Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     10.33000000000000002    0Xl3.1-IMAGE:7980297.5.5                   120 END     3           6        2                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8821385.5.5                    64 PI      76       2033     2359                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6640941.5                      36 PI      96        860     1202                MGC81213 protein [Xenopus laevis]
     4   0.0    0Xl3.1-xlk157b23ex.3                        35 PI      81       2033     2255                (no blast hit)
     5   0.0    0Xl3.1-XL048c10.5                           28 PI      77       2033     2352                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:6633594.5                      14 PI      87       1463     2222                (no blast hit)

 This cluster: approximate FL confidence score = 5%

 1012838482 Xl3.1-XL051h22.3.5 - 43 ESTs
                                                                       .......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL051h22.3.5                                                                                                                                                                                                                                                                                                                                                                                          TGGAAACGGCCAGAGGAGGAAAGGAAGCTCTGCCTGCAACTGCCTCAGCCGGAAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGATTTGAGGGAGAAGTTGACCGATGCATCCCTCCTTTTCCAAGGACACATTAGAAACCATTGCTTTGGGATGGGGGAGTGCTGGAGATTGGCAATTAATGGAATGGATGTGGAGAACTGTTGCCTTTCTGTACTGAATTTTGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGCTATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATCTGAAGCACTACTGTTTGATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGGGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTCTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGTAAGTATGCAGTCCAAGGAATCTCTTCTCTTGCATGGCGTTGATCTCATACACATGGGAAGAGTTTTTGTTTTTTTTAACAGCTGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAATGGTCAATGAAAGATATAAGTTAAAGTGCAGATAGAAGTTGTATCCAACCTCAAGTCTTTCTAGGGGAAATTCCTGAATGAAACTGATATATCTACGGTCGACTGAACCCAGTACATTGTCAGACACATTGTGCAGCCTGAACTGGTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTAAATAAGGAGTAGCAGAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAGCTTAAAGGATCAGTAACATCAATTTTTTTAAACAATAAAAAATTGGTTAGTATAGAACGAAAAAAAAACACAAAGACACATATTAAACTTTTAAATCGCTAAGTATTTAGTATTCAAAAATAACTTACCCAAACTGCGATTGAGCTCCTCTTCAGAAAAGGCGACAAGGCCACAATCCGTCATGCGGCGCTCGATTTCTCCTCCCTAGCTATCTCCTATAAGGAGAGCAGGGAGGAGAGATCGAGCACCGCACGGTGGATCACCGGGTTGCCTTTTCTGAAGAGGAGCGAGCGCAAGTGGAGTTTCGGTTAGTTATTTCTTAATAAAGTTAAC
                                                  Xl3.1-CHK-1012722014                                                                                                                                                                                                                                                                                                                                                                                                CGGCCAGAGGAGGAAAGGAAGCTCTGCCTGCAACTGCCTCAGxCxGxAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGATTTGAGGGAGAAGTTGACCGATGCATCCCTCCTTTTCCAAGGACACATTAGAAACCATTGCTTTGGGATGGGGGAGTGCTGGAGATTGGCAATTAATGGAATGGATGTGGAGAACTGTTGCCTTTCTGTACTGAATTTTGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGCTATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATCTGAAGCACTACTGTTTGATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGGGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTCTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGTAAGTATGCAGTCCAAGGAATCTCTTCTCTTGCATGGCGTTGATCTCATACACATGGGAAGAGTTTTTGTTTTTTTTAACAGCTGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAATGGTCAATGAAAGATATAAGTTAAAGTGCAGATAGAAGTTGTATCCAACCTCAAGTCTTTCTAGGGGAAATTCCTGAATGAAACTGATATATCTACGGTCGACTGAACCCAGTACATTGTCAGACACATTGTGCAGCCTGAACTGGTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTAAATAAGGAGTAGCAGAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAGCTTAAAGGATCAGTAACATCAATTTTTTTAAACAATAAAAAATTGGTTAGTATAGAACGAAAAAAAAACACAAAGACACATATTAAACTTTTAAATCGCTAAGTATTTAGTATTCAAAAATAACTTACCCAAACTGCGATTGAGCTCCTCTTCAGAAAAGGCGACAAGGCCACAATCCGTCATGCGGCGCTCGATTTCTCCTCCCTAGCTATCTCCTATAAGGAGAGCAGGGAGGAGAGATCGAGCACCGCACGGTGGATCACCGGGTTGCCTTTTCTGAAGAGGAGCGAGCGCAAGTGGAGTTTCGGTTAGTTATTTCTTAATAAAGTTAACGATTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                               2     2     2     2     2     3     2     4     3     