Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012838447 Xl3.1-IMAGE:4032804.5.5 - 14 ESTs
                                                                       ...-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:4032804.5.5                                                                          CTTTCCGGGAGTGCGGGCTGTGTTAAGACAAGCGGAACTGCAGGCTGTCAAAATCGAGACTGCTGGGCGGCTTTAAGGGACCTTAGAAAAGGGTTTATATCATTATTTACTTTTTTGTGGCTTCAGATTTATTTTCTACCTTTTTTTGGCACTTTTTCTTGCAATGAAAAAATTTGCATATTGTAAGGTGGTTTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGCTTTACTTCAGTGAATGCAACAAATGTGATGACAAGAAGGAACGGGGCCTACCTGGAGGGGATGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTACATAGCGTAATAAATCGGTCACCACGACATTTATTACGAGAAATTGTTCTTGTAGATGATGCCAGTGAGAGAGACTTTTTGAAAAGAGCACTGGAGACATATGTAAAAAAACTTTCAGTACCTGTTCATGTAATACGGATGGAGCAGCGTTCAGGGTTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACGTTTTTAGATGCCCACTGCGAATGTACTGTAGGCTGGCTGGAGCCTTTGTTGGCACGCATAAATCATGACAGACGGACAGTAGTGTGTCCGATCATTGATGTTATCAGTGATGATACGTTTGAATATATGGCTGGTTCTGATATGACTTATGGTGGATTCAACTGGAAATTAAACTTCCGTTGGTATCCTGTTCCCCAACGTGAAATGGATCGAAGAAGAAGTGATAGGACACTTCCTGTGAGGACTCCTACTATGGCAGGAGGCCTCTTTTCCATAGACAGAGATTATTTCCAAGAAATAGGAACATATGATGCTGGAATGGACATTTGGGGAGGAGAAAATTTAGAAATATCTTTCCGTATATGGCAGTGTGGTGGTACATTAGAAATAGTGACTTGTTCACATGTTGGACATGTATTCCGAAAAGCCACACCTTACACTTTCCCAGGGGGCACAGGTCAAATCATTAACAAGAATAACAGACGGCTTGCAGAAGTCTGGATGGATGAATTCAAAAACTTCTTTTATATCATTTCACCTGGTGTGACTAAAGTTGACTATGGAGACATAGCTACCAGAGTAGGCCTAAGACATAAACTGCAGTGTAAGCCCTTTTCCTGGTACTTAGAAAATGTATACCCTGATTCCCAGATACCCCGTCATTATTACTCTTTGGGTGAGATTAGAAATGTTGAGACAAACCAGTGTCTGGACAATATGGCAAGAAAAGAAAATGAGAAAGTTGGTATCTTCAACTGCCATGGAATGGGAGGGAACCAGGTTTTCTCCTATACAGCTAGCAAAGAAATACGAACGGATGATTTATGTTTAGATGTCTCTAAACTTAATGGTCCAGTTATAATGCTTAAGTGTCACCACTTAAGAGGCAATCAGTTATGGGAGTATGATCCAGTGAAACTAACATTGGTGCATGTGAATAGTAACCAGTGCTTGGACAAAGCTGCAGAAGAGGACAGCCAAGTACCCAGCATCAGAGACTGCAATGGTGGCCACTCTCAGCAGTGGCTGTTACGCAATGTCACTCTCCCAGAGAATCTCTAAAATATTATTAGATGGAAAATAAAAACAAATTTATAAAATGATGACTGCGCTACCTCTGCACATGTGACTTGCACATCCTTTAGTATCCTAGGAAGGAAACTGTTTTCTGCAACTTTTGGATGGGGCACATATTAGCTCAGAATACTTACCTAGGGCTCTTCTGTAGCTGAAACCAGCCTACCCCTTAGAGGATGTAAACTGGCACACTTTGTATCATAACTGTGCACATTGACGTATACAAGGAGAATTACCTTCTCTCATCAAGGAATTGTTCAGGCAATGGGTATAGGACTTGGCGAACCATCCTGTTGGCTTCTGGGAGAGTTGCACAACAGGACCCTTTCTTGAATATTTGACTCTTTAAAATAGTACTTTGGTGAGAATCATATGCCAATGGCCGAATTTTTAAAAAAACAGTAGAATTCCAACGAAGATTTGCACAAAACGTTTCCACGTGCAAAAACAGGGAAAGATAAGATCAGATATATTGAAAGTACAATTTGTTATAATAAAAAAAATTGATTTATATGTAGTTTTATACCTCTGCTAAGACCATAACCAGATCACTTTTGTTTTAGTTGCTTGATAGCAAC
                                                  Xl3.1-CHK-1012722004                                                                                GGGAGTGCGGGCTGTGTTAAGACAAGCGGAACTGCAGGCTGTCAAAATCGAGACTGCTGGGCGGCTTTAAGGGACCTTAGAAAAGGGTTTATATCATTATTTACTTTTTTGTGGCTTCAGATTTATTTTCTACCTTTTTTTGGCACTTTTTCTTGCAATGAAAAAATTTGCATATTGTAAGGTGGTTTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGCTTTACTTCAGTGAATGCAACAAATGTGATGACAAGAAGGAACGGGGCCTACCTGGAGGGGATGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTACATAGCGTAATAAATCGGTCACCACGACATTTATTACGAGAAATTGTTCTTGTAGATGATGCCAGTGAGAGAGACTTTTTGAAAAGAGCACTGGAGACATATGTAAAAAAACTTTCAGTACCTGTTCATGTAATACGGATGGAGCAGCGTTCAGGGTTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACGTTTTTAGATGCCCACTGCGAATGTACTGTAGGCTGGCTGGAGCCTTTGTTGGCACGCATAAATCATGACAGACGGACAGTAGTGTGTCCGATCATTGATGTTATCAGTGATGATACGTTTGAATATATGGCTGGTTCTGATATGACTTATGGTGGATTCAACTGGAAATTAAACTTCCGTTGGTATCCTGTTCCCCAACGTGAAATGGATCGAAGAAGAAGTGATAGGACACTTCCTGTGAGGACTCCTACTATGGCAGGAGGCCTCTTTTCCATAGACAGAGATTATTTCCAAGAAATAGGAACATATGATGCTGGAATGGACATTTGGGGAGGAGAAAATTTAGAAATATCTTTCCGTATATGGCAGTGTGGTGGTACATTAGAAATAGTGACTTGTTCACATGTTGGACATGTATTCCGAAAAGCCACACCTTACACTTTCCCAGGGGGCACAGGTCAAATCATTAACAAGAATAACAGACGGCTTGCAGAAGTCTGGATGGATGAATTCAAAAACTTCTTTTATATCATTTCACCTGGTGTGACTAAAGTTGACTATGGAGACATAGCTACCAGAGTAGGCCTAAGACATAAACTGCAGTGTAAGCCCTTTTCCTGGTACTTAGAAAATGTATACCCTGATTCCCAGATACCCCGTCATTATTACTCTTTGGGTGAGATTAGAAATGTTGAGACAAACCAGTGTCTGGACAATATGGCAAGAAAAGAAAATGAGAAAGTTGGTATCTTCAACTGCCATGGAATGGGAGGGAACCAGGTTTTCTCCTATACAGCTAGCAAAGAAATACGAACGGATGATTTATGTTTAGATGTCTCTAAACTTAATGGTCCAGTTATAATGCTTAAGTGTCACCACTTAAGAGGCAATCAGTTATGGGAGTATGATCCAGTGAAACTAACATTGGTGCATGTGAATAGTAACCAGTGCTTGGACAAAGCTGCAGAAGAGGACAGCCAAGTACCCAGCATCAGAGACTGCAATGGTGGCCACTCTCAGCAGTGGCTGTTACGCAATGTCACTCTCCCAGAGAATCTCTAAAATATTATTAGATGGAAAATAAAAACAAATTTATAAAATGATGACTGCGCTACCTCTGCACATGTGACTTGCACATCCTTTAGTATCCTAGGAAGGAAACTGTTTTCTGCAACTTTTGGATGGGGCACATATTAGCTCAGAATACTTACCTAGGGCTCTTCTGTAGCTGAAACCAGCCTACCCCTTAGAGGATGTAAACTGGCACACTTTGTATCATAACTGTGCACATTGACGTATACAAGGAGAATTACCTTCTCTCATCAAGGAATTGTTCAGGCAATGGGTATAGGACTTGGCGAACCATCCTGTTGGCTTCTGGGAGAGTTGCACAACAGGACCCTTTCTTGAATATTTGACTCTTTAAAATAGTACTTTGGTGAGAATCATATGCCAATGGCCGAATTTTTAAAAAAACAGTAGAATTCCAACGAAGATTTGCACAAAACGTTTCCACGTGCAAAAACAGGGAAAGATAAGATCAGATATATTGAAAGTACAATTTGTTATAATAAAAAAAATTGATTTATATGTAGTTTTATACCTCTGCTAAGACCATAACCAGATCACTTTTGTTTTAGTTGCTTGATAGCAACTAGAGT
                                                      consensus depths                                                                               4     4     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     6     6     6     7     6     7     7     9     7     9     7     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2
  5   1   2      ests                            Xl3.1-IMAGE:4032804.5                                                                          CTTTCCGGGAGTGCGGGCTGTGTTAAGACAAGCGGAACTGCAGGCTGTCAAAATCGAGACTGCTGGGCGGCTTTAAGGGACCTTAGAAAAGGGTTTATATCATTATTTACTTTTTTGTGGCTTCAGATTTATTTTCTACCTTTTTTTGGCACTTTTTCTTGCAATGAAAAAATTTGCATATTGTAAGGTGGTTTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGCTTTACTTCAGTGAATGCAACAAATGTGATGACAAGAAGGAACGGGGCCTACCTGGAGGGGATGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTACATAGCGTAATAAATCGGTCACCACGACATTTATTACGAGAAATTGTTCTTGTAGATGATGCCAGTGAGAGAGACTTTTTGAAAAGAGCACTGGAGACATATGTAAAAAAACTTTCAGTACCTGTTCATGTAATACGGATGGAGCAGCGTTCAGGGTTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACGTTTTTAGATGCCCACTGCGAATGTACTGTAGGCTGGCTGGAGCCTTTGTTGGCACGCATAAATCATGACAGACGGACAGTAGTGTGTCCGATCATTGATGTTATCAGTGATGATACGTTTGAATATATGGCTGGTTCTGATATGACTTATGGTGGATTCAACTGGAAATTAAACTTCCGTTGGTATCCTGTTCCCCAACGTGAAATGGATCGAAGAAGAAGTGATAGGACACTTCCTGTGAGGACTCCTACTATGGCAGGAGGCCTCTTTTCCATAGACAGAGATTATTTCCAAGAAATAGGAACATATGATGCTGGAATGGACATTTGGGGAGG
  5   1   2      ests                               