Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6326223.5                      37 PI      88        109     1656                Serine/threonine-protein phosphatase 4 regulatory subunit 2

 This cluster: approximate FL confidence score = 98%

 1012838472 Xl3.1-IMAGE:7208048.5.5 - 23 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:7208048.5.5                     CCTCCTCCTCCCCTGCTATGTGCTCGTTCCCGTGACGCGCCCAGTATCAGAGAAGCCGCTGCCTACTCCCGCCTCTCCTCTTGGTGACGTCACGAGCGCCATTATTGCGCGGCGGCTTCTGGGATCTCAGTTCACTTAGGTGTTTCCGTCGTTGCTCAGCGTGGTCACCGAAGGCAGGGGACTGGACCTCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCTGTGTGTGTGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGACGGACCCACGAAAGAATTACAACGGCACGGACAAGTTTCTTAGAGGAGTGGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACAATTCTACTAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGTAACTCCCAGAGTTACACAGACAGGTCAAACGTTAATGGTCCTGGAACCCCAAGACCAATGATTCGGCCAAAATTCTCCTTGTCAAGCCCAATGAACACAAATGGTTTGCCTGACAGTACAGAAAATAAAGAGTCGGACTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAATAAAA
                                                  Xl3.1-CHK-1012722920                           CCTCCCCTGCTATGTGCTCGTTCCCGTGACGCGCCCAGTATCAGAGAAGCCGCTGCCTACTCCCGCCTCTCCTCTTGGTGACGTCACGAGCGCCATTATTGCGCGGCGGCTTCTGGGATCTCAGTTCACTTAGGTGTTTCCGTCGTTGCTCAGCGTGGTCACCGAAGGCAGGGGACTGGACCTCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCTGTGTGTGTGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGACGGACCCACGAAAGAATTACAACGGCACGGACAAGTTTCTTAGAGGAGTGGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACAATTCTACTAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGTAACTCCCAGAGTTACACAGACAGGTCAAACGTTAATGGTCCTGGAACCCCAAGACCAATGATTCGGCCAAAATTCTCCTTGTCAAGCCCAATGAACACAAATGGTTTGCCTGACAGTACAGAAAATAAAGAGTCGGACTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAATAAAAAAAAAA
                                                      consensus depths                          2     2     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     5     4     6     4     6     4     6     4     6     4     6     4     7     6    10     6    10     6    10     6    10     6    10     6    10     6    10     9    10     9    10     8    10     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    10     9    10     8     9     8     9     8    11     8     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     8     8     8     8     7     7     7     7     6     6     6     6     6     6     6     6     6     6     5     5     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     3     5     4     5     4     5     3     5     3     5     3     6     4     6     4     6     4     6     4     5     4     5     4     7     5     7     5     7     5     7     5     7     5     7     5     7     5     6     6     7     6     7     7     8     7     8     6     9     7     9     7     9     8    10     8    10     8    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     7     7     6     6     5     6     5     6     5     6     2     3
  5   1   2       e50                            Xl3.1-IMAGE:7208048.5                     CCTCCTCCTCCCCTGCTATGTGCTCGTTCCCGTGACGCGCCCAGTATCAGAGAAGCCGCTGCCTACTCCCGCCTCTCCTCTTGGTGACGTCACGAGCGCCATTATTGCGCGGCGGCTTCTGGGATCTCAGTTCACTTAGGTGTTTCCGTCGTTGCTCAGCGTGGTCACCGAAGGCAGGGGACTGGACCTCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCTGTGTGTGTGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGACGGACCCACGAAAGAATTACAACGGCACGGACAAGTTTCTTAGAGGAGTGGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACAATTCTACTAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGTAACTCCCAGAGTTACACAGACAGGTCAAACGTTAATGGTCCTGGAACCCCAAGACCAATGATTCGGCCAAAATTCTCCTTGTCAAGCCCAATGAACACAAATGGTTTGCCTGACAGTACAGAAAATAAAGAGTCGGACTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTC
  5   1   2       e50                            Xl3.1-IMAGE:7208048.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAAT
                                               BLH ATG     312     936                     
                                               BLH MIN     312     157                     
                                               BLH MPR     177     157                     
                                               BLH OVR     312     959                     
                                               CDS MIN     312     157                     
