Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl269m22.5                            4 END     1           4       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl309e07.3                           74 PI      84        375     1380                (no blast hit)
     3   0.0    0Xl3.1-xl269m22.5                            4 PI      91          1      348                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012838434 Xl3.1-xlk163a20ex.3.5 - 22 ESTs
                                                                       ....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-xlk163a20ex.3.5               AGTCAAGTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCCGGCTGTTTCTATGGAGCTCTTGCCCCCAGCACTCAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACCACTTCTATGACGACCCCTGTTTCAATTCGTCCGACATGAGTTTCTTTGAAGAGCTGGAGCCCAGGCTGGTGCACGTGACTCTGC------------------------AGGAGGAGGAGGAGCACGTGAGGNCCCCCAGTGGCACCATCAGGCGGGCAGGTNCTTGTTGTGGGCGTGTAAAGCCTGTAAGAG------------------------AGGGCCGCCACCATGAGGGAGAGGAGGAGGCTCAGTAAAGTCAATGACGCCTTTGAGACCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGACTCCCCAAAGTGGACATTTTGCGC------------ACATCGACAGTCTCCAAACTCTGCTCCGAGACCAGGAACAGTCTCTGTACCCCAATATGGAACATTATAGTGGGGGACTCCGATCCTCCAGCCCCAGCTCCAACTGCTCCGACGGCATGAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACAGCAACTTCTACACTGACAGCCCCAATGACGTGAGACTTGGGAAGAGCTCAATGATCTCCAGCCTCGACTGTCTCTCCAGCATCGTAGAGCGAATCTCCACCCAAAGCCCCAGCTGCCCCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTTATAAGATTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTNCCAGATNCTCCTTTATATATTTATACTGCGGGAATATTCTAAATAAAGAACCTTATTTATAAAAAA
                                                  Xl3.1-CHK-1012722456                     GTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCCGGCTGTTTCTATGGAGCTCTTGCCCCCAGCACTCAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACCACTTCTATGACGACCCCTGTTTCAATTCGTCCGACATGAGTTTCTTTGAAGAGCTGGAGCCCAGGCTGGTGCACGTGACTCTGCTGAAGC------------------------AGGAGGAGCACGTGAGGNCCCCCAGTGGCACCATCAGGCGGGCAGGTNCTTGTTGTGGGCGTGTAAAGCCTGTAAGAGGAAGAG------------AGGAGGAGGGCCGCCACCATGAGGGAGAGGAGGAGGCTCAGTAAAGTCAATGACGCCTTTGAGACCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGACTCCCCAAAGTGGACATT------------NTAGTTACATCGACAGTCTCCAAACTCTGCTCCGAGACCAGGAACAGTCTCTGTACCCCAATATGGAACATTATAGTGGxGxNxxCxxxxCCTCCAGCCCCAGCTCCAACTGCTCCGACGGCATGAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACAGCAACTTCTACACTGACAGCCCCAATGACGTGAGACTTGGGAAGAGCTCAATGATCTCCAGCCTCGACTGTCTCTCCAGCATTGTAGAGCGAATCTCCACCCAAAGCCCCAGCTGCCCCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTTATAAGATTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTNCCAGATGCTCCTTTATATATTTATACTGCGGGAATATTCTAAATAAAGAACCTTATTTAT
                                                      consensus depths                    6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     0     6     0     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     0     6     0     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     0     7     5     9     5    11     5    11     5    11     5    11     7    11     4    11     6    11     6    11     6    14     8    14     7    12     7    12     4    12     6    12     5    11     5     8     6     9     6     9     