Xl3.1-XL450m07ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAACAGAATAACAGACGGCTTGCAGAAGTCTGGATGGATGAATTCAAAAACTTCTTTTATATCATTTCACCTGGTGTGACTAAAGTTGACTATGGAGACATAGCTACCAGAGTAGGCCTAAGACATAAACTGCAGTGTAAGCCCTTTTCCTGGTACTTAGAAAATGTATACCCTGATTCCCAGATACCCCGTCATTATTACTCTTTGGGTGAGATTAGAAATGTTGAGACAAACCAGTGTCTGGACAATATGGCAAGAAAAGAAAATGAGAAAGTTGGTATCTTCAACTGCCATGGAATGGGAGGGAACCAGGTTTTCTCCTATACAGCTAGCAAAGAAATACGAACGGATGATTTATGTTTAGATGTCTCTAAACTTAATGGTCCAGTTATAATGCTTAAGTGTCACCACTTAAGAGGCAATCAGTTATGGGAGTATGATCCAGTGAAACTAACATTGGTGCATGTGAATAGTAACCAGTGCTTGGACAAAGCTGCAGAAGAGGACAGCCAAGTACCCAGCATCAGAGACTGCAATGGTGGCCACTCTCAGCAGTGGCTGTTACGCAATGTCACTCTCCCAGAGAATCTCTAAAATATTATTAGATGGAAAATAAAAACAAATTTATAAAATGATGACTGCGCTACCTCTGCACATGTGACTTGCACATCCTTTAGTATCCTAGGAAGGAAACTGTTTTCTGCAACTTTTGGATGGGGCACATATTAGCTCAGAATACTTACCTAGGGCTCTTCTGTAGCTGAAACCAGCCTACCCCTTAGAGGATGTAAACTGGCACACTTTGTATCATAACTGTGCACATTGACGTATACAAGGAGAATTACCTTCTCTCATCAAGGAATTGTTCAGGCAATGGGTATAGGACTTGGCGAACCATCCTGTTGGCTTCTGGGAGAGTTGCACAACAGGACCCTTTCTTGAATATTTGACTCTTTAAAATAGTACTTTGGTGAGAATCATATGCCAATGGCCGAATTTTTAAAAAAACAGTAGAATTCCAACGAAGATTTGCACAAAACGTTTCCACGTGCAAAAACAGGGAAAGATAAGATCAGATATATTGAAAGTACAATTTGTTATAATAAAAAAAATTGATTTATATGTAGTTTTATACCTCTGCTAAGACCATAACCAGATCACTTTTGTTTTAGTTGCTTGATAGCAACTAGAGTATATTTCTCATTATAGCAATCATAAATTTTAGAAATGGAAATGGACTGAATGTTGTTGTTTGTTCGGGAAACGATGAGTCGGGTTTGATTTTTAATATACACCTTTTTAAAAAGACTTTCCTTACCCCACTCAATGTTGCTTTTTCAATGGACACAACATATTAGATACATTTTAAAAATTAAAGTTTTGTCATACCCAGAGCTCTCTATAGTGTGCTATTCCATGCAGCAAAAACACTTTATTTTATAGGAGGAATCATTAAAAGTATATATTTCATTTATTACATAGGAGAGAGAACTATATTCT
                                               BLH ATG     163    1715                                                                          
                                               BLH MIN     163     357                                                                          
                                               BLH MPR      82     357                                                                          
                                               BLH OVR     163     843                                                                          
                                               CDS MIN     163     357                                                                          
                                               ORF LNG     163     142                                                                          
                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 2e-159     NP_498722.1 GLYcosylation related (68.9 kD) (gly-3) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                  PROTEIN --- Ag ---- 0          XP_314708.4 AGAP008613-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 0          NP_001036338.1 polypeptide GalNAc transferase 5 CG31651-PB, isoform B [Drosophila melanogaster] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                PREDICTED = Sp ==== 0          XP_001193844.1 PREDICTED: similar to UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          NP_001025547.1 galnt1-prov protein [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 0          XP_687472.2 PREDICTED: similar to UDP-GalNAc:polypeptide, N-acetylgalactosaminyltransferase isoform 2 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 0          NP_038842.2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                   PROTEIN === Bt ==== 0          NP_803485.1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 0          NP_001006381.1 similar to polypeptide N-acetylgalactosaminyltransferase 1; GalNAc-T1; GalNAc transferase 1; protein-UDP acetylgalactosaminyltransferase 1; UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 1 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 0          NP_065207.2 polypeptide N-acetylgalactosaminyltransferase 1 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                   