                                               ORF LNG     312      76                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 6e-007     NP_001027962.1 nucleolin like protein CiRGG1 [Ciona intestinalis] --------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 4e-011     NP_491907.1 protein phosphatase 4 regulatory like (42.2 kD) (1H202) [Caenorhabditis elegans] --------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - ?? ---- 7e-016     XP_635213.1 hypothetical protein DDBDRAFT_0183896 [Dictyostelium discoideum AX4] -----------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 9e-031     XP_001688384.1 AGAP002501-PA [Anopheles gambiae str. PEST] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 1e-036     NP_996400.1 CG2890-PC, isoform C [Drosophila melanogaster] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 2e-037     XP_001184313.1 PREDICTED: similar to Wu:fe11b04 protein [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = ?? ==== 2e-089     XP_581095.4 PREDICTED: protein phosphatase 4, regulatory subunit 2 [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 3e-105     NP_001108612.1 protein phosphatase 4, regulatory subunit 2a [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 1e-131     NP_891984.1 RIKEN cDNA C230060M08 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Hs ==== 1e-137     NP_777567.1 hypothetical protein LOC151987 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Cf ==== 2e-140     XP_863179.1 PREDICTED: similar to protein phosphatase 4, regulatory subunit 2 isoform 6 [Canis familiaris] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 4e-144     NP_001006142.1 similar to protein phosphatase 4, regulatory subunit 2 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          Q28IG6.1 Serine/threonine-protein phosphatase 4 regulatory subunit 2 [Xenopus tropicalis]  ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Xl ==== 0          NP_001088887.1 hypothetical protein LOC496232 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:7208048.5.5                                                                                                         TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------ATG------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------TAA---------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2       e50                            Xl3.1-IMAGE:7208048.5                     CCTCCTCCTCCCCTGCTATGTGCTCGTTCCCGTGACGCGCCCAGTATCAGAGAAGCCGCTGCCTACTCCCGCCTCTCCTCTTGGTGACGTCACGAGCGCCATTATTGCGCGGCGGCTTCTGGGATCTCAGTTCACTTAGGTGTTTCCGTCGTTGCTCAGCGTGGTCACCGAAGGCAGGGGACTGGACCTCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCTGTGTGTGTGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGACGGACCCACGAAAGAATTACAACGGCACGGACAAGTTTCTTAGAGGAGTGGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACAATTCTACTAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGTAACTCCCAGAGTTACACAGACAGGTCAAACGTTAATGGTCCTGGAACCCCAAGACCAATGATTCGGCCAAAATTCTCCTTGTCAAGCCCAATGAACACAAATGGTTTGCCTGACAGTACAGAAAATAAAGAGTCGGACTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTC
                                                  Xl3.1-CHK-1012692737                           CCTCCCCTGCTATGTGCTCGTTCCCGTGACGCGCCCAGTATCAGAGAAGCCGCTGCCTACTCCCGCCTCTCCTCTTGGTGACGTCACGAGCGCCATTATTGCGCGGCGGCTTCTGGGATCTCAGTTCACTTAGGTGTTTCCGTCGTTGCTCAGCGTGGTCACCGAAGGCAGGGGACTGGACCTCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCTGTGTGTGTGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGACGGACCCACGAAAGAATTACAACGGCACGGACAAGTTTCTTAGAGGAGTGGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACAATTCTACTAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGTAACTCCCAGAGTTACACAGACAGGTCAAACGTTAATGGTCCTGGAACCCCAAGACCAATGATTCGGCCAAAATTCTCCTTGTCAAGCCCAATGAACACAAATGGTTTGCCTGACAGTACAGAAAATAAAGAGTCGGACTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTA
  5   1   2       bld Egg1                               PBX0006A01.5p CACGAGGGCGCCCAACCCTCCCTCCTCCTCCCCTGCTATGTGCTCGTTCCCGTGACGCGCCCAGTATCAGAGAAGCCGCTGCCTACTCCCGCCTCTCCTCTTGGTGACGTCACGAGCGCCATTATTGCGCGGCGGCTTCTGGGATCTCAGTTCACTTAAGTGTTTCCGTCGTTGCTCAGCGTGGTCACCGAAGGCAGGGGACTGGACCTCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCTGTGTGTGTGACACCCTTCTCTTCCGGCAATGGACG
  5   1   2       bld Egg1 5g                            PBX0006C01.5p                     CCTCCTCCTCCCCTGCTATGTGCTCGTTCCCGTGACGCGCCCAGTATCAGAGAAGCCGCTGCCTACTCCCGTCTCTCCTCTTGGTGACGTCACGAGCGCCATTATTGCGCGGCGGCTTCTGGGATCTCAGTTCACTTAGGTGTTTCCGTCGTTGCTCAGCGTGGCCACCGAACGCAGGGGACTGGACCTCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCTGTGTGTGTGACACCCTCCTTTTCCGGCAATGGACGTCGACCGGCTTCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACT
  5   1   2       bld Egg1 5g                            PBX0006B01.5p                      CTCCTCCTCCCCTGCTATGTGCTCGTTCCCGTGACGCGCCCAGTATCAGAGAAGCCGCTGCCTACTCCCGCCTCTCCTCTTGGTGACGTCACGAGCGCCATTATTGCGCGGCGGCTTCTGGGATCTCAGTTCACTTAGGTGTTTCCGTCGTTGCTCAGCGTGGTCACCGAAGGCAGGGGACTGGACCTCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCTGTGTGTGTGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTC
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db25d04.y1                                                                                    GGGTCGACCCACGCGTCCGGTCACGAGCGCCATTATTGCGCGGCGGCTTCTGGGATCTCAGTTCACTTAGGTGTTTCCGTCGTTGCTCAGCGTGGTCACCGAAGGCAGGGGACTGGACCGCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCtgtgtgtgtgtgtgtgACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTNTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGAC
  5   1   2       bld DMZ       out                        xl309f11.5p                                                                                                                              GCTTCTGGTGATCTCAGTTCACTTAGGTGTTTCCGTCGTTGCTCAGCGTGGTCACCGAAGGCAGGGGACTGGACCTCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGgtgtctgtctgtctgtctgtgtgtgtgACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGACGGACCCACGAAAGAATTACAACGGCACGGACAAGTTTCTTAGAGGAGTGGAAAAGAATATCATGGTTGTGA
  5   1   2      seed Ga15 5g3  in                       XL421m24ex.5p                                                                                                                                        CTTCTGGGATCTCAGTTCACTTAGGTGTTTCCGTCGTTGCTCAGCGTGGTCACCGAAGGCAGGGGACTGGACCGCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCTGTGTGTGTGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGACGGACCCACGAAAGAATTACAACGGCACGGACAAGTTTCTTAGAGGAGTGGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACAATTCTACTAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGTAACTCCCAGAGTTACACAGACAGGTCAAACGTTAATGGTCCTGGGAACCC
  5   1   2       bld Ov1       in                    IMAGE:5073385.5p                                                                                                                                                                                                   CCACGCGTCCGGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGgtgtctgtctgtctgtgtgtgtgACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGACGGACCCACGAAAGAATTACAACGGCACGGACAAGTTTCTTAGAGGAGTGGAAAAGAATATCATG
  5   1   2       bld Te2  5g3  in                    IMAGE:7208048.5p                                                                                                                                                                                                             GACCGCGTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCTGTGTGTGTGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGACGGACCCACGAAAGAATTACAACGGCACGGACAAGTTTCTTAGAGGAGTGGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACAATTCTACTAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGTAACTCCCAGAGTTACACAGACAGGTCAAACGTTAATGGTCCTGGAACCCCAAGACCAATGATTCGGCCAAAATTCTCCTTGTCAAGCCCAATGAACACAATGGTTTGCCTGAAGTACAGAAAATAAGAGTCGGACTGCAGCAGAAGAGAGAGTCGAGTGATCTGCGTGTCGA
  5   1   2       bld Ga12 5g3  in                         XL179f13.5p                                                                                                                                                                                                               GTTCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGgtgtctgtctgtctgtgtgtgtgACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGTGGTCCAGTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGNAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCNAATGTGGAATATATTCCTTTTGATGAGATGANGCAAAGAATACTGAAGATTGTCACTG
  5   1   0       chi Ooc3      in                    IMAGE:3473059.5p                                                                                                                                                                                                                     TCCCTCCTGTGGGTTTCCCTCTCTGTGACGGAGGAAGCGATTTCGGACGGGGCTGAGAGCGAGGAGCGACGGGAGGCAGCCGGTGTCTGTCTGTGTGTGTGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTCTGAAAGATTTTGAAAAAAGAGGAAAGAAGGAAGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAAACTGGAGAGACCGCGGGCCAggggggggATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCCCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATCTTCCTTTTGATGAGATGAACAAAGAATACTGACAATTGTCCTGGCTTCAAGGCCCTCCTTTTACATTCAGCGCTTCGGGAGTTACCCGCACCACCCCCCAAATAATCCCACGCGACGGACAATTTTCTTAAAGGAGCGCAAAACATATCT
  5   1   2       bld DMZ                                  xl325n06.5p                                                                                                                                                                                                                                                                                                                                                                                                  GAAGGAAGTTTCTCCTGAACTCTACCAGTTTCTGTGTCATGNTGCANAAACTGGAGAGACCGTGGTCCANTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACTAAGAGGATCCCCGANTCCAAATGTGGAATATATTCCTTTTGATGAG