5     4     8     6    15     7    17     8    21     8    21     8    21     8    21     8    21     8    21     8    21     8    21     8    21     8    21     8    21     8    21    13    21    19    21    18    21    19    21    18    20    18    20    18    20    18    20    18    20    18    20    18    20    18    20    18    20    17    20    17    20    17    20    17    20    17    20    17    20    16    20    17    20    16    20    16    20    17    20    17    19    17    19    16    18    16    18    15    17    15    17    15    17    15    17    13    16    13    16    13    16    12    15    12    15    10    12    10    12     9    12     9    12    10    13     8    13     9    13     7    11     7    11     6    10     5    11     6    10     6    10     6     9     5     9     4     9     4     8     4     8     5     9     5     9     5     9     5     9     5     9     6     9     8    10     8    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     7     9     8    10     6    10     7    10     6     9     6     9     5     8     5     8     4     8     4     8     4     8     4     8     5     9     4     8     5     8     5     8     5     8     5     8     4     8     4     8     4     7     4     6     4     6     4     6     4     7     5     7     5     7     7     7     7     7     8     8     8     8     8     8     8     8     9     9     9    10    10    10    10    10    10    10    14    14    14    14    14    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    10    14     9    14     9    14     8    12     8    12     7    11     7    11     6    10     6     9     7     9     6     9     7     9     6     9     7     9     6     9     6     9     5     9     5     9     3     9     3     6     3     6     3     6     3     6     3     6     2     5     2     5     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4
  5   1   2       e>2                      Xl3.1-IMAGE:4030760-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                          TGGAAACGGCCAGAGGAGGAAAGGAAGCTCTGCCTGCAACTGCCTCAGTCTGCAGAGAGGGAGCTGGAAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGGAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTCCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCCTGACTAAAATGACGAGGTCCGAATTATGGTGATTT
  5   1   2       e50                            Xl3.1-IMAGE:6642366.5                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATG
  5   1   2       e50                                 Xl3.1-XL051h22.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGATTTGAGGGAGAAGTTGACCGATGCATCCCTCCTTTTCCAAGGACACATTAGAAACCATTGCTTTGGGATGGGGGAGTGCTGGAGATTGGCAATTAATGGAATGGATGTGGAGAACTGTTGCCTTTCTGTACTGAATTTTGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGCTATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATCTGAAGCACTACTGTTTGATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGGGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTCTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGTAAGTATGCAGTCCAAGGAATCTCTTCTCTTGCATGGCGTTGATCTCATACACATGGGAAGAGTTTTTGTTTTTTTTAACAGCTGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAATGGTCAATGAAAGATATAAGTTAAAGTGCAGATAGAAGTTGTATCCAACCTCAAGTCTTTCTAGGGGAAATTCCTGAATGAAACTGATATATCTACGGTCGACTGAACCCAGTACATTGTCAGACACATTGTGCAGCCTGAACTGGTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTAAATAAGGAGTAGCAGAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAGCTTAAAGGATCAGTAACATCAATTTTTTTAAACAATAAAAAATTGGTTAGTATAGAACGAAAAAAAAACACAAAGACACATATTAAACTTTTAAATCGCTAAGTATTTAGTATTCAAAAATAACTTACCCAAACTGCGATTGAGCTCCTCTTCAGAAAAGGCGACAAGGCCACAATCCGTCATGCGGCGCTCGATTTCTCCTCCCTAGCTATCTCCTATAAGGAGAGCAGGGAGGAGAGATCGAGGGGGGGGCCGGAGATCACCGGGTTGCCTTTTCTGAAGAGGAGCGAGCGCAAGTGGAGTTTCGGTTAGTTATTTCTTAATAAAGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCACCAGACAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCTTCACTGAATCTAGACTTGAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      G-A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                               BLH MIN     315      43                                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH OVR     432      13                                                                                                                                                                                                                                                                                                                                                                                          