6     9     7    10     7    10     5    10     4    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    12    12    12    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    10    12    12    12    12    12    12    12    12    12    12    12    11    12    12    12    11    11    11    11    11    11    10    11    10    11    10    11    10    11     7    11     9    11    10    12    10    13    10    13    11    13    11    13     9    12     5     7     3     3     3     3     3     3
  5   1   2       e50                                Xl3.1-xlk2n07ex.5               AGTCAAGTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCCGGCTGTTTCTATGGAGCTCTTGCCCCCAGCACTCAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACCACTTCTATGACGACCCCTGTTTCAATTCGTCCGACATGAGTTTCTTTGAAGAGCTGGAGCCCAGGCTGGTGCACGTGACTCTGC------------------------AGGAGGAGGAGGAGCACGTGAGGNCCCCCAGTGGCACCATCAGGCGGGCAGGTNCTTGTTGTGGGCGTGTAAAGCCTGTAAGAG------------------------AGGGCCGCCACCATGAGGGAGAGGAGGAGGCTCAGTAAAGTCAATGACGCCTTTGAGACCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGACTCCCCAAAGTGGACATTTTGCGC------------ACATCGACAGTCTCCAAACTCTGCTCCGAGACCAGGAACAGTCTCTGTACCCCAATATGGAACATTATAGTGGAGANTCCGATGCCTCCAGCCCCAGCTCCAACTGCTCCGACGGCATGAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCT
  5   1   2       e50                              Xl3.1-xlk163a20ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGGACTCCGANCCTCCAGCCCCCAGCTCCAACTGCTCCGACGGCATAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACAGCAACTTCTACACTGACAGCCCCAATGACGTGAGACTTGGGAAGAGCTCAATGATCTCCAGCCTCGACTGTCTCTCCAGCATCGTAGAGCGAATCTCCACCCAAAGCCCCAGCTGCCCCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTTATAAGATTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTNCCAGATGCTCCTTTATATATTTATACTGCGGGAATATTCTAAATAAAGAACCTTATTTATAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------AT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       G-----------
                                               BLH ATG      80     392               
                                               BLH MIN      80      44               
                                               BLH MPR      80      44               
                                               BLH OVR      80      57               
                                               CDS MIN      80      44               
                                               EST CLI     -12      44               
                                                                                                                                                                     PROTEIN === Mm ==== 5e-042     NP_034996.2 myogenic differentiation 1 [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                     PROTEIN === Hs ==== 3e-042     NP_002469.2 myogenic factor 3; myoblast determination protein 1 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                     PREDICTED = Cf ==== 2e-042     XP_854756.1 PREDICTED: similar to myogenic factor 3 [Canis familiaris] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                     PROTEIN === Bt ==== 2e-045     NP_001035568.2 myogenic differentiation 1 [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN --- Dr ---- 1e-051     