Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:7980543.3                      10 END     1           5       10                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7203941.5.5                    76 PI      88       1271     1406                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:4201817-IMAGp.5                50 PI      86       1241     1421                MGC83430 protein [Xenopus laevis]
     4   0.0    0Xl3.1-xl282j08.5.5                         22 PI      89       1241     1405                (no blast hit)
     5   0.0    0Xl3.1-XL196l21.3                           13 PI      92       1241     1409                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:6955195.5                      10 PI      89        809     1180                retinaldehyde binding protein 1 [Xenopus tropicalis]
     7   0.0    0Xl3.1-IMAGE:6325043.5                       6 PI      88       1241     1420                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:4061508.5                       4 PI      88       1241     1391                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012838459 Xl3.1-IMAGE:6955359.5.5 - 20 ESTs
                                                                       .-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6955359.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCTGCTTTATTAACACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTATTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGATTTAAGGCTGTACACTTTATTCATCAGCCCTGGTACTTCACTACCACATACAATGTTGTGAAACCGTTCCTGAAGAGCAAGCTACTGGAGAGGGTGTTTGTACATGGAGACGGCCTGGAAGGCTTCTTCAAGGAAATAGATGCTGACATCCTGCCAGCTGACTTTGGGGGGAATCTGCCAAAATATGACGGGAAAATTATCGCTGAGAAACTTTTTGGGCCAAGAAACGAATCAGAAGACACTGCTCTTTAAAGTATATATGAAATATATGTTTTATTCCCAAGTTGCTTAGTTCTAGCTCTGTTCATGTTAAGTCATTACTATTCCCTCTTAGATGTATATACAGTATGTATTTTTTGTAAGAATGCATCCTTCCGCACAGTCAAAGAGCACCACTATAATAATACATTATTATAGACAAATGGTATTCTGTATTCTGCAACTTTGGGCGACTATTGAAAACGCATTGCCGCGTGTGCATTAACGCAGGCGTCTTTTCATTGTAGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTAGGGGATACTTATATCTGTCATCCTAATGAGATTGCAAACCCTATGCCCACTCAAACTTTCCCACATTTAACCTTGTTCCACCCCCAAGTCTTGTATCTGGTTTTCAAGGAATAAGGGACTGAAAAGGAAATGTGGGGCAGCTGGCAGGTATGATTAGTAGTAAACATTAAGGGGTATATTCATCAAACGATGTTAAAAAAGGGCGAGTAAATACACCACTCACTGAACGGCATATGTGAAGCTGTTGATTTATTTCTGCTTAGAATTCTGCCTTCAAAAACAGCAGCAACTCAAAAAAAAATTCTCATTGACTTGAACGGGTTACACCATAAAATAATGGCTTATAATAATGCCTCTAAACATGGCGATAGGGTGGTATAAAAGAAAATGATTTCTTTCACTTTTTTTTCCAGTGTAAATAATATTACACTCTTAAGTGCAGCAATCAAATATGTACTTAAATAGACCCAACAGTTCCCCAGTAGGGTCTCTGACTGAAGTGTAAAGGCCCCCATATACGGGGCGATAAAAGCTGCAGACAGACCATGTGTGGGGCCATGCAACGGGGTTCCCTGAAAGTCGGCCAGATCTCGATCAGGCAAGTTAAAAAATCCCGTAGGATCGCAAGCACA
                                                  Xl3.1-CHK-1012722462                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTATTAACACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTCTTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGATTTAAGGCTGTACACTTTATTCATCAGCCCTGGTACTTCACTACCACATACAATGTTGTGAAACCGTTCCTGAAGAGCAAGCTACTGGAGAGGGTGTTTGTACATGGAGACGGCCTGGAAGGCTTCTTCAAGGAAATAGATGCTGACATCCTGCCAGCTGACTTTGGGGGGAATCTGCCAAAATATGACGGGAAAATTATCGCTGAGAAACTTTTTGGGCCAAGAAACGAATCAGAAGACACTGCTCTTTAAAGTATATATGAAATATATGTTTTATTCCCAAGTTGCTTAGTTCTAGCTCTGTTCATGTTAAGTCATTACTATTCCCTCTTAGATGTATATACAGTATGTATTTTTTGTAAGAATGCATCCTTCCGCACAGTCAAAGAGCACCACTATAATAATACATTATTATAGACAAATGGTATTCTGTATTCTGCAACTTTGGGCGACTATTGAAAACGCATTGCCGCGTGTGCATTAACGCAGGCGTCTTTTCATTGTAGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTAGGGGATACTTATATCTGTCATCCTAATGAGATTGCAAACCCTATGCCCACTCAAACTTTCCCACATTTAACCTTGTTCCACCCCCAAGTCTTGTATCTGGTTTTCAAGGAATAAGGGACTGAAAAGGAAATGTGGGGCAGCTGGCAGGTATGATTAGTAGTAAACATTAAGGGGTATATTCATCAAACGATGTTAAAAAAGGGCGAGTAAATACACCACTCACTGAACGGCATATGTGAAGCTGTTGATTTATTTCTGCTTAGAATTCTGCCTTCAAAAACAGCAGCAACTCAAAAAAAAATTCTCATTGACTTGAACGGGTTACACCATAAAATAATGGCTTATAATAATGCCTCTAAACATGGCGATAGGGTGGTATAAAAGAAAATGATTTCTTTCACTTTTTTTTCCAGTGTAAATAATATTACACTCTTAAGTGCAGCAATCAAATATGTACTTAAATAGACCCAACAGTTCCCCAGTAGGGTCTCTGACTGAAGTGTAAAGGCCCCCATATACGGGGCGATAAAAGCTGCAGACAGACCATGTGTGGGGCCATGCAACGGGGTTCCCTGAAAGTCGGCCAGATCTCGATCAGGCAAGTTAAAAAATCCCGTAGGATCGCAAGCACATCTGAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 2     3     5     5     7     7     7     7     8     8     8     8     8     8     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    11    11    11    11     9    11    11    11    11    11    11    11    10    10    10    10     9     9     9     9     8     9     9     9     8     9     9    10     9    10     9    11     9    11     9    11     9    11     9    11     9    11     8    11     8    10     7     9     7     9     6     9     6     9     7    11     7    11     7    11     7    11     6    11     6    11     6    10     6    10     6     9     6     8     6     8     6     7     6     7     5     7     5     7     5     6     6     6     6     6     6     6     6     6     5     6     5     6     5     7     3     7     4     7     3     7     3     7     3     7     3     6     3     6     3     6     3     6     3     5     4     6     4     6     4     6     4     7     4     7     3     7     4     7     4     7     4     7     4     7     4     7     5     7     5     7     5     7     5     7     5     7     4     7     5     7     5     7     5     7     4     7     4     7     4     7     4     7     2     7     2     7     2     7     2     7     2     7     2     6     2     6     2     6     2     6     2     6     2     6     3     7     3     7     3     7     3     7     3     7     3     5     2     5     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
  5   1   2       e50                            Xl3.1-IMAGE:6955359.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCTGCTTTATTAACACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTATTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGATTTAAGGCTGTACACTTTATTCATCAGCCCTGGTACTTCACTACCACATACAATGTTGTGAAACCGTTCCTGAAGAGCAAGCTACTGGAGAGGGTGTTTGTACATGGAGACGGCCTGGAAGGCTTCTTCAAGGAAATAGATGCTGACATCCTGCCAGCTGACTTTGGGGGGAATCTGCCAAAATATGACGGGAAAATTATCGCTGAGAAACTTTTTGGGCCAAGAAACGAATCAGAAGACACTGCTCTTTAAAGTATATATGAAATATATGTTTTATTCCCAAGTTGCTTAGTTCTAGCTCTGTTCATGTTAAGTCATTACTATTCCCTCTTAGATGTATATACAGTATGTATTTTTTGTAAGAATGCATCCTTCCGCACAGTCAAAGAGCACCACTATAATAATACATTATTATAGACAAATGGTATTCTGTATTCTGCAACTTTGGGCGACTATTGAAAACGCATTGCCGCGTGTGCATTAACGCAGGCGTCTTTTCATTGTAGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTAGGGGATACTTATATCTGTCATCCTAATGAGAT
  5   1   2       e50                            Xl3.1-IMAGE:4740267.