                                               EST CLI      62      27                                                                                                                                                                                                                                                                                                                                                                                          
  5   1   2       e>2                      Xl3.1-IMAGE:4030760-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                          TGGAAACGGCCAGAGGAGGAAAGGAAGCTCTGCCTGCAACTGCCTCAGTCTGCAGAGAGGGAGCTGGAAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGGAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTCCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCCTGACTAAAATGACGAGGTCCGAATTATGGTGATTT
                                                  Xl3.1-CHK-1012693996                                                                                                                                                                                                                                                                                                                                                                                                CGGCCAGAGGAGGAAAGGAAGCTCTGCCTGCAACTGCCTCAGTCTGCAGAGAGGGAGCTGGAAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGGAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTCCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCxxxxxxAAAATGACGAGGTCCGAATTATGG
  5   1   1       add Oo1                             IMAGE:6639313.5p CAAAATCAAACTGGAGCAGCTACACTCACGCGTCTCACTACTCGCATACAGACTTATATGTGGCAGGAAAGTTCAGTCCACCTTTATTTCCACATGGTTAGTGAAAGGGGAGGGGGAGCTGCAGAAGAAGAGCAGCTACTGTGAAACAACAACGGAGCTTTTCTACTGATCAAACTACTGATGCTGCTCTCAGAGGGGGTGCTGGCTGCAGGGGCAGAGCTGCTTTAATAAGTGGACAGCTGCACGGGGCACACTTATTTTGGGGGCCCATGGCTGACTTGTAATGTTTTTTGCCTTTATTTATTAAATAAGTACTTGGTGCTGGCTCCCTCCCCTGGCCGATCCACTTACATTTCGCACCCACCCCCCCGGTGAAGTGGAAACGGCCAGAGGAGGAAAGGAAGCTCTGCCTGCAACTGCCTCAGTCTGCAGAGAGGGAGCTGGAAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTTAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACACCATGACTCTGCTCGGCCCCAGCCTCTCCAGGAAATCCACAGACACCTTCACTGAATCTAGATCTCAATATGGATAGCATTCCCCAGAGAAGTGTATGGTGCCATGGTGAGTACTGCAGCGGCTGGTGGGGCGAACCAAAAGGGCGGGGCCCGTGATGGCAAAAAGGGACGGGCCCACATCGCCAGAGGAATCATAGGACTGGAggggggggaaaaaagcttctgggagggaagtccgtccttaaaaaaaaaGGATGGGGAAGACAAAGAAAAGTCCCAGGTCCATTTGCCCCTCCATTTTGGGGCCAGGCTCCCTTAAAGGGAAACGGACTTAAAAACCACCCCGGGGGAATCCCGGAAAAGGAACCCCAANCCCACCCTAAGAACCCAAAA
  5   1   2       bld Ga12      in                         XL203o05.5p                                                                                          TGGTTAGTGAAAGGGGAGGGGGAGCTGCAGAAGGAGAGGAGCTACTGTGAAACAACAACGGAGCTTTTCTACTGATCAAACTACTGATGCTGCTTTCAGAGGGGGTGCTGGCTCCAGGGGCAGGGCTGCTTTAATAAGTAGGCCGCTGCCCAGGGCACACTTATTTTGAGGGCCCATGGCTGACTTGTCatttttttgcctttatttatttattaAATAAGTACTTGGTGCTGGCTCCCTCCCCTGGCCGATCCACTTACATTTCGCACCCCCCTCAACCCGGTGAAGTGGAAACGGCCAGAGGAGGAAAGCAAGCCCTGCCTGCGACTGCCTCAGTCTGCAGAGAGGGAGCCGGAAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATC
  5   1   2       bld Ov1  5x3                        IMAGE:8332440.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            cccacgcgtccggCCGGAAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGGAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGTGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTCCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCTGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGCCCTGG
  5   1   2      seed Kid  5x3               IMAGE:4030760-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGAAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGGCGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGAGTGGAGCCGAAGGAGCATGTAGAAGAGCTGGAGCATCGATGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGATTTGAGGGAGAAGTTGACCGATGCATCCCTCCTTTTCCCATGCCAACGCCTGCTTGTGCTGGGATTCATTTTCTCCAAGGACACATTAGAAACCATTGCTTTGGGATGGGGGAGTGCTGGAGATTGGCAATTAATGGAATGGATGTGGAGAACTGTTGCCTTTCTGTACTGAATT