PREDICTED = Cf ==== 0          XP_866757.1 PREDICTED: similar to polypeptide N-acetylgalactosaminyltransferase 1 isoform 7 [Canis familiaris] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                   PREDICTED = Xl ==== 0          NP_001083410.1 hypothetical protein LOC398911 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:4032804.5.5                                                                                                                                                   TAA---------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------ATG------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------TAA------------------------------------------------------------------------------------------------TAG---------------TAG---------------------------------------------------------------TAA------------------------------------------------------------ATG---------------------------------------------------------------TGA------------------TAG------------------ATG---ATG---------------------TAG---------------------------------------------------------------------------------------------------TGA---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2      ests                            Xl3.1-IMAGE:4032804.5                                                                          CTTTCCGGGAGTGCGGGCTGTGTTAAGACAAGCGGAACTGCAGGCTGTCAAAATCGAGACTGCTGGGCGGCTTTAAGGGACCTTAGAAAAGGGTTTATATCATTATTTACTTTTTTGTGGCTTCAGATTTATTTTCTACCTTTTTTTGGCACTTTTTCTTGCAATGAAAAAATTTGCATATTGTAAGGTGGTTTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGCTTTACTTCAGTGAATGCAACAAATGTGATGACAAGAAGGAACGGGGCCTACCTGGAGGGGATGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTACATAGCGTAATAAATCGGTCACCACGACATTTATTACGAGAAATTGTTCTTGTAGATGATGCCAGTGAGAGAGACTTTTTGAAAAGAGCACTGGAGACATATGTAAAAAAACTTTCAGTACCTGTTCATGTAATACGGATGGAGCAGCGTTCAGGGTTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACGTTTTTAGATGCCCACTGCGAATGTACTGTAGGCTGGCTGGAGCCTTTGTTGGCACGCATAAATCATGACAGACGGACAGTAGTGTGTCCGATCATTGATGTTATCAGTGATGATACGTTTGAATATATGGCTGGTTCTGATATGACTTATGGTGGATTCAACTGGAAATTAAACTTCCGTTGGTATCCTGTTCCCCAACGTGAAATGGATCGAAGAAGAAGTGATAGGACACTTCCTGTGAGGACTCCTACTATGGCAGGAGGCCTCTTTTCCATAGACAGAGATTATTTCCAAGAAATAGGAACATATGATGCTGGAATGGACATTTGGGGAGG
                                                  Xl3.1-CHK-1012695911                                                                                GGGAGTGCGGGCTGTGTTAAGACAAGCGGAACTGCAGGCTGTCAAAATCGAGACTGCTGGGCGGCTTTAAGGGACCTTAGAAAAGGGTTTATATCATTATTTACTTTTTTGTGGCTTCAGATTTATTTTCTACCTTTTTTTGGCACTTTTTCTTGCAATGAAAAAATTTGCATATTGTAAGGTGGTTTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGCTTTACTTCAGTGAATGCAACAAATGTGATGACAAGAAGGAACGGGGCCTACCTGGAGGGGATGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTACATAGCGTAATAAATCGGTCACCACGACATTTATTACGAGAAATTGTTCTTGTAGATGATGCCAGTGAGAGAGACTTTTTGAAAAGAGCACTGGAGACATATGTAAAAAAACTTTCAGTACCTGTTCATGTAATACGGATGGAGCAGCGTTCAGGGTTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACGTTTTTAGATGCCCACTGCGAATGTACTGTAGGCTGGCTGGAGCCTTTGTTGGCACGCATAAATCATGACAGACGGACAGTAGTGTGTCCGATCATTGATGTTATCAGTGATGATACGTTTGAATATATGGCTGGTTCTGATATGACTTATGGTGGATTCAACTGGAAATTAAACTTCCGTTGGTATCCTGTTCCCCAACGTGAAATGGATCGAAGAAGAAGTGATAGGACACTTCCTGTGAGGACTCCTACTATGGCAGGAGGCCTCTTTTCCATAGACAGAGATTATTTCCAAGAAATAGGAACATATGATGCTGGAATGGACATTTGGGGAGGAGAAAA