NP_571337.2 myogenic differentiation [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                     PROTEIN === Gg ==== 2e-060     NP_989545.1 myogenic factor 1 [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                     PREDICTED = Xl ==== 4e-110     AAA49902.1 MyoD1 homologous protein; putative [Xenopus laevis]  ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-xlk163a20ex.3.5                                                                                               ATG---------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------TGA------TGA------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------TGA---------TGA---------------------------------TGA---------------------------------------------TGA---------------TAG------------------------------------------------------------TGA---------ATG---------------------------------------------------------------------------TAA
                                                                   ORF                                                                                               ... open reading frame                                                                                                                                       ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2       e50                                Xl3.1-xlk2n07ex.5               AGTCAAGTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCCGGCTGTTTCTATGGAGCTCTTGCCCCCAGCACTCAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACCACTTCTATGACGACCCCTGTTTCAATTCGTCCGACATGAGTTTCTTTGAAGAGCTGGAGCCCAGGCTGGTGCACGTGACTCTGC------------------------AGGAGGAGGAGGAGCACGTGAGGNCCCCCAGTGGCACCATCAGGCGGGCAGGTNCTTGTTGTGGGCGTGTAAAGCCTGTAAGAG------------------------AGGGCCGCCACCATGAGGGAGAGGAGGAGGCTCAGTAAAGTCAATGACGCCTTTGAGACCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGACTCCCCAAAGTGGACATTTTGCGC------------ACATCGACAGTCTCCAAACTCTGCTCCGAGACCAGGAACAGTCTCTGTACCCCAATATGGAACATTATAGTGGAGANTCCGATGCCTCCAGCCCCAGCTCCAACTGCTCCGACGGCATGAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCT
                                                  Xl3.1-CHK-1012700288                     GTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCCGGCTGTTTCTATGGAGCTCTTGCCCCCAGCACTCAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACCACTTCTATGACGACCCCTGTTTCAATTCGTCCGACATGAGTTTCTTTGAAGAGCTGGAGCCCAGGCTGGTGCACGTGACTCTGCTGAAGC------------------------AGGAGGAGCACGTGAGGNCCCCCAGTGGCACCATCAGGCGGGCAGGTNCTTGTTGTGGGCGTGTAAAGCCTGTAAGAGGAAGAG------------AGGAGGAGGGCCGCCACCATGAGGGAGAGGAGGAGGCTCAGTAAAGTCAATGACGCCTTTGAGACCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGACTCCCCAAAGTGGACATT------------NTAGTTACATCGACAGTCTCCAAACTCTGCTCCGAGACCAGGAACAGTCTCTGTACCCCAATATGGAACATTATAGTGGAGANTCCGATGCCTCCAGCCCCAGCTCCAACTGCTCCGACGGCATGAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACA
  5   1   2       bld Ga18 5g3  in                       xlk68o06ex.5p GAGCAACTNCCACAAGTCAAGTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCCGGCTGTTTCTATGGAGCTCTTGCCCCCAGCACTCAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACCACTTCTATGACGACCCCTGTTTCAATTCGTCCGACATGAGTTTCTTTGAAGAGCTGGAGCCCAGGCTGGTGCACGTGACTCTGCTGAAGCCGNNNNNCCNNNNNgaggaggaggaggaggagCACGTGAGGNCCCCCAGTGGNNCCATCAGGCGGGCAGGTNCTTGTTGTGGGCGTGTAAAGCCTGTAAGAGGAAGAGCAGCGNNNNNNNAGGAGGAGGGCCGCCACCATGAGGGAGAGGAGGAGGNTCAGTAAAGTCAATGACGCCTTTGAGACCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGACTCCCCAAAGTGGACATTTTGCGCAANNNNNTTAGNTACATCGACAGTCTCCAAACTCTGCTCCGAGACCAGGAACAGTCTCTGTACCCCAATATGGAACATTATAGTGGGGNCTCCGATGCCNCCNGCCCCAGCTCCAACTGCTCCGACGGCATGANCAGCCCCCCCTGCAGCTCC