  5   1   2       bld Kid  5x                         IMAGE:4030760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAACACGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGGCGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGAGTGGAGCCGAACGAGCATGTAGAAGAGCTGGAGCATCGATGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTTACAGAACCAGAGAGCCATACTGAAGCACCGTCACAAGGAGGTGGAGGGAGGACATTACCTGACTGGGTCAAGAGCAAGAGGAAATGAACGCTAATCTGCTGGAATTGCACGGTTTGGGCCTGCGAACGGGAAACCTGAGCACAATGACAAGGGCACGAGGAGGCTCCATGGAAACACAACCCAAAGGGGCAACCAAGAAAATGGGGACCCGATAGAAGAACCACCAAGTCAAGAAGACACCCCTAACGGGGAAACCTACATAAAAGCGAAACATCGCACCAAATGCCGAAACCGCACGCCGGCGGAAAGCGAAAGAAACCGGAGCACTTCTCAAGGAACAAAGAGGGTGACATTCGGAGGAACAGAACAGCGGCCGGAAACAACACATAATACGCGTGACNGAGTACTGGGAGACCGCTCTACTACACATCTTTAGTGCGCTCGGAGCCTCCCGCCACTCAACGACTGTACGACACAGACACCAACCGAGAACTCTTCAAGATGTAATCATCCGACCCCGCCTTTGTGGGGGTCGCAAAATATTCGCTGTAGGCGATGGAACAGAAGAAACATATCGGCAGCCACAAATCACGTCGACCCTGCTCCCATAAAAGGAAGAAACAAGTAAAAAAGAACTTATTAATGAAGAAGCGCTGACATATTGCGTTGCACCGAAGAATTCACGCCACAGCGGCGAAAAGTGATCTTTTCACGCAGCCCAGAGAAAGGGAAAAAAAGAATGGGGGTGCCCCACCACTGATGACTGGATGAAGGTCCGCCCACGATTGGGTAGAGGTTGNGGCGCGCTGGAGGAAAAGCTTGTGACCCACACCGTGGGACTACGTGATGCACTCGTCGCCTTTTCCGGTGAGACACAGCCCGAAAACAAGCACCACGCAAGTCGACGAGTGAACGACCGCAGGAACAGATAGCAATGTACGCGANGGGAGAAAACACGATTTGTCTAGCCCGTCGACACCATCAGTAATATACCAGATAGACTACAAGATAAATATAAGCTACTAGTAACACAAATGTAATAAAAACTTCTAATGGATCAACCCACGCCGAGACAGAACAAACAATTCCCACCGGAATATGCACGTATAGATATGCAGAGCGATAAATTAGCGTCTAACCAACGACA
  5   1   2       bld Emb9 5x3                        IMAGE:7977168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGAAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCGCTGATCTAGACTTGATGCAAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGGAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTCCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCTGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGGCCTGGTGCCATGCTGCAGAATCCACGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGATTTGAGGGAGAAGTT
  5   1   2       bld Ov1  5x3                        IMAGE:8330725.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGAGTGGAGCCGAAGGAGCATGTAGAAGAGCTGGAGCATCGATGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGAAATGGCCTGGTGCCCTGCTGCAGAATCCAG
  5   1   2       bld Ga15      out                      XL478l08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGGAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGTGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTCCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGNGCCAAGAGNATGGAGCTCTGGAGGAAGTCTGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTACACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCACGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGATTT
  5   1   2       bld Tbd7 5g3  in                         XL051h22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGGAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGTGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTCCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCTGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAG
  5   1   2       bld Neu7 5g3  in                         XL021d17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACGAGGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGGAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGTGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTCCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCTGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCA
  5   1   2       bld Kid  5x3                        IMAGE:7012326.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACACGCAGGTGCCTCGTTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTAGTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGGCGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGAGTGGAGCCGAAGGAGCATGTAGAAGAGCTGGAGCATCGATGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAATTTAGCGAGAGAAACAGAATCCCCAAGAATGACCTGGGGGCAAGCTGAAGAAACAATGCATTGCCTTTTATTACAGGGCGGGAAGAAAGAGATAGGAAAAATGAA
  5   1   2       bld Lmb1 5x3                        IMAGE:8532149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGCAGGTGCCTCGCTGGTCTGTAGCGGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGGCGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGACTTGATGCAAGAGAGAGTGGAGCCGAAGGAGCATGTAGAAGAGCTGGAGCATCGATGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTA
  5   1   2       e50                            Xl3.1-IMAGE:6642366.5                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATG
                                                  Xl3.1-CHK-1012697452                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGAGA
  5   1   2      seed Oo1  5x3                        IMAGE:6642366.5p                                                                                                                                                                                                                                                                                                                                                                                                                  GGTCCGGAATTCCCGCGATGGGAGCCGGAAGAGGAGTAGAGTAGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCGGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGAGAAGTTGACCGATGCATCCCCTCCTTTTCCAAGGACACATTAGAAACATTGCTTGGGGNAATGGGGGAGTGGCTGGAGATTGGCCAATAATGGAATGGATGTGGGAGAACTGTTGCCTTTCTGAACCTGGAATTTGGGTCCCCTAGTGAATT