  5   1   2      seed Kid  5g                         IMAGE:4032804.5p TTGTGACGTTGGGATTAGCTGTTCCGCTGAAGTCAATGAGCTGGGTATTCACGGTATTGCAGAACGTTTAAAGCTTTCCGGGAGTGCGGGCTGTGTTAAGACAAGCGGAACTGCAGGCTGTCAAAATCGAGACTGCTGGGCGGCTTTAAGGGACCTTAGAAAAGGgtttatatcattatttacttttttgtggcttcagatttattttctacctttttttggcactttttCTTGCAATGAAAAAATTTGCATATTGTAAGGTGGTTTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGCTTTACTTCAGTGAATGCAACAAATGTGATGACAAGAAGGAACGGGGCCTACCTGGAGGGGATGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTACATAGCGTAATAAATCGGTCACCACGACATTTATTACGAGAAATTGTTCTTGTAGATGATGCCAGTGAGAGAGACTTTTTGAAAAGAGCACTGGAGACATATGTAAAAAAACTTTCAGTACCTGTTCATGTAATACGGATGGAGCAGCGTTCAGGGTTGATCAGGGCTCGTCT
  5   1   2       bld Ga18 5g                            xlk80m20ex.5p                                      TGAGCTGGGATTCNCGGTATTGCAGAACGNTTAAAGCTTTTCGGGAGTNCGGGCTGTGTTAAGACAAGCGGAACTGCAGGCTGTCAAAATCGAGACTGCTNGGNGGCTTTAAGGGACCTTAGAAAAGGGtttatatcattatttacttttttgtggcttcagatttattttctacctttttttggcactttttCTTGCAATGAAAAAATTTGCATATTGTAAGGNNGNTTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGCTTTACTTCAGTGAATGCAACANATGTGATGACAAGNAGGAACNGGGCCTACCTGGAGGGGATNNNCCTGATATTAGNCT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073181.5p                                                     CCACGCGTCCGACGTTTAAAGCTTTCCGGGAGTGCGGGCTGTGTTAAGACAAGCGGAACTGCAGGCTGTCAAAATCGAGACTGCTGGGCGGCTTTAAGGGACCTTAGAAAAGGGTTTATATCATTATTtacttttttgtggcttcagatttattttctacctttttttggcactttttCTTGCAATGAAAAAATTTGCATATTGTAAGGTGGTTTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGCTTTACTTCAGTGAATGCAACAAATGTGATGACAAGAAGGAACGGGGCCTACCTGGAGGGGATGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGT
  5   1   2       bld Ov1  5g                IMAGE:5073181-IMAGp.IMAGp                                                                ACGTTTAAAGCTTTCCGGGAGTGCGGGCTGTGTTAAGACAAGCGGAACTGCAGGCTGTCAAAATCGAGACTGCTGGGCGGCTTTAAGGGACCTTAGAAAAGGgtttatatcattatttacttttttgtggcttcagatttattttctacctttttttggcactttttCTTGCAATGAAAAAATTTGCATATTGTAAGGTGGTTTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGCTTTACTTCAGTGAATGCAACAAATGTGATGACAAGAAGGAACGGGGCCTACCTGGAGGGGATGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTA
  5   1   2       bld Ga12 5g3  in                         XL144p08.5p                                                                                     GGCGGGCTGTGTTAAGACAAGCGGAACTGCAGGCTGTCAAAATCGAGACTGCTGGGCGGCTTTAAGGGACCTTAGAAAAGGGTTTATATCATTATTtacttttttgtggcttcagatttattttctacctttttttggcactttttCTTGCAATGAAAAAATTTGCATATTGTAAGGTGGTTTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGCTTTACTTCAGTGAATGCAACAAATGTGATGACAAGAAGGAACGGGGCCTACCTGGAGGGGATGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTACATAGCGTAATAAATCGGTCACCACGACATTTATTACGAGAAATTGTTCTTGTAGATGATGCCAGTGAGAGAGACTTTTTGAAAAGAGCA
  5   1   2       bld Oo1                             IMAGE:6640351.5p                                                                                                                                                                                                                                                                                                                    GCTGCTTTACTTCAGTGAATGCAACAAATGTGATGACAAGAAGGAACGGGGCCTACCTGGAGGGGATGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTACATAGCGTAATAAATCGGTCACCACGACATTTATTACGAGAAATTGTTCTTGTAGATGATGCCAGTGAGAGAGACTTTTTGAAAAGAGCACTGGAGACATATGTAAAAAAACTTTCAGTACCTGTTCATGTAATACGGATGGAGCAGCGTTCAGGGTTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACGTTTTTAGATGCCCACTGCGAATGTACTGTAGGCTGGCTGGAGCCTTTGTTGGCACGCATAAATCATGACAGACGGACAGTAGTGTGTCCGATCATTGATGTTATCAGTGATGATACGTTTGAATATATGGCTGGTTCTGATATGACTTATGGTGGATTCCACTGGAAATAAACTTCCGTTGGTATCCTGTTCCCCAACGTGAAATGGATCGAAGAAGAAGTGATAGGACACTTCCCTGGGAGGACTTCTACTATGGGCAGGNAGGCCTCTTTTTCTTAGACCGAGATTATTTCCAGAAATAAGAACCTATGATGCTTGGAATGGACATTTTGGGGAAAGGAAAAATTTAGAAAAATCCTTTCCGAAAATGGGCAAGGGTGGGGGGGAACATAAAAAAA