  5   1   2       bld Ga18 5g3  in                      xlk163a20ex.5p   AGCAACTNCCACAAGTCAAGTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCGGCTGTTTCTATGGAGCTCTTGCCCCCAGCACTCAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACCACTTCTATGACGACCCCTGTTTCAATTCGTCCGACATGAGTTTCTTTGAAGAGCTGGAGCCCAGGCTGGTGCACGTGACTCTGCTGAAGCCGGNNNNCCNNNNNgaggaggaggaggaggagCACGTGAGGNCCCCCAGTGGCACCATCAGGCGGGCAGGTNCTTGTTGTGGGCGTGTAAAGCCTGTAAGAGGAAGAGCAGCNNNNNNANAGGAGGAGGGCCGCCACCATGAGGGAGAGGAGGAGGNTCAGTAAAGTCAATGACGCCTTTGAGACCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGACTCCCCAAAGTGGACATTTTGCGCAANNNNNTAGTTACATCGACAGTCTCCAAACTCTGCTCCGAGACCAGGAACAGTCTCTGTACCCCAATATGGAACATTATAGTGGGGACTCCGATGNCTCCAGNCCCAGNTCCAACTGCTNCGACGGCATGAACAGCCCCCCCTGCAGNTCCAGGAGAAGAAACAGCTACGACAGNNNTTCTACACTGACAGCCCNNNGACGTGAGA
  5   1   2       bld Ga18 5g   ?                        xlk80b13ex.5p     AACTNNCACAAGTCAAGTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCCGGCTGTTTCTATGGAGCTCTTGCCCCCAGCACTCAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACCACTTCTATGACGACCCCTGTTTCAATTCGTCCGACATGAGTTTCTTTGAAGAGCTGGAGCCCAGGCTGGTGCACGTGACTCTGCTGAAGCCGNNNNNCCNNNNNgaggaggaggaggaggagCACGTGAGGNCCCCCAGTGGCACCATCAGGCGGGCAGGTNCTTGTTGTGGGCGTGTAAAGCCTGTAAGAGGAAGAGCAGCNNNNNNANAGGAGGAGGGCCGCCACCATGAGGGAGAGAAGGAGGCTCAGTAAAGTCAATGACGCCTTTGAGACCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGACTCCCCAAAGTGGACATTTTGCGCAANGNNNTAGTTACATCGACAGTCTCCAAACTCTGCTCCGAGANCAGGAACANTCTCTGTACCCNAATATGGAACATTATAGTGGAGANTCCGATGCCTCCAGCCCCAGCTCCAACTGCTCCGACNGCATGAACAGCCCCCCCTGCAGCTCCAGGNNAAGAAANAGCTACGACAGNNNTTCTACACTGACAGCCCCNATGACGTGA
  5   1   2       bld Ga18 5g3  in                      xlk162k22ex.5p     AACTNCCACAAGTCAAGTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCCGGCTGTTTCTATGGAGCTCTTGCCCCCAGCACTCAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACCACTTCTATGACGACCCCTGTTTCAATTCGTCCGACATGAGTTTCTTTGAAGAGCTGGAGCCCAGGCTGGTGCACGTGACTCTGCTGAAGCCGGNNNCCCNNNNNgaggaggaggaggaggagCACGTGAGGNCCCCCAGTGGCACCATCAGGCGGGCAGGTNCTTGTTGTGGGCGTGTAAAGCCTGTAAGAGGAAGAGCAGCNNNNNNANAGGAGGAGGGCCGCCACCATGAGGGAGAGGAGGAGGCTCAGTAAAGTCAATGACGCCTTTGAGACCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGACTCCCCAAAGTGGACATTTTGCGCAACGNNTTAGNTACATCGACAGTCTCCAAACTCTGCTCCGAGACCAGGAACAGTCTCTGTACCCCAATATGGAACATTATAGTGGGGNCTCCGATGCCTCCAGCCCCAGNTCCAACTGCTCCGACGGCATGAACAGCCCCCCCT
  5   1   2       bld Ga18 5g3  in                      xlk152c04ex.5p           CACAAGTCAAGTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCCGGCTGTTTCTATGGAGCTCTTGCCCCCAGCACTCAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACCACTTCTATGACGACCCCTGTTTCAATTCGTCCGACATGAGTTTCTTTGAAGAGCTGGAGCCCAGGCTGGTGCACGTGACTCTGCTGAAGCCGGNNNCCCNNNNNgaggaggaggaggaggagCACGTGAGGNCCCCCAGTGGCACCATCAGGCGGGCAGGTNCTTGTTGTGGGCGTGTAAAGCCTGTAAGAGGAAGAGCAGCNNNNNGANAGGAGGAGGGCCGCCACCATGAGGGAGAGGAGGAGGCTCAGTAAAGTCAATGACGCCTTTGAGANCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGACTCCCCAAAGTGGACATTTTGCGCAANNNNTTAGTTACATCGACAGTCTCCAAACTCTGCTCCGAGANCAGGAACAGTCTCTGTACCCCAATATGGAACATTATAGTGGGGNNTCCGATGCCTCCAGCCCCAGCTCCAACTGCTCCGACGGCATGAACAGCCCCCCCTGCAGCTCCAGGAGAAGAANCAGCTACGACAGNNNTTCTACACTGACAGCCCCNATGAC
