Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 18 Jul 2019 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6326223.5                      37 PI      88        109     1656                Serine/threonine-protein phosphatase 4 regulatory subunit 2

 This cluster: approximate FL confidence score = 98%

 1012838472 Xl3.1-IMAGE:7208048.5.5 - 23 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                          2     2     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     5     4     6     4     6     4     6     4     6     4     6     4     7     6    10     6    10     6    10     6    10     6    10     6    10     6    10     9    10     9    10     8    10     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    10     9    10     8     9     8     9     8    11     8     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     8     8     8     8     7     7     7     7     6     6     6     6     6     6     6     6     6     6     5     5     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     3     5     4     5     4     5     3     5     3     5     3     6     4     6     4     6     4     6     4     5     4     5     4     7     5     7     5     7     5     7     5     7     5     7     5     7     5     6     6     7     6     7     7     8     7     8     6     9     7     9     7     9     8    10     8    10     8    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     7     7     6     6     5     6     5     6     5     6     2     3
  5   1   2       e50                            Xl3.1-IMAGE:7208048.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAAT
                                               BLH ATG     312     936                     
                                               BLH MIN     312     157                     
                                               BLH MPR     177     157                     
                                               BLH OVR     312     959                     
                                               CDS MIN     312     157                     
                                               ORF LNG     312      76                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 6e-007     NP_001027962.1 nucleolin like protein CiRGG1 [Ciona intestinalis] --------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 4e-011     NP_491907.1 protein phosphatase 4 regulatory like (42.2 kD) (1H202) [Caenorhabditis elegans] --------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - ?? ---- 7e-016     XP_635213.1 hypothetical protein DDBDRAFT_0183896 [Dictyostelium discoideum AX4] -----------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 9e-031     XP_001688384.1 AGAP002501-PA [Anopheles gambiae str. PEST] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 1e-036     NP_996400.1 CG2890-PC, isoform C [Drosophila melanogaster] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 2e-037     XP_001184313.1 PREDICTED: similar to Wu:fe11b04 protein [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = ?? ==== 2e-089     XP_581095.4 PREDICTED: protein phosphatase 4, regulatory subunit 2 [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 3e-105     NP_001108612.1 protein phosphatase 4, regulatory subunit 2a [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 1e-131     NP_891984.1 RIKEN cDNA C230060M08 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Hs ==== 1e-137     NP_777567.1 hypothetical protein LOC151987 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Cf ==== 2e-140     XP_863179.1 PREDICTED: similar to protein phosphatase 4, regulatory subunit 2 isoform 6 [Canis familiaris] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 4e-144     NP_001006142.1 similar to protein phosphatase 4, regulatory subunit 2 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          Q28IG6.1 Serine/threonine-protein phosphatase 4 regulatory subunit 2 [Xenopus tropicalis]  ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Xl ==== 0          NP_001088887.1 hypothetical protein LOC496232 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:7208048.5.5                                                                                                         TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------ATG------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------TAA---------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2       bld DMZ                                  xl325n06.5p                                                                                                                                                                                                                                                                                                                                                                                                  GAAGGAAGTTTCTCCTGAACTCTACCAGTTTCTGTGTCATGNTGCANAAACTGGAGAGACCGTGGTCCANTGGCCACAATTCAAAGAGTACTTCGTATTTAAACTGGAGATGGTAATGGATGATTTTCGCACTTCTGCTCCTGAACTAAGAGGATCCCCGANTCCAAATGTGGAATATATTCCTTTTGATGAG
  5   1   2       e50                            Xl3.1-IMAGE:7208048.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAAT
                                                  Xl3.1-CHK-1012695665                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAATAAAAAA
  5  -1   2       bld Bla2                            IMAGE:7298464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTAGGGCGGGACAGGTGAGTGTCTGAATTTGCGGGTGTCAACAGTACGCGTACTAGCGACCAGCAGTNGAAATTCTTCACCAGACCAATGTGCGACGTCGAATAAGATCGCTGCGCAAAGGAGATCAGAGGATTGCGTGTNGAGAGATCACAGCACCACTCAGAAATAGCATCGGTGAGACTGGCAGAGGTGAGGAACACGAAGTGAAGGACTAAAATCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATaaaaaaattttatgtacaaaaacaaaaaaaaGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAATaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCATCGCCCAAGAACGC
  3   1   2       bld Ga15 5g3  in                       XL421m24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGACAGTANGGAAAATAAAGAGTTGGTCTTGCAGCAGAAAGAGAAGAGTCAGAGTGATTCTGCCGTGTCTGATGATGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGANCACGAAGTGAAGAGNCTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATNTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTCCACA
  3   1   2       bld Ga12 5g3  in                         XL179f13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGATCACAAGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAGCACGAAGTGAAGAGANTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGTTTAATCCAGACGCATNTAGTGAGGTCTCCACAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAACACAGCACAGGCTTTTGATGAAGAGTCTTTAATGACAGCGAGNGANTCGACGGAGGCAGAAAGCANCGAGAGAGACANTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTNTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATNTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGANTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGA
  5   1   2       bld Egg1      in                    IMAGE:3300361.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACGAGGGCAACCACTTCAAGAAATAAGCACTCGGCTGAGGACTCGGCAGAGGTTGAGGAACACGAAGTGAAGAGACTAAAATTCGACCCGGACGAGGAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCACAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCA
  5   1   2       bld Egg2                   IMAGE:3300361-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGAGGAAGCTGCCTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCACAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATaaaaaaattttatgtacaaaaacaaaaaaaaGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGaaaaaaaaaaaaaaaaaaGATTCGCGGCC
  3   1   2       bld Ooc3      in                    IMAGE:3473059.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAATCCAGACGCATCTAGTGAGGTCTCCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTTTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTTTTTGACCAGTGACGAGCACAACTTTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTTTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACCCTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAA
  3   1   2       bld Ov1       in                    IMAGE:5073385.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGCAGAAATGGCAGAGGAAGCAGAATCTGCATCTACAAGTGCGGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAAAAAAAAAAAAG
  3   1   2      seed Egg1      in                    IMAGE:3300361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGGCTTCTGATGAAGAGTCTTTAATGACAGCGAGTGAATCGACGGAGGCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACACATGGAAA
  3   1   2       bld Ooc1 5g3  in                     Ooc1-db25d04.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGAAAGCAACGAGAGAGACAGTGAGAACGTGAGTGTGACGGAAGAATCCTCAGAGGAGAGTCATCACATGGACCAATCGGAAGAGTCCGAATCAGCCTGTTCTCTGACCAGTGACGAGCACAACTCTACTGCGGCAGCAACAACGAGCACTGAGGATGCCGACCCCAGCGAGGAGGAACATCTGGCAACTTCTAGTGGGAAGTCCACTGAAACCCTTACATTGTCTCCTATGGAAAACAGTGAAGAGGCCACCGATGCTCCAGAGGAACCAATGGAACAAGACTAACCCCCGACACACCAGTATTTTCCACACACTTCTGTTTTTACACTGTATAAAAAAATTTTATGTACAAAAACAAAAAAAAGGACCTTTTAGTTTTTTCAAAAGGCAAGTAAACCACAAACTCCTGGAATAAAAACAAAAAAAAACAAAAAAAA

In case of problems mail me! (