  5   1   2       bld Oo1                             IMAGE:6857295.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGATCAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGACGGACCCACGAAAGAATTACAACGGCACGGACAAGTTTCTTAGAGGAGTGGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACAATTCTACTAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGTAACTCCCAGAGTTACACAGACAGGTCAAACGTTAATGGTCCTGGAACCCCAAGACCAATGATTCGGCCAAAATTCTCCTTGTCAAGCCCAATGAACACAAATGGTTTGCCTGACAGTACAGAAAATAAAGAGTCGGACTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCCCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGGAAAGAAAGCTGTCAAAACCGCACAGGGCTTCTGATGAAGAGTCTTTTAATGGACAGCGAGTGAAATCCGACGGGAGGGCAGAAAGCCACCGAGAAGAGGACAGTGGAGAAACCTGGAATTGGTGACGGAAAGAATCCCTCCGAAGGAAAAGTCCATCACCATGGGACCAAAT
  5   1   2       bld Egg1                            IMAGE:4678369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCACGAGGATTTTCGCACTTCTGCTCCTGAACAAAGAGGATCCCCGAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTGAAGATTGTCACTGGCTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGTGAGTTACTGACGGACCCACGAAAGAATTACAACGGCACGGACAAGTTTCTTAGAGGAGTGGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACAATTCTACTAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGTAACTCCCAGAGTTACACAGACAGGTCAAACGTTAATGGTCCTGGAACCCCAAGACCAATGATTCGGCCAAAATTCTCCTTGTCAAGCCCAATGAACACAAATGGTTTGCCTGACAGTACGGAAAATAAAGAGTCGGACTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCC
  5   1   2       e50                            Xl3.1-IMAGE:7208048.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAAT
                                                  Xl3.1-CHK-1012695665                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAATAAAAAA
  3   1   2       bld Te2  5g3  in                    IMAGE:7208048.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAACAATTTTATACTTAGTTTTGAACCGGCAAGAAATGGCGTTAATGTTTCCAATGAAACTCCCCAGAGTTAACACAGACAGGTCAAACGTTAATGGGTCCTGGAACCCCAAGACCCAATGATTCGCCAAAAATCTCCTTGTCAAGCCCAATGAACACAAATGTTTTGCCTGACAGTACAGAAAATAAAGAGTCGGACTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACCGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAATAAACAAAAAAAA
  5  -1   2       bld Bla2                            IMAGE:7298464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTAGGGCGGGACAGGTGAGTGTCTGAATTTGCGGGTGTCAACAGTACGCGTACTAGCGACCAGCAGTNGAAATTCTTCACCAGACCAATGTGCGACGTCGAATAAGATCGCTGCGCAAAGGAGATCAGAGGATTGCGTGTNGAGAGATCACAGCACCACTCAGAAATAGCATCGGTGAGACTGGCAGAGGTGAGGAACACGAAGTGAAGGACTAAAATCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATaaaaaaattttatgtacaaaaacaaaaaaaaGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAATaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCATCGCCCAAGAACGC
  3   1   2       bld Ga15 5g3  in                       XL421m24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGACAGTANGGAAAATAAAGAGTTGGTCTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGANCACGAAGTGAAGAGNCTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATNTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTCCACA
  3   1   2       bld Ga12 5g3  in                         XL179f13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAGCACGAAGTGAAGAGANTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGTTTAATCCAGACGCATNTAGTGAGGTCTCCACAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAACACAGCACAGGCTTTTGATGAAGAGTCTTTAATGACAGCGAGNGANTCGACGGAGGCAGAAAGCANCGAGAGAGACANTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTNTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATNTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGANTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGA
  5   1   2       bld Egg1      in                    IMAGE:3300361.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACGAGGGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCACAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCA
  5   1   2       bld Egg2                   IMAGE:3300361-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCACAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATaaaaaaattttatgtacaaaaacaaaaaaaaGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGaaaaaaaaaaaaaaaaaaGATTCGCGGCC
  3   1   2       bld Ooc3      in                    IMAGE:3473059.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTTTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTTTTTGACCAGTGACGAGCACAACTTTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTTTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACCCTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAA
  3   1   2       bld Ov1       in                    IMAGE:5073385.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAAAAAAAAAAAAG
  3   1   2      seed Egg1      in                    IMAGE:3300361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACACATGGAAA
  3   1   2       bld Ooc1 5g3  in                     Ooc1-db25d04.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAATAAAAACAAAAAAAAACAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)