAGGGAAGGTATTGACGTGTAGTTCTACATGACATTTGCAGACTGAGACTGGATATGATGATTGCAGGGCCCGGGACTGAA
  5   1   2      ests                            Xl3.1-IMAGE:3430351.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCATGGGAGGAAAAAAAAAAACATGAGACTACTGCAAATACCACCGTCCATAGCTGGCTGAGGATGCTGGGAATTGTAGTTCACAAGTGTAGGGTATCAGGGACGTCTGTAGCAAGAAGATTCTTTTTCTTGTTCTCAAAATGATGCAGATTTATTTTATAAGACAAAAGAAATAGCTTTTTTTTTTGCATTGTGAACGTGTAACCTGTAAATATAAATATATTGTCATTCATATGTTGTGACTTGTGTGTCACATGGTTCTT
                                                  Xl3.1-CHK-1012706014                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGGAAAAAAAAAAACATGAGACTACTGCAAATACCACCGTCCATAGCTGGCTGAGGATGCTGGGAATTGTAGTTCACAAGTGTAGGGTATCAGGGACGTCTGTAGCAAGAAGATTCTTTTTCTTGTTCTCAAAATGATGCAGATTTATTTTATAAGACAAAAGAAATAGCTTTTTTTTTTGCATTGTGAACGTGTAACCTGTAAATATAAATATATTGTCATTCATATGTTGTGACTTGTGTGTCACATGGTTCTTTATTTA
  5  -1   2       bld Egg5      in                    IMAGE:3430351.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGACGTGTAGTTTTACATGACATTTGCAGACTGAGACTGGATATGATGATTGCAGGGCCCATCGCTACCCGGGACTGAAATCTCAAGAAGAACATTTTCCCATGGGAGGaaaaaaaaaaaCATGAGACTACTGCAAATACCACCGTCCATAGCTGGCTGAGGATGCTGGGAATTGTAGTTCACAAGTGTAGGGTATCAGGGACGTCTGTAGCAAGAAGATTCTTTTTCTTGTTCTCAAAATGATGCAGATTTATTTTATAAGACAAAAGAAATAGCttttttttttGCATTGTGAACGTGTAACCTGTAAATATAAATATATTGTCATTCATATGTTGTGACTTGTGTGTCACATGGTTCTTTATTTATAATATTTTTTTATAATaaaaaaaaGAA
  3  -1   2      seed Egg5      in                    IMAGE:3430351.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACGTGTAGTTCTACATGACATTTGCAGACTGAGACTGGATATGATGATTGCAGGGCCCATCGCTACCCGGGACTGAAATCTCAGAATGACATTTCCCATGGGAGGAAAAAAAAAAACATGAGACTACTGCAAATACCACCGTCCATAGCTGGCTGAGGATGCTGGGAATTGTAGTTCACAAGTGTAGGGTATCAGGGACGTCTGTAGCAAGAAGATTCTTTTTCTTGTTCTCAAAATGATGCAGATTTATTTTATAAGACAAAAGAAATAGCTTTTTTTTTTGCATTGTGAACGTGTAACCTGTAAATATAAATATATTGTCATTCATATGTTGTGACTTGTGTGTCACATGGT
  3   1   2       add Ga12 5g3  in                         XL215k15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CNNTTTCCCNGGGGGGGAAAAAAAAAAATATGAGNCTNCTGCAAATACCNCCGTCCATAGCTGGCTGAGGATGCTGGGAATTGTAGTTCACAAGTGTAGGGTATCAGGGACGTNTGTAGCAAGGAGATTNTTTTTNTTGTTNTCAAAATGATGCAGATTTATTTTATAAGACAAAAGAAATAGCTTTTTTTTTTGCATTGTGAACGTGTAACCTGTAAATATAAATATATTGTCATTCATATGTTGTGACTTGTGTGTCACATGGTTCTTTATTTATAAT
  3   1   2       bld Ga15 5g3  in                       XL504h24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCNGGGGGGNAAAAAAAAAAATATGAGACTACTGCAAATACCNCCGTCCATAGCTGGCTGAGGATGCTGGGAATTGTAGTTCNCAAGTGTAGGGTATCAGGGACGTCTGTAGCAAGGAGATTCTTTTTCTTGTTCTCAAAATGATGCAGATTTATTTTATAAGACAAAAGAAATAGCTTTTTTTTTTGCATTGTGAACGTGTAACCTGTAAATATAAATATATTGTCATTCATATGTTGTGACT
  3   1   2       add Ga15 5g3  in                       XL448j13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGCAAATNCCCCCGTCCATANCTGGCTGAGGATGCTNGGAATTGTAGTTCNCAAGTGTAGGGTATCAGGGACGTCTGTAGCAAGAAGATTCTTTTTCTTGTTCTCAAAATGATGCAGATTTATTTTATAAGNCAAAAGGAAATAGCTTTTTTTTTTGCATTGTGAANCGTGTAACCTGTAAATATAAATATATTGTCATTCATATGTNG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)