  5   1   2       add Egg6 5g3  in                    IMAGE:4412598.5p                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAGTCTGCAGAGAGGGAGCCGGAAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCAGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCGTGCTGAAGAGCTGGAGCATCGATATATTCAGCTGTCAAGAGAAACATACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGGAGTACATTAGCTGACTGGCTCATGACAAAGAGGAGATGAACGCTAATCTGCTGGAATTGCAAGTTTTGGTCATACCGCTGGTAACTGAGCGCAATGAATGGTACAGGATGCTCATGGAAGCAACCCAAGGTCCC
  5   1   2       bld Ov1  5x3                        IMAGE:6317809.5p                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGCCGGAAGAGGAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTCCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTCGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAAGTCCCGAATTATGGTGATTTTGAGGGGAGAAGTTGACCCGATGCATCCCCTCCNTTTTCCCATGCCAT
  5   1   2       bld Kid  5x3                        IMAGE:7009993.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGTAGAGTGGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGGTGCATGCTGCAGAATCATGCATCCCTTT
  5   1   2       bld Egg1 5g                         IMAGE:3300733.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCACGAGTAGTGCGTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACANGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGA
  5   1   2       add Ga12 5g3  in                         XL168o24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCGTACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCAGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCGTGTAGAAGAGCTGGAGCATCGATATATTCAGCTGTCAGGAGAAACATACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGGAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATACGGCTGGTAACTGAGCGCAATGAATGGTACAGGAGGCTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTANAGGAGGATGGGAGACGG
  5   1   2       bld Ga12 5g3  in                         XL189a11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCACACGCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGGCACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAA
  5   1   2       bld Ga12 5g3  in                         XL187b24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGGTGCCTCGCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGGCACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATAGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGA
  5   1   2       bld Eye1 5x3                        IMAGE:6959336.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGGTCTGTAGCTGCTGCTCAAGTTCAGCAAATCCTCCTGATGTCGGCGCTTGTTGTACCCAGCTGTCACACTCGCACATCATGACGCTGCCCGGCCCCAGGCTCTCCAGGAATCCACCAGACACCTTCACTGAATCTAGCTTCGGTTTACAGACTTGATGCAAGAGAGAGTGGAGCTGAAGGAGCATGTAGAAGAGCTGGAGCATCGTTGTATTCAGCTGTCAGGAGAAACACACTATTGGTGAATACATTGCACTTTATCAGAACCAGAGAGCCATACTGAAGCAGCGTCACAAGGAAATGGAGCAGTACATTAGCTGACTGGCTCAGGACAAAGAGGAGATGAAGGCTAATCTGCTGGAATTGCAAGTTTTGGTCATGCGACTGGTAACTGAGCACAATGAATGGTACAGGAGGTTCATGGAAGCAACCCAGGGTCCCCAGACAGGGTCAGAAGAGTTCCCAGCAGAAAACCCTATGGAACTTGAAGGAAAAGAGAATGGAGCTCTGGAGGAAGTCGGCTTAGAAGAGGATGGGAGACGGGAAGTACAGTCATTGCCTCATTTGGCAGCTCCTCAGGAACGACTAAACCCCTGGATCAGAAGACCCAACCACTAAACAAATTATGCATGAGATACAGAATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGATTTGAGGGAGAAGTTGACCGATGCATCCCCTCTTTTCCCATGCCAACGCCTGCTTGTGCTGGGATTCATTTTCTCCCAGGACACATTAGAAACATTGCTTTGGGGATGGGGGGAATGCTGGANATTGGCCATTAATGGA
  5   1   2       e50                                 Xl3.1-XL051h22.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGATTTGAGGGAGAAGTTGACCGATGCATCCCTCCTTTTCCAAGGACACATTAGAAACCATTGCTTTGGGATGGGGGAGTGCTGGAGATTGGCAATTAATGGAATGGATGTGGAGAACTGTTGCCTTTCTGTACTGAATTTTGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGCTATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATCTGAAGCACTACTGTTTGATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGGGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTCTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGTAAGTATGCAGTCCAAGGAATCTCTTCTCTTGCATGGCGTTGATCTCATACACATGGGAAGAGTTTTTGTTTTTTTTAACAGCTGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAATGGTCAATGAAAGATATAAGTTAAAGTGCAGATAGAAGTTGTATCCAACCTCAAGTCTTTCTAGGGGAAATTCCTGAATGAAACTGATATATCTACGGTCGACTGAACCCAGTACATTGTCAGACACATTGTGCAGCCTGAACTGGTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTAAATAAGGAGTAGCAGAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAGCTTAAAGGATCAGTAACATCAATTTTTTTAAACAATAAAAAATTGGTTAGTATAGAACGAAAAAAAAACACAAAGACACATATTAAACTTTTAAATCGCTAAGTATTTAGTATTCAAAAATAACTTACCCAAACTGCGATTGAGCTCCTCTTCAGAAAAGGCGACAAGGCCACAATCCGTCATGCGGCGCTCGATTTCTCCTCCCTAGCTATCTCCTATAAGGAGAGCAGGGAGGAGAGATCGAGGGGGGGGCCGGAGATCACCGGGTTGCCTTTTCTGAAGAGGAGCGAGCGCAAGTGGAGTTTCGGTTAGTTATTTCTTAATAAAGT