  5   1   2      seed Ga18 5g3  in                        xlk2n07ex.5p           CACAAGTCAAGTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCCGGCTGTTTCTATGGAGCTCTTGCCCCCAGCACTCAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACCACTTCTATGACGACCCCTGTTTCAATTCGTCCGACATGAGTTTCTTTGAAGAGCTGGAGCCCAGGCTGGTGCACGTGACTCTGCTGAAGCCGGNNNNCCNNNNCgaggaggaggaggaggagCACGTGAGGNCCCCCAGTGGCACCATCAGGCGGGCAGGTGCTTGTTGTGGGCGTGTAAAGCCTGTAAGAGGAAGAGCAGCNNNNNNANAGGAGGAGGGCCGNCACCATGAGGGAGAGAAGGAGGNTCAGTAAAGTCAATGACGCCTTTGAGACCCTCAAGCGATGCACCTCGACCAACCCCAACCAGAGACTCCCCAAAGTGGACATTTTGCGCAACGNNNTAGTTACATCGACAGTCTCCAAACTCTGCTCCGAGACCAGGAACAGTCTCTGTACCCCAATATGGAACATTATAGTGGAGANTCCGATGCCTCCAGCCCCAGCTCCAACTGCTCCGACGGCATGANCAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACAGCAACTTCTACACTGACAGCCCNNNGACGTGNGA
  5   1   2       bld Neu7      in                         XL011c12.5p               GGTNAAGTCTCTGCTCCAAACTGCGGGTATTTGGCCTGGACCCCCGAGTTGTGGATCTGTGGGACCCCCCGGCTGNTTCTATGGAGCTCTTGCCCCCAGCACTNAGGGACATGGAGGAGACCGAGGGATCTCTCTGCGCCTTNCCGACCCCCGACCACTNCTATGACGAC
  5   1   2       e50                              Xl3.1-xlk163a20ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGGACTCCGANCCTCCAGCCCCCAGCTCCAACTGCTCCGACGGCATAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACAGCAACTTCTACACTGACAGCCCCAATGACGTGAGACTTGGGAAGAGCTCAATGATCTCCAGCCTCGACTGTCTCTCCAGCATCGTAGAGCGAATCTCCACCCAAAGCCCCAGCTGCCCCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTTATAAGATTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTNCCAGATGCTCCTTTATATATTTATACTGCGGGAATATTCTAAATAAAGAACCTTATTTATAAAAA
                                                  Xl3.1-CHK-1012691774                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------------AGCCCCxxxxxCCAACTGCTCCGAxGxxxxAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACxxxxAxxTxxxxACTGACAGCCCCAATGACGTGAGACTTGGGAAGAGCTCAATGATCTCCAGCCTCGACTGTCTCTCCAGCATTGTAGAGCGAATCTCCACCCAAAGCCCCAGCTGCCCCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTTATAAGATTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTGCCAGATGCTCCTTTATATATTTATACTGCGGGAATATTCTAAATAAAGAACCTTATTTA
  3   1   2       bld Ga18 5g3  in                       xlk68o06ex.3p                                                                                                                                                                                                                                                                                                                                                                                           GAGGANGGCCGNCNCCATNAGGNAGNNGAGNAGGCTCAGTAAANTCAATGNNNCNTTTNNGNCCCTNNANNCGANNNNCNTCGNCCNACCCCCAACCAAGAGNCTCCCNAAAGTGGACNTTTTNGCNNANCGCGATTAGTTANATCGACAGTCNCCAAACTCTGCTCCGAGNCCAGNAACANTCTCTNNACCCCAATATGGAACATTATAGTGGGGACTCCGATNNCTCCANNCCCAGCTCCANCTGCTCNGNNGGCATGAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTNNGACAGCAACTTCTACACTGACAGNCCCAATGACGTGAGACTTGGGAAGAGCTCAATGATCTCCAGCCTCGACTGTCTCTCCAGCATCGTAGAGCGAATCTCCACCCAAANNCCCAGNNNNNCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTTATAAGATTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTNCCAGATNCTCCTTTATATATTTATACNNCGGG