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         NGGAATAGAGCGCAGTGGAGGATTTTAAGGGATAATTGTCGAGTAAAAATGTTTTGGTGGGATGGATCATTAGTTGAATAAATAAAGGCATTTTGTTCTCTGTGGGATGGAAGTATGAGTAATGGGCAAGTGGTAATTGTTTTTTAACAGAGGAGAAGAACGTATTATGGGGTTGGATAACAGCGTCATGAAAGGCCGAAATCTGCGGTAGGAGATAATTTTGTCGCCTTATAATAGAGATAGGTTGGGTGTATTTCGATTACCATTGTAGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTAGGGGATACTTATATCTGTCATCCTAATGAGATTGCAAACCCTATGCCCACTCAAACTTTCCCACATTTAACCTTGTTCCACCCCCAAGTCTTGTATCTGGTTTTCAAGGAATAAGGGACTGAAAAGGAAATGTGGGGCAGCTGGCAGGTATGATTAGTAGTAAACATTAAGGGGTATATTCATCAAACGATGTTAAAAAAGGGCGAGTAAATACACCACTCACTGAACGGCATATGTGAAGCTGTTGATTTATTTCTGCTTAGAATTCTGCCTTCAAAAACAGCAGCAACTCAAAAAAAAATTCTCATTGACTTGAACGGGTTACACCATAAAATAATGGCTTATAATAATGCCTCTAAACATGGCGATAGGGTGGTATAAAAGAAAATGATTTCTTTCACTTTTTTTTCCAGTGTAAATAATATTACACTCTTAAGTGCAGCAATCAAATATGTACTTAAATAGACCCAACAGTTCCCCAGTAGGGTCTCTGACTGAAGTGTAAAGGCCCCCATATACGGGGCGATAAAAGCTGCAGACAGACCATGTGTGGGGCCATGCAACGGGGTTCCCTGAAAGTCGGCCAGATCTCGATCAGGCAAGTTAAAAAATCCCGTAGGATCGCAAGCACATCTGATTGCAATAAACATTTTGGGAAAGAATGATTGAATTGGTGCGTGGAAACGAAAATGGGACTAAGTGTGAGAGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            C-----------
                                               BLH ATG     100    1257                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               BLH MIN      85     155                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               BLH OVR     100    1288                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               EST CLI      -1       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               ORF LNG     100      70                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                                                       PROTEIN --- Ce ---- 8e-010     NP_001040875.1 T23G5.2a [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - ?? ---- 1e-014     XP_581476.4 PREDICTED: similar to Protein tyrosine phosphatase, non-receptor type 9 [Bos taurus] ----------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 2e-034     NP_609119.2 CG5958-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 9e-039     XP_001179908.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Ag ==== 1e-044     XP_317327.4 AGAP008133-PA [Anopheles gambiae str. PEST] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 8e-137     NP_991253.1 retinaldehyde binding protein 1 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 8e-141     NP_000317.1 retinaldehyde binding protein 1; Retinaldehyde-binding protein-1 (cellular);retinaldehyde-binding protein 1 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Cf ==== 7e-141     XP_549634.2 PREDICTED: similar to retinaldehyde binding protein 1 [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Bt ==== 6e-142     NP_776876.2 retinaldehyde binding protein 1 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 4e-142     NP_065624.1 retinaldehyde binding protein 1; retinaldehyde-binding protein 1 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Gg ==== 4e-155     NP_001019865.1 retinaldehyde binding protein 1 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 2e-174     CAJ83222.1 retinaldehyde binding protein 1 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 0          NP_001080386.1 retinaldehyde binding protein 1 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:6955359.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGA---------------TGA------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------TAG---------------------------------------TGA------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------TAA---------------ATG------------------TGA------------------------------------ATG---------------TAA------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------TAA------ATG------------------------------------------------------------------------TAG------------------------------TGA---------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2       e50                            Xl3.1-IMAGE:6955359.