                                                  Xl3.1-CHK-1012689374                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGATTTGAGGGAGAAGTTGACCGATGCATCCCTCCTTTTCCAAGGACACATTAGAAACCATTGCTTTGGGATGGGGGAGTGCTGGAGATTGGCAATTAATGGAATGGATGTGGAGAACTGTTGCCTTTCTGTACTGAATTTTGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGCTATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATCTGAAGCACTACTGTTTGATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGGGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTCTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGTAAGTATGCAGTCCAAGGAATCTCTTCTCTTGCATGGCGTTGATCTCATACACATGGGAAGAGTTTTTGTTTTTTTTAACAGCTGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAATGGTCAATGAAAGATATAAGTTAAAGTGCAGATAGAAGTTGTATCCAACCTCAAGTCTTTCTAGGGGAAATTCCTGAATGAAACTGATATATCTACGGTCGACTGAACCCAGTACATTGTCAGACACATTGTGCAGCCTGAACTGGTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTAAATAAGGAGTAGCAGAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAGCTTAAAGGATCAGTAACATCAATTTTTTTAAACAATAAAAAATTGGTTAGTATAGAACGAAAAAAAAACACAAAGACACATATTAAACTTTTAAATCGCTAAGTATTTAGTATTCAAAAATAACTTACCCAAACTGCGATTGAGCTCCTCTTCAGAAAAGGCGACAAGGCCACAATCCGTCATGCGGCGCTCGATTTCTCCTCCCTAGCTATCTCCTATAAGGAGAGCAGGGAGGAGAGATCGAGxxxxGxxCxGxxGATCACCGGGTTGCCTTTTCTGAAGAGGAGCGAGCGCAAGTGGAGTTTCGGTTAGTTATTTCTTAATAAAGTTAACGA
  5   1   2       bld Gas7                   IMAGE:3749773-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCCCCAGGAATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGATTTGAGGGAGAAGTTGACCGATGCATCCCTCCTTTTCCAAGGACACATTAGAAACCATTGCTTTGGGATGGGGGAGTGCTGGAGATTGGCAATTAATGGAATGGATGTGGAGAACTGTTGCCTTTCTGTACTGAATTTTGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGCTATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATCTGAAGCACTACTGTTTGATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGAGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATACTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGTAAGTATGCAGTCCAAGGAATCTCTTCTCTTTGCATTGCGTTTGATCTCATACACATGGGAAGAGtttttgattttttACAGCTGCAAAAGTT
  5   1   2       bld Gas5      in                    IMAGE:3749773.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGGCCTGGTGCCATGCTGCAGAATCCATGCATCCCCTTTTTCTACCGTGCTGACTAAAATGACGAGGTCCGAATTATGGTGATTTGAGGGAGAAGTTGACCGATGCATCCCTCCTTTTCCAAGGACACATTAGAAACCATTGCTTTGGGATGGGGGAGTGCTGGAGATTGGCAATTAATGGAATGGATGTGGAGAACTGTTGCCTTTCTGTACTGAATTTTGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGCTATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTAGAATAGTCAGTCTTATTTCTGGAT
  5   1   2       bld Egg1      in                    IMAGE:4783109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCACGAGGCGAATTATGGTGATTTGAGGGAGAAGTTGACCGATGCATCCCTCCTTTTCCAAGGACACATTAGAAACCATTGCTTTGGGATGGGGGAGTGCTGGAGATTGGCAATTAATGGAATGGATGTGGAGAACTGTTGCCTTTCTGTACTGAATTTTGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGCTATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATTTGAAGCACTACTGTTTGATATGATGTTGAC
  5   1   2       bld Egg1      in                    IMAGE:4783918.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGAGAAGTTGACCGATGCATCCCTCCTTTTCCAAGGACACATTAGAAACCATTGCTTTGGGATGGGGGAGTGCTGGAGATTGGCAATTAATGGAATGGATGTGGAGAACTGTTGCCTTTCTGTACTGAATTTTGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGCTATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATTTGAAGCACTACTGTTTGATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGGGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTCTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGT
  3   1   2       bld Neu7 5g3  in                         XL021d17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGATGGGGGAGTGCTGGAGATTGGCAATTAATGGAATGGATGTGGAGAACTGTTGCCTTTCTGTACTGAATTTTGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGATATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATCTGAAGCACTACTGTTTGATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGGGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTCTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGTAAGTATGCAGTCCAAGGAATCTCTTCTCTTGCATGGCGTTGATCTCATACACATGGGAAGAGTTTTTGTTTTTTTTAACAGCTGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAATGGTCAATCAAAGATATAAGTTAAAGTGCAGNATAGAAGTTGTATCCAACCTCAAGT
  5   1   2       bld Egg1                               PBX0081F02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAATTTTGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGCTATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATCTGAAGCACTACTGTTTGATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGGGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTCTAGAACTTTGGGT
  5   1   2       bld Ga12      out                        XL200c10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGATATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATCTGAAGCACTACTGTTTGATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGGGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTCTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGTAAGTATGCAGTCCAAGGAATCTCTTCTCTTGCATGGCGTTGATCTCATACACATGGGAAGAGtttttgttttttttAACAGCTGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAATGGTCAATGAAAGATATAAGTTAAAGTGCAGATAGAAGTTGTATCCAACCTCAAGTCTTTCTAGGGGAAATTCCTGAATGAAACTGATATATCTAC
  3   1   2       bld Ga12 5g3  in                         XL189a11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTCCCATAGTGAATAGTTGGTGAAATGTGGAGTATTTTCTTCCACCCAAGGGAACCCCTGTATTGCACAGGCCAATGGGTTATACCATTCAGTGCAGATTTGTTTCCACACTCTAGTTTAAAGCTGCTATTTTCACCTGCTACCCTTGGGGGAGGGGGCTCAACCCCATCCACTTGAATAGTCAGTCTTATTTCTGGATTTTCACATATCTGAAGCACTACTGTTTGATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGGGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTTTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGTAAGTATGCAGTCCAAGGAATCTCTTCTCTTGCATTGCGTTGATCTCATACACATGGGAAGAGTTTTTTTGTTTTTTTAACAGCTGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAATGGTCAATGAAAGATATAAGTTAAAGTGCAGATAGAAGCTGTATCTAAAAGTTTAAAAAAGAAGA
  3   1   2       bld Ga12 5g3  in                         XL187b24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATATGATGTTGACCACAAGAAGAATGGTGGTTTAGAAATGAGGTGGAGGGTTATACTGTTAGGGGGAAGGCTGTTCAGGCAGAACAAAAGAGATATGACCATGTTGATTGTTCTCTGTTCATTCTCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTCTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGTAAGTATGCAGTCCAAGGAATCTCTTCTCTTGCATTGCGTTGATCTCATACACATGGGAAGAGTTTTTTTGTTTTTTTAACAGCTGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAATGGTCAATGAAAGATATAAGTTAAAGTGCAGATAGAAGCTGTATCCAACCTCAAGTCTTTCTAGGGGAAATTCCTGAATGAAACTGATATATCTACGGTCGACTGAACCCAGTACATTGTCAGACACATTGTGCAGCCTGAACTGGTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTAAATAAGGAGTAGCAGAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCCATATATCTTGAATGTGTAACTTT
  3   1   2      seed Ga12      in                         XL203o05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGATAATAAGTAATCCTTTGGGAAAAATGTGTTATTCTAGAACTTTGGGTAAAGGCAGGTGATTGACGTTGCTTGTAAGTATGCAGTCCAAGGAATCTCTTCTCTTGCATGGCGTTGATCTCATACACATGGGAAGAGTTTTTGTTTTTTTTAACAGCTGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAATGGTCAATGAAAGATATAAGTTAAAGTGCAGATAGAAGTTGTATCCAACCTCAAGTCTTTCTAGGGGAAATTCCTGAATGAAACTGATATATCTACGGTCGACTGAACCCAGTACATTGTCAGACACATTGTGCAGCCTGAACTGGTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTAAATAAGGAGTAGCAGAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAGCTTAAAGGATCAG
  5   1   2       add Emb4                            IMAGE:5572186.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAATGTGTTATTCTAGAACTTTGGGTAAAGGCAGGTGATTGACATTGCTTGTAAGTATGCAGCCCAAGGAATCTCTTCTCTTGCATTGCGTGATCTCATACACATGGGAAGAGGTTTTTGTTTTAACAGCTGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAAATGGTCAATGAAAGATATAAGTTAAAGTGCAGATTGTTATAGAAGCTGTATCCAAACTCAAGTCTTTCTAGGGGAAATTCCTGAATGAAACATATATCTATGGTCGACTGAACCCAGTACATTGTCAGGCACATTGTGCAGCTCTGCAGCCTGAACTGGTATCATTACAATCAGTCCGGCTTCATAAAAGGCATATGGAGGTTGTTTTTAAATAAGTAGTAGCAGAAGACTTACACCTAAGCAGCGGATAAAAATGATATACTGACGAGCATTACATGAGCACAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGCAAGTTTTGAGGAATTTGCACCTTGGCCTTCTCTCTGCTTAAAAGGGCCATATACCATATGACCGGGTATAATGCCCCAGCCGCCCTGGTTAAttttttcactttaaatttttttagatttccctggatgcccacccccttttttCTTCATGCCATATATCCTTGGAATGGGGAAACCTTTTGGTGGCCTCCCTGCTTGTTTTGGCCCCCATGCAAAAGCCTGCAAAAACCCGCTAAAGGGATCCGACCACACCCAACTCTTTCCTTTTAAACACAAACAATCCGCGCCCATTAGAGACAATGTGCACACAACGACCCCAGGAACCTTTTGTCAACCTTTTGGCAACCGCTGCAGCttttttttttAACAGACAGTTGCTTCCCCCAAAAATGCGCGCAAAGGCGATTTCCCACCTACTCCTACTCGCGGATATTCAGCCACAAAAACACAGCCG
  3   1   2       add Ga12 5g3  in                         XL168o24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACAGATGCAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAAATGGTCAATGAAGATATAAGTTAAAGTGCAGATTGTTATAGAAGCTGTATCCAAACTAAAGTCTTTNTAGGGGAAATTCCTGAATGAAACTGATATATCTACGGTCGACTGAACCCAGTACATTGTCAGACACATTGTGCAGCTCTGCAGCCTGAACAGGTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTGAATAAGGAGTAGCAGAAGACTTAGACNTAAGCAGTGGATAAAAATGATATNCTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTNGAAAGTAGCACACATTGAGGTTTTAAGGAATTTGCACCTTTCCCTTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTTTTTTAGATTTCATGATGTTAGCAGTTTTTnTAATTCATGCATATATCTTGAATGTGTAACCTNTTGTGC