  3   1   2       bld Ga18 5g3  in                      xlk162k22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTNACATCGACAGTNNCNNANNCTGCTNCNAGACCAGGAACAGNCTCTNTACCCCAATATGGAACATNATAGTGGGGACTCCGATNCCTCCANNCCCAGCTCCAACTGCTCCGACGGCATGAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACAGCAACTTCTACACTGACAGCCCCAATGACGTGAGACTTGGGAAGAGCTCAATGATCTCCAGCCTCGACTNTCTCTCCAGCATCGTAGAACGAATCTCCACCCAAANNCCCAGNNNNNCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTNTCCCNCGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGCCATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGACATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTATAAGATTTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTNCCAGATNCTCCTTTATATATTTATACTGCG
  3   1   2       bld Ga18 5g3  in                      xlk163a20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANNTCNACANNCTCCAANNTCTGCTCCNNGACCANGANNNGTCTCTGTACCCCAATATGNANCATTATAGTGGGGACNCCGATNCCTCCAGCCCCAGCTCCAACTGCNCCGACGGCATGNACAGNCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACANNAACTTCTACACTGACAGCCCCAATGACGTGAGACTAGGGAAGAGCTCAATGATCTCCAGCCTCGACTNTCTCTCCAGCATCGTAGAGCGAATCTCCACCCAAANCCCCAGCTNNCCCGCCCCCATGGCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCACTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTATAAGATTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTNCCAGATGCTCCTTTATATATTTATACT
  3   1   2       bld Ga18 5g3  in                      xlk152c04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGACANNCNCNAANNTCTGCTCCGAGNCNAGGANNNGTCTCNGTACCCCAATNATGGANCATNATAGTGGGGACTCCGATNCCNCCANNCCCAGCTCCAACTGCTCCGANGGCATGAACANNCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACAGCAACTTCTACACTGACAGCCCCAATGACGTGAGACTTGGGAAGAGCTCAATGATCTCCANNCTCGACTNTCTCTCCAGCATCGTAGAACGAATCTCCACCCAAANNCCCAGNNNNNCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGCCATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGACATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTATAAGATTTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGANNCTTATTTATGTGCTTGTTGTGTTGTNCCAGATNCTCCTTTATATATTTATACT
  3   1   2       bld Ga18 5g3  in                        xlk2n07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGNCAGTNNCNANNTCTGCTCCGAGNCNAGGANNAGTCTCTGTNCCCANTATGGAACATTATAGTGNAGACTCCGATNCCTCCAGCCCCAGCTCCAACTGCTCCGANNGCATGAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACAGCAACTTCTACACTGACAGCCCCAATGACGTGAGACTTGGGAAGAGCTCAATGATCTCCAGCCTCGACTGTCTCTCCAGCATTGTAGAGCGAATCTCCACCCAAANNCCCAGCTNNCCCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTTATAAGATTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTNCCAGATNCTCCTTTATATATTTATACT
  3   1   2       bld Ga18                             rxlk129c23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGTGGGCTCCGACGGCATGAACANCCCCCCCTGCAGCTCCAGNAGNAGAAACAGCTACGACANNANCTTCTACACTGACAGCCCCAATGACGTGAGACTAGGGAAGAGCTCAATGATCTCCAGCCTCGACTGTCTCTCCAGCATCGTAGAGCGAATCTCCACCCAAANNCCCAGCTNNCCCNNCCCCATGGCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGNCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCACTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGANNATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTATAAGATTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTNCCAGATGCTCCTTTATATATTTATACTNCGGGAA