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCTGCTTTATTAACACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTATTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGATTTAAGGCTGTACACTTTATTCATCAGCCCTGGTACTTCACTACCACATACAATGTTGTGAAACCGTTCCTGAAGAGCAAGCTACTGGAGAGGGTGTTTGTACATGGAGACGGCCTGGAAGGCTTCTTCAAGGAAATAGATGCTGACATCCTGCCAGCTGACTTTGGGGGGAATCTGCCAAAATATGACGGGAAAATTATCGCTGAGAAACTTTTTGGGCCAAGAAACGAATCAGAAGACACTGCTCTTTAAAGTATATATGAAATATATGTTTTATTCCCAAGTTGCTTAGTTCTAGCTCTGTTCATGTTAAGTCATTACTATTCCCTCTTAGATGTATATACAGTATGTATTTTTTGTAAGAATGCATCCTTCCGCACAGTCAAAGAGCACCACTATAATAATACATTATTATAGACAAATGGTATTCTGTATTCTGCAACTTTGGGCGACTATTGAAAACGCATTGCCGCGTGTGCATTAACGCAGGCGTCTTTTCATTGTAGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTAGGGGATACTTATATCTGTCATCCTAATGAGAT
                                                  Xl3.1-CHK-1012691282                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTATTAACACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTCTTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGATTTAAGGCTGTACACTTTATTCATCAGCCCTGGTACTTCACTACCACATACAATGTTGTGAAACCGTTCCTGAAGAGCAAGCTACTGGAGAGGGTGTTTGTACATGGAGACGGCCTGGAAGGCTTCTTCAAGGAAATAGATGCTGACATCCTGCCAGCTGACTTTGGGGGGAATCTGCCAAAATATGACGGGAAAATTATCGCTGAGAAACTTTTTGGGCCAAGAAACGAATCAGAAGACACTGCTCTTTAAAGTATATATGAAATATATGTTTTATTCCCAAGTTGCTTAGTTCTAGCTCTGTTCATGTTAAGTCATTACTATTCCCTCTTAGATGTATATACAGTATGTATTTTTTGTAAGAATGCATCCTTCCGCACAGTCAAAGAGCACCACTATAATAATACATTATTATAGACAAATGGTATTCTGTATTCTGCAACTTTGGGCGACTATTGAAAACGCATTGCCGCGTGTGCATTAACGCAGGCGTCTTTTCATTGTAGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTxACCCxTAGGGGATACTTATATCTGTCATCCTAATGAGATTGCAAA
  5   1   2      seed Brn1 5g                IMAGE:4740665-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGGGGTTGGGGTCCGGGTCCGGGAATTCCCGGGATTTCTGCCCAATCCGTCCTGCTTTATTAAACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATACGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTATTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCCAGCTTCAGGCA
  5   1   2       bld Tad1 5g3  in                    IMAGE:6878468.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGAGCACAGATCTTGGGTACGTTCTGCCCATCCGTCCTGCTTTATTAACACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATACGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTCTTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGGAGAATTTTCAAAGGATTCA
  5   1   2       bld Brn1 5g                         IMAGE:6955359.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCCTGCTTTATTAACACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCAGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTCTTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTATGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGATTTTAAGCTGTACACTTTATTCATCAGCCCCTGGTACTTCACTACCACATACAATGTTTGT
  5   1   2       bld Brn1 5g3  in                    IMAGE:4740267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATTAACACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTTTGAAAGACCTTCGGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTCTNTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAA
  5   1   2       bld Brn1 5g3  in                    IMAGE:4740665.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTAACACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCATGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATACGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTATTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGN
  5   1   2       bld Brn1 5g                         IMAGE:6952690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCAGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTCTTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTTACATTGAAAATTGGGGACTATGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTTCTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGGCTTCTGCATTATTTGAGAATTTCAAAGGATTCACCCATGCCAGCAAGCTTCCGGGATTAAAGCCATCCGAACTGAAAGAAAATGGGGGGACATGCCTCCAGGAACTCGGTTTCCCAAGCAAGAATTAGAGGGGGGAACCCTTTTATTTCTCCAACCCCCTGGTAACTTTCCCTTACCCCAATTCCAATGGTTTGGGGAAAACCCGTTCCCGGAAAAAGAA
  5   1   2       bld Brn1 5g                         IMAGE:6951871.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCTTGACTTGCTTTTGGTAGCTGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTATTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAGCTGAAAAAAATGGTGGAACATGTCTACAGGGACTCCGTTCCCAGCCCAGATTTTAAGGGCTGTTACACCTTTTATTCCATCAGGCCCCTGGGGTACTTTTCACTACCAACCATTATCAAT
  5   1   2       bld Brn1 5g                         IMAGE:6953504.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAGCCAAACCAGCACTTGTGCCACTCTTTTGCGCTCCTTGCGTGAAGACAGAAGAAGTCAAATGTCAGAGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCAGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTCTTTGAGGAGCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATGCAGGAATCTTGAGCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAAGATTGAAAATTGGGACTATGAGGAGATCACCTTGGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAGACTTGCTGGAGAAGCAGGAGACTCAGATTGATGGGTTCCGGATTGTTGGGAATTTGGGAGGAGTTGCCGTGGCGGCAAGCCTGCAGGCAGTAGAGGGGTTCCGAAGCTGaaaaaaaaGGGGGGGACATGGCGAACGGGGACTCCGTGTCCCAAGCCCAGAATGTTGAAGGGGTGGGGACAACTTTTGAATTCCAGCCAAGGAGCCTGGGGATACTGTCCGCTTAAGCCGAGAAGT
  5   1   2       bld Brn1                            IMAGE:6952006.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGCTGGTACNNCGGTCCGGAATTCTCCGGGATGATAACTGGAACCTATCGCATTGTCTCTGAGGAGGAACAGTCTCTCAGGGCCAAGCTTGAGCGGCTCACTACTAAAGACCATGGCTCAGTCTTTGGTAAATGTGGGAAGCTACCAGAGTACACCGTGCAGAAGGCCAAAGATGAATTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTATTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAACTGAAGAAAATGGTGGACATGCTACAGGGACTCGTTCCCCGCCAGATTTAAAGGTGGACACTTTATTTCCTCAACCCTGGGTACTTCACTACCACAATAAAATGGTTGGGGAAACCGGTTCCCTGAAAAAACAAGGCTCCTGGAAAAGGGTGGTTTGGTACCTTGGAAAACGGGCCTGGAAAGGCTTCTTTCAAGGGAAATAAGAAGCCTGACC
  5   1   2       bld Brn1      ?                     IMAGE:6951060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAAATGAGACAGAAGAGAATAGAGAATCGGCTGTGAAAGACCTTCTGGCACTGGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTTCTTCCTGAGGTTCATTCGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAAACTTCCGCCAGCAGTACCCAGAACTATTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGATTTAAGGCTGTACACTTTATTCATCAGCCCTGGTACTTCACTACCACATACAATGTTGTGAAACCGTTCCTGAAGAGCAAGCTACTGGAGAGGGTGTTTGTACATGGAGACGGCCTGGAAGGCTTCTTCAGGGAATAGATGCTGACATCCTGCCAGCTGACTTTGGGGGGGAATCTGCCAAAATATGACGGAAAAATTATCGCTGAGAAACTTTTTTGGGCCCCAGAAACGAATCAGAAGACACTGGCTCTTTAAAAGTGAAATATATGTTTTTTATTCCCCAAAGTTTGCTTT
  3   1   2       bld Tad1 5g3  in                    IMAGE:6878468.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTAAAGACCTTCTGGCACTGTTCAGGAGAAGGCCAAGGCAGGGGATGAGCTGTGCAAAGCAGTGGCCGAGAAAGTCAAAGACAAGGAAAATAATTCTTTCCTGAGGTTCATACGGGCCCGGAAATTTGATGTGAGCCGAGCCTATGAACTCCTGAAAGGATATGTAACTTCCGCCAGCAGTACCCAGAACTCTTTGAGGACCTGACACCCGAGGCGGTGCGGAGCACTATTGAAGCCGGATATCCAGGAATCTTGACCAGCAGAGATAAGAACGGCAGAGTTATCCTCCTTTTTAACATTGAAAATTGGGACTACGAGGAGATCACCTTTGATGAGATCCTCCGAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGATTTAAGGCTGTACACTTTATTCATCAGCCCTGGTACTTCACTACCACATACAATGTTGTGAAACCGTTCCTGAAGAGCAAGCTACTGGAGAGGGTGTTTGTACATGGAGACGGCCTGGAAGGCTTCTTCAAGGAAATAGATGCTGACATCCTGCCAGCTGACTTTGGGGGGAATCTGCCAAAATATGACGGGAAAATTATCGCTGAGAAACTTTTTGGGCCAAGAAACGAATCAGAAGACACTGCTCTTTAAAGTGAAATATATGTTTTATTCCCAAAGTTGCTTAGTTCTAGCTCTGTTCATGCTAAGTCATTACTATTCCCTCTTAGATGTATATACAGTATGTAATTTTTGTAAGAATGCATCCTT