  5   1   2       bld Egg1                               PBX0059G02.5p                                                                                                                                                                                                                                                                                                                                      CACGAGGGACAAGCGGAACTGCAGGCTGTCAAAATCGAGACTGCTGGGCGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTACATAGCGTAATAAATCGGTCACCACGACATTTATTACGAGAAATTGTTCTTGTAGATGATGCCAGTGAGAGAGACTTTTTGAAAAGAGCACTGGAGACATATGTAAAAAAACTTTCAGTACCTGTTCATGTAATACGGATGGAGCAGCGTTCAGGGTTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACGTTTTTAGATGCCCACT
  5   1   2       bld Eye1                            IMAGE:6957868.5p                                                                                                                                                                                                                                                                                                                                                   TCCGGATCCGTGCTGTTACACGAAGCTCTTCGGAGAGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTACATAGCGTAATAAATCGGTCACCACGACATTTATTACGAGAAATTGTTCTTGTAGATGATGCCAGTGAGAGAGACTTTTTGAAAAGAGCACTGGAGACATATGTAAAAAAACTTTCAGTACCTGTTCATGTAATACGGATGGAGCAGCGTTCAGGGTTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACGTTTTTAGATGCCCACTGCGAATGTACTGTAGGCTGGCTGGAGCCTTTGTTGGCACGCATAAATCATGACAGACGGACAGTAGTGTGTCCGATCATTGATGTTATCAGTGATGATACGTTTGAATATATGGCTGGTTCTGATATGACTTATGGTGGATTCAACTGGAAATTAAACTTCCGTTGGTATCCTGTTCCCCAACGTGAAATGGATCGAAGAAGAAGTGATAGGACACTTCCTGTGAGGACTCCTACTATGGCAGGAGGCCTCTTTTCCATAGACAGAGATTATTTCCAAGAAATAGGAACATATGATGCTGGAATGGACATTTGGGGAGGGAGAAAA
  5   1   2       bld Li1       out                   IMAGE:3396965.5p                                                                                                                                                                                                                                                                                                                                                             AGGAACGGGGCCTACCTGGAGGGGATGGTCCTGATATTAGTCTTAAACCACAAGAAGGCCCAGGCGAAATGGGAAAGCCTGTTGTTATTCTGAAAGAAGAGCAGGAAAGGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTCAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACAAAAGTGTACCCTGACAACCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACCACTTTATTAAGGACTGTACATAGCGTAATAAATCGGTCACCACGACATTTATTACGAGAAATTGTTCTTGTAGATGATGCCAGTGAGAGAGACTTTTTGAAAAGAGCACTGGAGACATATGTAAAAAAACTTTCAGTACCTGTTCATGTAATACGGATGGAGCAGCGTTCANGGTTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACGTTTTTAGATGCCCACTGCGAATGTACTGTACGCTGGCTGGAGCCTTTGTTGGCACGCATAAATTATGACAGACGGACAGTAGTGTGGACGATCATTGAGTTA