  5   1   2       bld Egg1                               PBX0116B06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGAGGCGGCATGAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACAGCAACTTCTACACTGTCAGCCCCAATGACGTGAGACTTGGGAAGAGCTCAATGATCTCCAGCCTCGACTGTCTCTCCAGCATTGTAGAGCGAATCTCCACCCAAAGCCCCAGCTGCCCCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAAT
  5   1   2       bld Egg1                               PBX0139C08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGCGGCATGAACAGCCCCCCCTGCAGCTCCAGGAGAAGAAACAGCTACGACAGCAACTTCTACACTGACAGCCCCAATGACGTGAGACTTGGGAAGAGCTCAATGATCTCCAGCCTCGACTGTCTCTCCAGCATTGTAGAGCGAATCTCCACCCAAAGCCCCAGCTGCCCCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCC
  3   1   2      seed DMZ       out                        xl269m22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACTTGGGAAGAGCTCAATGATCTCCAGCCTCGACTGTCTCTCCAGCATCGTAGAGCGAATCTCCACCCAAAGCCCCAGCTGCCCCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTTATAAGATTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTGCCAGATGCTCCTT
  3   1   2       bld Neu7      in                         XL011c12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCAGCATCGTAGAGCGAATCTCCACCCAAAGCCCCAGCTGCCCCGCCCCCATCTCTGTGGATAGTGGATCCGAGGGCAGTCCCTGTTCTCCTCTGCAGGGGGAGACACTGAGCGACAGAGGAATCCCCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTTATAAGATTTTTTTATAGATTTGTACATAAGAAGCGATTGTGCNANAAATGAGTCTTATTTATGTGCTTNTTGTGTTGTGCCAGATGCTCCTTTATATATTCACACTGCG
  3   1   2       bld Ga18      in                       xlk62d10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCATTTTTTTATAAGATTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTNCCAGATGCTCCTTTATANATTTATACT
  5   1   2       bld Ga18      in                       xlk62d10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTCTTCTCCCGGCAATTCCTGCACTCAACTGTCCCACGACCCCAGCAGCACCATCTACCAGATCTTATAGGCCTCAGTCTGCCCCCTATTGGTCACTTGTTTCCATCAACTGGATTCTCTCCTAATTCCTTCCCAATCCATCAACTTCCCCTTTATTTATTGGTTTGTTCCAGCCAGAGGTTTCTGACATATTTCCCCTGTAAATAACCGAACCCCTCCCAATATCCAATCAGACTGAGGCTGGTGGTGAAGGACAGACCATTCTGGATCCTTAGGGGTTACATGACCCCCCAATGTTGTGTTGAATACGGACAATGGGGAAATTCCCCCCTGAGGCCAAAGGAAACTTTAGGACCatttttttataagatttttttATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTGCCAGATGCTCCTTTATATATTTATACTGCGGGAATATTCTAAATAAAGAACCTTATTTATaaaaaaaaaa
  3   1   2       bld Ga18                             rxlk114o22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGCGTGGGTCGCGAGCGNNCNNNNNGAGNNCAAAGGNANCTTTAGGNCNNTTTTTTTATAAGATTTTTTTATAGATTTGTAAATAAGAAGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTNCCAGATNCTCCTTTATATATTTATACT
  5   1   2       bld Emb4                            IMAGE:5515938.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGTAAATAAGACGCTATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTGCCAGATGCTCCTTTATATATTTATACTGCGGGAATATTCTAAATAAAGAACCTTATTTATAACaaaaaaaaaaaaaaaaGG
  5   1   2       bld Ga18                              xlk136o10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCGATTGTGCGAGAAATGAGTCTTATTTATGTGCTTGTTGTGTTGTGCCAGATGCTCCTTTATATATTTATACTGCGGGAATATTCTAAATAAAGAACCTTATTTATaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)