  5   1   2       bld Brn1                            IMAGE:4740997.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCACCTTTGATGAGATCCTCCTAGCTTACTGCATTATACTGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGATTTAAGGCTGTACACTTTATTCATCAGCTCTGGTACTTCACTACCACATACAATGTTGTGAAACCGTTCCTGAAGAGCAAGCTACTGGAGAGGGTGTTTGTACATGGAGACGGCCTGGAAGGCTTCTTCAAGGAAATAGATGCTGACATCCTGCCAGCTGACTTTGGGGGGAATCTGCCAAAATATGACGGGAAAATTATCGCTGAGAAACTTTTTGGGCCAAGAAACGAATCAGAAGACACTGCTCTTTAAAGTGAAATATATGTTTTATTCCCAAAGTTGCTTAGTTCTAGCTCTGTTCATGTTAAGTCATTACTATTCCCT
  5   1   2       bld Brn1      in                    IMAGE:6950340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTCCGGAATTCCCGGGATGGAGAACTTGCTGGAAAACGAGGAGACTCAGATTAATGGCTTCTGCATTATTGAGAATTTCAAAGGATTCACCATGCAGCAAGCTTCAGGCATAAAGCCATCCGAGCTGAAGAAAATGGTGGACATGCTACAGGACTCGTTCCCAGCCAGATTTAAGGCTGTACACTTTATTCATCAGCCCTGGTACTTCACTACCACATACAATGTTGTGAAACCGTTCCTGAAGAGCAAGCTACTGGAGAGGGTGTTTGTACATGGAGACGGCCTGGAAGGCTTCTTCAAGGAAATAGATGCTGACATCCTGCCAGCTGACTTTGGGGGGAATCTGCCAAAATATGACGGGAAAATTATCGCTGAGAAACTTTTTGGGCCAAGAAACGAATCAGAAGACACTGCTCTTTAAAGTATATATGAAATATATGTTTTATTCCCAAGTTGCTTAGTTCTAGCTCTGTTCATGTTAAGTCATTACTATTCCCTCTTAGATGTATATACAGTATGTATTTTTTGTAAGAATGCATCCTTCCGCACAGTCAAAGAGCACCACTATAATAATACATTATTATAGACAAATGGTATTCTGTATTCTGCAACTTTGGGCGACTATTGAAAACGCATTGCCGCGTGTGCATTAACGCAGGCGTCTTTTCATTGTAGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTTAGGGATACTTATATCTGGCATCCTAATGAGATTGCAAACCCTATGCCCCACTTCAAACTTTCCCACCATTTAACCCTGGTTCCACCCCCCAAGTCCTTGGCATCCGGGTA
  5   1   2       bld Brn1      in                    IMAGE:6956684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGACATGCTACAGGACTCTTTCCCAGCCAGATTTAAGGCTGTACACTTTATTCATCAGCCCTGGTACTTCACTACCACATACAATGTTGTGAAACCGTTCCTGAAGAGCAAGCTACTGGAGAGGGTGTTTGTACATGGAGACGGCCTGGAAGGCTTCTTCAAGGAAATAGATGCTGACATCCTGCCAGCTGACTTTGGGGGGAATCTGCCAAAATATGACGGGAAAATTATCGCTGAGAAACTTTTTGGGCCAAGAAACGAATCAGAAGACACTGCTCTTTAAAGTATATATGAAATATATGTTTTATTCCCAAGTTGCTTAGTTCTAGCTCTGTTCATGTTAAGTCATTACTATTCCCTCTTAGATGTATATACAGTATGTATTTTTTGTAAGAATGCATCCTTCCGCACAGTCAAAGAGCACCACTATAATAATACATTATTATAGACAAATGGTATTCTGTATTCTGCAACTTTGGGCGACTATTGAAAACGCATTGCCGCGTGTGCATTAACGCAGGCGTCTTTTCATTGTAGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTAGGGGATACTTATATCTGTCATCCTAATGAGATTGCAAACCCCTATGCCCACTCAAACTTTCCCACATTTAACCTTTGTTCCACCCCCCAAAGTCTTGTATCTGGGTTTTCCAAGGGAATTAAGGGGAACTGAAAAAAGGAAAATGTGGGGGGCCAAGCTGGGCAAGGGTAATGAATTTAAGGTAGGTTAAAACCATTTTAAGAGGGGGGGTATAAATTTCCCATCCCAAAACCGGAATGC
  5   1   2       bld Brn1                            IMAGE:6949951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACATGCTACAGGACTCGTTCCCAGCCAGATTTAAGGCTGTACACTTTATTCATCAGCCCTGGTACTTCACTACCACATACAATGTTGTGAAACCGTTCCTGAAGAGCAAGCTACTGGAGAGGGTGTTTGTACATGGAGACAGCCTGGAAGGCTTCTTCAAGGAAATAGATGCTGACATTCTGCCAGCTGACTTTGGGGGGAATCTGCCAAAATATGACGGGAAAATTATCGCTGAGAAACTTTTTGGGCCAAGAAACGAATCAGAAGACACTGCTCTTTAAAGTACATATGAAATATATGTTTTATTCCCAAGTTGCTTAGTTCTAGCTCTGTTCATGTTAAGTCATTACTATTCCCTCTTAGATGTATATACAGTATGTATTTTTTGTAAGAATGCATCCTTCCGCACAGTCAAAGAGCACCACTATAATAATACATTATTATAGACAAATGGTATTCTGTATTCATCTTATAGTGAAGCAACTTTGGGCGACTATTGAAAACGCATCGCCGCGTGTGCATTAACGCAGGCGTCTTTTCATTGTAGCCTATGGGGAACAACGTTGAGGCAGTTTGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCCGACGACAAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTAGGGGATACTTATATCTGTCATCCTAATGAGATTGCAAACCCTATGCCCACTCAAACTTTCCCCCATTTAACCTTGATCCACCCCCCAGTCTTGTATCTGGTTCTTCAGGAAATAAGGGGACTGAAAAGGAAATGTGGGGGCAGCTGGGCAAGTATGATTTAGTATTAAACCATTAAGGGGGTATATTCCTTCAAACCGAGGTTTAAAAAGGGGCCGAGTAAATTACACCCCCTTCACTGGAACGGCCTTATGTGAA