  5   1   2      skin Ga15      in                       XL450m07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATTGATGTTATCAGTGATGATACGTTTGAATATATGGCTGGTTCTGATATGACTTATGGTGGATTCAACTGGAAATTAAACTTCCGTTGGTATCCTGTTCCCCAACGTGAAATGGATCGAAGAAGAGGTGATAGGACACTTCCTGTGAGGACTCCTACTATGGCAGGAGGCCTCTTTTCCATAGACAGAGATTATTTCCAAGAAATAGGAACATATGATGCTGGAATGGACATTTGGGGAGGAGAAAATTTAGAAATATCTTTCCGTATATGGCAGTGTGGTGGTACATTAGAAATAGTGACTTGTTCACATGTTGGACATGTATTCCGAAAAGCCACACCTTACACTTTCCCAGGGGGCACAGGTCAAATCATTAACAAGAATAACAGACGGCTTGCAGAAGTCTGGATGGATGAATTCAAAAACTTCTTTTATATCATTTCACCTGGTGTGACTAAAGTTGACTATGGAGACATAGCTACCAGAGTAGGCCTAAGACATAAACTGCAGTGTAAGCCCTTTTCCTGGTACTTAGAAAATGTATACCCTGATTCCCAGATACCCCGTCATTATTACTCTTTGGGTGAGATTAGAAATGTTGAGACAAACCAGTGTCTGGACAATATGGCAAGAAAAGAAAATGAGAAAGTTGGTATCTTCAACTGCCATGGAATGGGAGGGAACCAGGTTTTCTCCTATACAGCTAGCAAAGAAATACGAACGGATGATTTATGTTTAGATGTCTCTAAACTTAATGGTCCANTTATAATGCTTAAGTGTCA
  5   1   2      ests                               Xl3.1-XL450m07ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAACAGAATAACAGACGGCTTGCAGAAGTCTGGATGGATGAATTCAAAAACTTCTTTTATATCATTTCACCTGGTGTGACTAAAGTTGACTATGGAGACATAGCTACCAGAGTAGGCCTAAGACATAAACTGCAGTGTAAGCCCTTTTCCTGGTACTTAGAAAATGTATACCCTGATTCCCAGATACCCCGTCATTATTACTCTTTGGGTGAGATTAGAAATGTTGAGACAAACCAGTGTCTGGACAATATGGCAAGAAAAGAAAATGAGAAAGTTGGTATCTTCAACTGCCATGGAATGGGAGGGAACCAGGTTTTCTCCTATACAGCTAGCAAAGAAATACGAACGGATGATTTATGTTTAGATGTCTCTAAACTTAATGGTCCAGTTATAATGCTTAAGTGTCACCACTTAAGAGGCAATCAGTTATGGGAGTATGATCCAGTGAAACTAACATTGGTGCATGTGAATAGTAACCAGTGCTTGGACAAAGCTGCAGAAGAGGACAGCCAAGTACCCAGCATCAGAGACTGCAATGGTGGCCACTCTCAGCAGTGGCTGTTACGCAATGTCACTCTCCCAGAGAATCTCTAAAATATTATTAGATGGAAAATAAAAACAAATTTATAAAATGATGACTGCGCTACCTCTGCACATGTGACTTGCACATCCTTTAGTATCCTAGGAAGGAAACTGTTTTCTGCAACTTTTGGATGGGGCACATATTAGCTCAGAATACTTACCTAGGGCTCTTCTGTAGCTGAAACCAGCCTACCCCTTAGAGGATGTAAACTGGCACACTTTGTATCATAACTGTGCACATTGACGTATACAAGGAGAATTACCTTCTCTCATCAAGGAATTGTTCAGGCAATGGGTATAGGACTTGGCGAACCATCCTGTTGGCTTCTGGGAGAGTTGCACAACAGGACCCTTTCTTGAATATTTGACTCTTTAAAATAGTACTTTGGTGAGAATCATATGCCAATGGCCGAATTTTTAAAAAAACAGTAGAATTCCAACGAAGATTTGCACAAAACGTTTCCACGTGCAAAAACAGGGAAAGATAAGATCAGATATATTGAAAGTACAATTTGTTATAATAAAAAAAATTGATTTATATGTAGTTTTATACCTCTGCTAAGACCATAACCAGATCACTTTTGTTTTAGTTGCTTGATAGCAACTAGAGTATATTTCTCATTATAGCAATCATAAATTTTAGAAATGGAAATGGACTGAATGTTGTTGTTTGTTCGGGAAACGATGAGTCGGGTTTGATTTTTAATATACACCTTTTTAAAAAGACTTTCCTTACCCCACTCAATGTTGCTTTTTCAATGGACACAACATATTAGATACATTTTAAAAATTAAAGTTTTGTCATACCCAGAGCTCTCTATAGTGTGCTATTCCATGCAGCAAAAACACTTTATTTTATAGGAGGAATCATTAAAAGTATATATTTCATTTATTACATAGGAGAGAGAACTATATTCT
                                                  Xl3.1-CHK-1012707605                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATAACAGACGGCTTGCAGAAGTCTGGATGGATGAATTCAAAAACTTCTTTTATATCATTTCACCTGGTGTGACTAAAGTTGACTATGGAGACATAGCTACCAGAGTAGGCCTAAGACATAAACTGCAGTGTAAGCCCTTTTCCTGGTACTTAGAAAATGTATACCCTGATTCCCAGATACCCCGTCATTATTACTCTTTGGGTGAGATTAGAAATGTTGAGACAAACCAGTGTCTGGACAATATGGCAAGAAAAGAAAATGAGAAAGTTGGTATCTTCAACTGCCATGGAATGGGAGGGAACCAGGTTTTCTCCTATACAGCTAGCAAAGAAATACGAACGGATGATTTATGTTTAGATGTCTCTAAACTTAATGGTCCAGTTATAATGCTTAAGTGTCACCACTTAAGAGGCAATCAGTTATGGGAGTATGATCCAGTGAAACTAACATTGGTGCATGTGAATAGTAACCAGTGCTTGGACAAAGCTGCAGAAGAGGACAGCCAAGTACCCAGCATCAGAGACTGCAATGGTGGCCACTCTCAGCAGTGGCTGTTACGCAATGTCACTCTCCCAGAGAATCTCTAAAATATTATTAGATGGAAAATAAAAACAAATTTATAAAATGATGACTGCGCTACCTCTGCACATGTGACTTGCACATCCTTTAGTATCCTAGGAAGGAAACTGTTTTCTGCAACTTTTGGATGGGGCACATATTAGCTCAGAATACTTACCTAGGGCTCTTCTGTAGCTGAAACCAGCCTACCCCTTAGAGGATGTAAACTGGCACACTTTGTATCATAACTGTGCACATTGACGTATACAAGGAGAATTACCTTCTCTCATCAAGGAATTGTTCAGGCAATGGGTATAGGACTTGGCGAACCATCCTGTTGGCTTCTGGGAGAGTTGCACAACAGGACCCTTTCTTGAATATTTGACTCTTTAAAATAGTACTTTGGTGAGAATCATATGCCAATGGCCGAATTTTTAAAAAAACAGTAGAATTCCAACGAAGATTTGCACAAAACGTTTCCACGTGCAAAAACAGGGAAAGATAAGATCAGATATATTGAAAGTACAATTTGTTATAATAAAAAAAATTGATTTATATGTAGTTTTATACCTCTGCTAAGACCATAACCAGATCACTTTTGTTTTAGTTGCTTGATAGCAACTAGAGTATATTTCTCATTATAGCAATCATAAATTTTAGAAATGGAAATGGACTGAATGTTGTTGTTTGTTCGGGAAACGATGAGTCGGGTTTGATTTTTAATATACACCTTTTTAAAAAGACTTTCCTTACCCCACTCAATGTTGCTTTTTCAATGGACACAACATATTAGATACATTTTAAAAATTAAAGTTTTGTCATACCCAGAGCTCTCTATAGTGTGCTATTCCATGCAGCAAAAACACTTTATTTTATAGGAGGAATCATTAAAAGTATATATTTCATTTATTACATAGGAGAGAGAACTA