  3  -1   1       add Ga15      out                      XL507f09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAATGGCATAAGACAGACATGAGACAGTTTAGTTTGGAACACAGGGATTTGCTACAGCTGGCAGAGGATTGTGGGAATTGTAGGAAGTAATGAAGCAGCATTCTGTTCTGCTTCCCCCTCATACCCCACCTGTTCAAGCAACACGGGCTGGGAGGAAACTTCGGGCGACTATGGAAAATGCATCGCCGCGTGTGCTTTAGTGCAGGCGACTTTTCTTTATAGCCTATGGGAAAAAACGATGAGGCAGTTTGGGGAGATTGTTGCTCAGAAGACGAGGCGATTAGACAAAATTAGACAAAATCTCCCCGAATCCCCTCGTGTGAACTAACCCGTAGGCACTTATAACACACAGACGCACATAAATATAAACATTACCCTTTTGTCTGTGCTCAGGGGAGCGTGATGAGTTAATAGAAGGCTGAATGGCGGTGCCAAGCCGAGGAGAAGAGAGGGAAGAGGTGATCACATGAGACATCTCCACAGGCAGCAGAGAAAGTGCAGAGACACAAGCACTGCANTAACAGAGCTGTATACAAACTGTCTCTAAGCAACCACAAAAGCCACACGCTAACTAACCAAACTGCCTGCTATAAACTGTCANTACAACCTAACTGCCTGCTATAATCTGGCAGTACAACCTANCCTGTCAGATATAATCTGGCAGTACAACCCAACTGCCAGCTATAATATGGCAGTAGAACCCACCTGTCNAACTATAATCTGGCAGTACAACCCAACTGCCTGCAGTAATCTG
  5   1   2       e50                            Xl3.1-IMAGE:4740267.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         NGGAATAGAGCGCAGTGGAGGATTTTAAGGGATAATTGTCGAGTAAAAATGTTTTGGTGGGATGGATCATTAGTTGAATAAATAAAGGCATTTTGTTCTCTGTGGGATGGAAGTATGAGTAATGGGCAAGTGGTAATTGTTTTTTAACAGAGGAGAAGAACGTATTATGGGGTTGGATAACAGCGTCATGAAAGGCCGAAATCTGCGGTAGGAGATAATTTTGTCGCCTTATAATAGAGATAGGTTGGGTGTATTTCGATTACCATTGTAGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTAGGGGATACTTATATCTGTCATCCTAATGAGATTGCAAACCCTATGCCCACTCAAACTTTCCCACATTTAACCTTGTTCCACCCCCAAGTCTTGTATCTGGTTTTCAAGGAATAAGGGACTGAAAAGGAAATGTGGGGCAGCTGGCAGGTATGATTAGTAGTAAACATTAAGGGGTATATTCATCAAACGATGTTAAAAAAGGGCGAGTAAATACACCACTCACTGAACGGCATATGTGAAGCTGTTGATTTATTTCTGCTTAGAATTCTGCCTTCAAAAACAGCAGCAACTCAAAAAAAAATTCTCATTGACTTGAACGGGTTACACCATAAAATAATGGCTTATAATAATGCCTCTAAACATGGCGATAGGGTGGTATAAAAGAAAATGATTTCTTTCACTTTTTTTTCCAGTGTAAATAATATTACACTCTTAAGTGCAGCAATCAAATATGTACTTAAATAGACCCAACAGTTCCCCAGTAGGGTCTCTGACTGAAGTGTAAAGGCCCCCATATACGGGGCGATAAAAGCTGCAGACAGACCATGTGTGGGGCCATGCAACGGGGTTCCCTGAAAGTCGGCCAGATCTCGATCAGGCAAGTTAAAAAATCCCGTAGGATCGCAAGCACATCTGATTGCAATAAACATTTTGGGAAAGAATGATTGAATTGGTGCGTGGAAACGAAAATGGGACTAAGTGTGAGAGG
                                                  Xl3.1-CHK-1012706842                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGCGCAGTGGAGGATTTTAAGGGATAATTGTCGAGTAAAAATGTTTTGGTGGGATGGATCATTAGTTGAATAAATAAAGGCATTTTGTTCTCTGTGGGATGGAAGTATGAGTAATGGGCAAGTGGTAATTGTTTTTTAACAGAGGAGAAGAACGTATTATGGGGTTGGATAACAGCGTCATGAAAGGCCGAAATCTGCGGTAGGAGATAATTTTGTCGCCTTATAATAGAGATAGGTTGGGTGTATTTCGATTACCxxxGxxGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTAGGGGATACTTATATCTGTCATCCTAATGAGATTGCAAACCCTATGCCCACTCAAACTTTCCCACATTTAACCTTGTTCCACCCCCAAGTCTTGTATCTGGTTTTCAAGGAATAAGGGACTGAAAAGGAAATGTGGGGCAGCTGGCAGGTATGATTAGTAGTAAACATTAAGGGGTATATTCATCAAACGATGTTAAAAAAGGGCGAGTAAATACACCACTCACTGAACGGCATATGTGAAGCTGTTGATTTATTTCTGCTTAGAATTCTGCCTTCAAAAACAGCAGCAACTCAAAAAAAAATTCTCATTGACTTGAACGGGTTACACCATAAAATAATGGCTTATAATAATGCCTCTAAACATGGCGATAGGGTGGTATAAAAGAAAATGATTTCTTTCACTTTTTTTTCCAGTGTAAATAATATTACACTCTTAAGTGCAGCAATCAAATATGTACTTAAATAGACCCAACAGTTCCCCAGTAGGGTCTCTGACTGAAGTGTAAAGGCCCCCATATACGGGGCGATAAAAGCTGCAGACAGACCATGTGTGGGGCCATGCAACGGGGTTCCCTGAAAGTCGGCCAGATCTCGATCAGGCAAGTTAAAAAATCCCGTAGGATCGCAAGCACATCTGATTGCAATAAACATTTTGGGAAAGAATGATTGAATTGGTGCGTGGAAACGAAAATGGGACTAAGTGTGAGAGGCGGGTC
  3   1   1       add Brn1      in                    IMAGE:6950340.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         NGGAATAGAGCGCAGTGGAGGATTTTAAGGGATAATTGTCGAGTAAAAATGTTTTGGTGGGATGGATCATTAGTTGAATAAATAAAGGCATTTTGTTCTCTGTGGGATGGAAGTATGAGTAATGGGCAAGTGGTAATTGTTTTTTAACAGAGGAGAAGAACGTATTATGGGGTTGGATAACAGCGTCATGAAAGGCCGAAATCTGCGGTAGGAGATAATTTTGTCGCCTTATAATAGAGATAGGTTGGGTGTATTTCGATTACCCGAGATGGAGACCGATAATCGTGGCGCCAGGATGGCTACGATTGTAGGGACCCCCTTACATCCTTACGGAGGAATACGTTTTTGTATATTTTACATTCTCAAAATTGGGAATTGCCAAATCCCGTTATGGAAACAGTTCAGATGTGTTTCTCGCCCATTTTGCCCCTTGTTTCCACCTCCCCAAGATTTGTGTATACTGTTTTTTCGTAAGAATTAATGGGAACTGAAAAAGGAAATAGTGGGGCTATCTTGGCAGGTAATGATTAATAGGTGAAACTTTAAGGTGTTATATTCATCAAAGGATTGTTAAAAAGGGGTGCGAGTAATATACTCCACTCAATTGGAACTGCATATGTGAAGCTGGTTGATTTATTTCTGCTTAGAATTCTGCCTTCAAAAACAGCAGCAACTCAAAAAAAAATTCTCATTGACTTGAACGGGTTACACCATAAAATAATGGCTTATAATAATGCCTCTAGACATGGCAATAGGGTGGTATAAAAGAAAATGATTTCTTTCACTTTTTTTCCAGTGTAAATAATATTACACTCTTAAGTGCAGCAATCAAATATGTACTTAAATAGACCCAACAGTTCCCCAGTAGGGTCTCTGACTGAAGTGTAAAGGCCCCCATATACGGGGCGATAAAAGCTGCAGACAGACCATGTGTGGGGCCATGCAACGGGGTTCCCTGAAAGTCGGCCAGATCTCGATCAGGCAAGTTAAAAAATCCCGTAGGATCGCAAGCACATCTGATTGCAATAAACATTTTGGGAAAGAATGATTGAATTGGTGCGTGGAAACGAAAATGGGACTAAGTGTGAGAGGCGGGTCGGGTG
  3   1   2      seed Brn1 5g3  in                    IMAGE:4740267.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCATCCTTCCGCACAGTCAAAGAGCACCACTATAATAATACATTATTATAGACAAATGGTATTCTGTATTCTGCAACTTTGGGCGACTATTGAAAACGCATTGCCGCGTGTGCATTAACGCAGGCGTCTTTTCATTGTAGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTAGGGGATACTTATATCTGTCATCCTAATGAGATTGCAAACCCTATGCCCACTCAAACTTTCCCACATTTAACCTTGTTCCACCCCCAAGTCTTGTATCTGGTTTTCAAGGAATAAGGGACTGAAAAGGAAATGTGGGGCAGCTGGCAGGTATGATTAGTAGTAAACATTAAGGGGTATATTCATCAAACGATGTTAAAAAAGGGCGAGTAAATACACCACTCACTGAACGGCAAAAAAAA
  3   1   2       bld Brn1      in                    IMAGE:6956684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCCAAAAGGGTAATTTCGGTATTTCCGGCAAACTTTTGGGGCGAATTTATTGAAAAACGCATTTCCCGGCGTGTGCATTAAACGCAGGGGTCTTTTCATTGTTAGCCTATGGGGAACAACGTTGAGGCAGTTCGGGGAGATTGTCACTCAAAAGACGAGGTGATTAGTCGCCAGGCGACAAAATCTCCCCGAATCTCCTCGTGTGGCCTTACCCTTAGGGGATACTTATATCTGTCATCCTAATGAGATTGCAAACCCTATGCCCACTCAAACTTTCCCACATTTAACCTTGTTCCACCCCCAAGTCTTGTATCTGGTTTTCAAGGAATAAGGGACTGAAAAGGAAATGTGGGGCAGCTGGCAGGTATGATTAGTAGTAAACATTAAGGGGTATATTCATCAAACGATGTTAAAAAAGGGCGAGTAAATACACCACTCACTGAACGGCATATGTGAAGCTGTTGATTTATTTCTGCTTAGAATTCTGCCTTCAAAAACAGCAGCAACTCAAAAAAAAATTCTCATTGACTTGAACGGGTTACACCATAAAATAATGGCTTATAATAATGCCTCTAAACATGGCGATAGGGTGGTATAAAAGAAAATGATTTCTTTCACTTTTTTTTCCAGTGTAAATAATATTACACTCCTAAGTGCAGCAATCAAATATGTACTTAAATAGACCCAACAGTTCCCCAGTAGGGTCTCTGACTGAAGTGTAAAGGCCCCCATATACGGGGCGATAAAAGCTGCAGACAGACCATGTGTGGGGCCATGCAACGGGGTTCCCTGAAAGTCGGCCAGATCTCGATCAGGCAAGTTAAAAAAGCCAGTAGGATCGCAAGCACATCTTGCGGAAGT
  3   1   2      skin Brn1 5g3  in                    IMAGE:4740665.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATATTCATCAAACGATGTTAAAAAAGGGCGAGTAAATACACCACTCACTGAACGGCATATGTGAAGCTGTTGATTTATTTCTGCTTAGAATTCTGCCTTCAAAAACAGCAGCAACTCAAAAAAAAATTCTAATTGACTTGAACGGGTTACACCATAAAATAATGGCTTATAATAATGCCTCTAAACATGGCGATAGGGTGGTATAAAAGAAAATGATTTCTTTCACTTTTTTTCCAGTGTAAATAATATTACACTCCTAAGTGCAGCAATCAAATATGTACTTAAATAGACCCAACAGTTCCCCAGTAGGGTCTCTGACTGAAGTGTAAAGTCCCCCATATACGGGGCGATAAAAGCTGCAGACAGACCATGTGTGGGGCCATGCAACGGGGTTCCCTGAAAGTCGGCCAGATCTCGATCAGGCAAGTTAAAAAATCCCGTAGGATCGCAAGCACATCTGTGCGTTTAGTCATGGAATGGAATTAAAGTATATTCAATCTGAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)