  5   1   2       bld Eye1                            IMAGE:6957777.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAACAGAATAACAGACGGCTTGCAGAAGTCTGGATGGATGAATTCAAAAACTTCTTTTATATCATTTCACCTGGTGTGACTAAAGTTGACTATGGAGACATAGCTACCAGAGTAGGCCTAAGACATAAACTGCAGTGTAAGCCCTTTTCCTGGTACTTAGAAAATGTATACCCTGATTCCCAGATACCCCGTCATTATTACTCTTTGGGTGAGATTAGAAATGTTGAGACAAACCAGTGTCTGGACAATATGGCAAGAAAAGAAAATGAGAAAGTTGGTATCTTCAACTGCCATGGAATGGGAGGGAACCAGGTTTTCTCCTATACAGCTAGCAAAGAAATACGAACGGATGATTTATGTTTAGATGTCTCTAAACTTAATGGTCCAGTTATAATGCTTAAGTGTCACCACTTAAGAGGCAATCAGTTATGGGAGTATGATCCAGTGAAACTAACATTGGTGCATGTGAATAGTAACCAGTGCTTGGACAAAGCTGCAGAAGAGGACAGCCAAGTACCCAGCATCAGAGACTGCAATGGTGGCCACTCTCAGCAGTGGCTGTTACGCAATGTCACTCTCCCAGAGAATCTCTAAAATATTATTAGATGGAAAATAAAAACAAATTTATAAAATGATGACTGCGCTACCTCTGCACATGTGACTTGCACATCCTTTAGTATCCTAGGAAGGAAACTGTTTTCTGCAACTTTTGGATGGGGCACATATTAGCTCAGAATACTTACCTAGGGCTCTTCTGTAGCTGAAACCAGCCTACCCCTTAGAGGATGTAAACTGGCACACTTTGTATCATAACTGTGCACATTGACGTATACAAGGAAGAATTT
  3   1   2      seed Ga15      in                       XL450m07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCTGCACATGTGACTTGCACATCCTTTAGTATCCTAGGAAGGAAACTGTTTTCTGCAACTTTTGGATGGGGCACATATTAGCTCAGAATACTTACCTAGGGCTCTTCTGTAGCTGAAACCAGCCTACCCCTTAGAGGATGTAAACTGGCACACTTTGTATCATAACTGTGCACATTGACGTATACAAGGAGAATTACCTTCTCTCATCAAGGAATTGTTCAGGCAATGGGTATAGGACTTGGCGAACCATCCTGTTGGCTTCTGGGAGAGTTGCACAACAGGACCCTTTCTTGAATATTTGACTCTTTAAAATAGTACTTTGGTGAGAATCATATGCCAATGGCCGAATTTTTAAAAAAACAGTAGAATTCCAACGAAGATTTGCACAAAACGTTTCCACGTGCAAAAACAGGGAAAGATAAGATCAGATATATTGAAAGTACAATTTGTTATAATAAAAAAAATTGATTTATATGTAGTTTTATACCTCTGCTAAGACCATAACCAGATCACTTTTGTTTTAGTTGCTTGATAGCAACTAGAGTATATTCTCATA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073181.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGTGACTTGCACATCCTTTAGTATCCTAGGAAGGAAACTGTTTTCTGCAACTTTTGGATGGGGCACATATTAGCTCAGAATACTTACCTAGGGCTCTTCTGTAGCTGAAACCAGCCTACCCCTTAGAGGATGTAAACTGGCACACTTTGTATCATAACTGTGCACATTGACGTATACAAGGAGAATTACCTTCTCTCATCAAGGAATTGTTCAGGCAATGGGTATAGGACTTGGCGAACCATCCTGTTGGCTTCTGGGAGAGTTGCACAACAGGACCCTTTCTTGAATATTTGACTCTTTAAAATAGTACTTTGGTGAGAATCATATGCCAATGGCCGAATTTTTAAAAAAACAGTAGAATTCCAACGAAGATTTGCACAAAACGTTTCCACGTGCAAAAACAGGGAAAGATAAGATCAGATATATTGAAAGTACAATTTGTTATAATAAAAAAAATTGATTTAAAAAAAAAAAAAAAG
  3   1   2       bld Ga12 5g3  in                         XL144p08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGAGTTGCACAACAGGACCCTTTCTTGAATATTTGACTCTTTAAAATAGTACTTTGGTGAGAATCATATGCCAATGGCCGAATTTTTAAAAAAACAGTAGAATTCCAACGAAGATTTGCACAAAACGTTTCCACGTGCAAAAACAGGGAAAGATAAGATCAGATATATTGAAAGTACAATTTGTTATAATAAAAAAAATTGATTTATATGTAGTTTTATACCTCTGCTAAGACCATAACCAGATCACTTTTGTTTTAGTTGCTTGATAGCAACTAGAGTATATTTCTCATTATAGCAATCATAAATTTTAGAAATGGAAATGGACTGAATGTTGTTGTTTGTTCGGGAAACGATGAGTCGGGTTTGATTTTTAATATACACCTTTTTAAAAAGACTTTCCTTACCCCACTCAATGTTGCTTTTTCAATGGACACAACATATTAGATACATTTTAAAAATTAAAGTTTTGTCATACCCAGAGCTCTCTATAGTGTGCTATTCCATGCAGCAAAAACACTTTATTTTATAGGAGGAATCATTAAAAGTATATATTTCATTTATTACATAGGAGAGAGAACTATATTCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)