  3  -1   2       bld Bla2      out                   IMAGE:7296618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAAGTTAAGGATTAAGGATTTTTTAGCTCAAAATGGTCAATGAAAGATATAAGTTAAAGTGCAGATAGAAGTTGTATCCAACCTCAAGTCTTTCTAGGGGAAATTCCTGAATGAAACTGATATATCTACGGTCGACTGAACCCAGTACATTGTCAGACACATTGTGCAGCCTGAACTGGTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTAAATAAGGAGTAGCAGAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTNGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAGCTTAAAGGATCAGTAACATCAATTTTTTAAAAAATAAAAAATTTGGTTAGTATAGAACGAAAAAAAAACACAAAGACACATATANNACTTTTAAGTCGCTAAGTTATTTAGTATTCAAAAATACTTTGCAAAACTGCGATGAGTCCCTCAAGACGCCCCC
  5   1   2       bld Eye1                            IMAGE:6944767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGAATTCCCGGGATTGAACCCAGTACATTGTCAGACACATTGTGCAGCCTGAACTGGTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTAAATAAGGAGTAGCAGAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCATGCAAAACTGCAAAAGCTTAAAGGATCAGTAACATCAATTTTTTAAAACAATAAAAAATTGGTTAGTATAGAAAGaaaaaaaaaaCACGAAGACACATATTAAACTTTTAAATTTATTTAGTATTCAAAAATAACTTACCCAAACTGCGATTGGGCTCCTCTTCAGAAAAAGGGGACGCGGCCACAGTCCCGTCGTTGCCGGACTGTACAGTTTCACCCGAAGTATAAGACAGAGAGCGCATGATCAGCTTGTGTGTCCGTCGGGGGGGCCGGAGCATTTTTCTGTTAGTTTGAGTCCGACATACGCAGGAGTATATGCGAACATATAGTGAAGATAACTTGCACACGATTATCAACCCTGCGTATAAGTACGCCCCGAGCATAGTAACTCTACATCGTTCGAGTCTCCCCCTCTCTAACCCACCCTGTGTGTATAATTCACCGCCTGTTGCAGCCACAAGAGGGGCACCGCGCGCTAACGCTGATAGTATCTACAACTTCGACTTTGACCCTACTCACATTTCCAATCAATAGCTCTATTGTTTTCGCTGTATTTTCACTGT
  3   1   2       bld Egg1      in                    IMAGE:4783918.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACGGTCGACTGAACCCAGTACATTGTCAGACACATTGTGCAGCCTGAACTGGTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTAAATAAGGAGTAGCAGAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAGCTTAAAGGATCAGTAACATCAATTTTTTAAAACAATAAAAAATTGGTTAGTATAGAACGAAAAAAAAACACAAATACACATATTAAACTTTTAAATCGCTAAGTATTTAGTATTCAAAAATAACTTACCCAAACTGCGATTGAGAAAAAAAAAA
  3   1   2       bld Egg1      in                    IMAGE:4783109.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTATCATTACAATCAGTCTGGCTTCATACAAGGCATATGGAGGTTGTTTTTAAATAAGGAGTAGCAGAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAGCTTAAAGGATCAGTAACATCAATTTTTTAAAACAATAAAAAATTGGTTAGTATAGAACGAAAAAAAAACACAAAGACACATATTAAACTTTTAAATCGCTAAGTATTTAGTATTCAAAAATAACTTACCCAAACTGCGATTGAGAAAAAAAAAAA
  3   1   2       bld Tbd7 5g3  in                         XL051h22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTAAATAAGGAGTAGCAGAAGACTTAGACNTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAGCTTAAAGGATCAGTAACATCAATTTTTTAAAACAATAAAAAATTGGTTAGTATAGAACGAAAAAAAAACACAAAGACACATATTAAACTTTTAAATCGCTAAGTATTTAGTATTCAAAAATAACTTACCCAAACTGCGATTGAGCTCCTCTTCAGAAAAGGCGACACGGCCACAATCCATCGTGCGGCGCTCGATTTCTCCTCCCTAGCTATCTCCTATAAGGAGAGCAGGGAGGAGAGATCGAGCACCGCACGGTGGATCACCGGGTTGCCTTTTCTGAAGAGGAGCGAGCGCAAGTGGAGTTTCGGTTAGTTATTTCTTAATAAAGTTAACGATTTAAAAGTTTGTCCTTGTTTTTTCCGTTCTATACTAACAAAATTCTAAAAATTGTCGACC
  3   1   2       add Egg6 5g3  in                    IMAGE:4412598.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGACTTAGACCTAAGCAGTGGATAAAAATGATATACTGACGAGCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGCACACATTGAGGTTTTAAGGAATTTGCACCTTTCCCTTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTTTTTTAGATTTCATGATGTTAGCAGTTTTTTTAATTCATGCATATATCTTGAATGTGTAGCCTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAGCTGCAAAAGCTTAAAGGATCAGTAACATCA
  5   1   2       bld Egg1                               PBX0015F01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATTACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAACTTAAAGGATCAGTAACATCAATTTTTTTAAACAATAAAAAATTGGTTAGTATAGAACGaaaaaaaaaCACAAAGACACATATTAAACTTTTAAATCGCTAAGTATTTAGTATTCAAAAATAACTTACCCAAACTGCGATTGAGCTCCTCTTCAGAAAAGGCGACAAGGCCACAATCCGTCATGCGGCGCTCGATTTCTCCTCCCTAGCTATCTCCTATA
  5   1   2       bld Egg1                               PBX0013G01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATTACATGAGCAGAAGCATATTTATGTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAACTTAAAGGATCAGTAACATCAATTTTTTTAAACAATAAAAAATTGGTTAGTATAGAACGaaaaaaaaaCACAAAGACACATATTAAACTTTTAAATCGCTAAGTATTTAGTATTCAAAAATAACTTACCCAAACTGCGATTGAGCTCCTCTTCAGAAAAGGCGACAAGGCCACAATCCGTCATGCGGCGCTCGATTTCTCCTCCCTAGCTATCTCCTATAAGGAGGGCAGGGAGGAGAAATCGAGCACTGCACAACGGATCACCGGATTGCCTTTTCTGAAGAGGAGCGAGCGCAAGTGGAGTTTCGCTTAGTTATTTCTTAATAAAGTTAACGATTTAA
  5   1   2       bld Egg1                               PBX0016G01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACATGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATGCAAAACTGCAAAAACTTAAAGGATCAGTAACATCAATTTTTTTAAACAATAAAAAATTGGTTAGTATAGAACGaaaaaaaaaCACAAAGACACATATTAAACTTTTAAATCGCTAAGTATTTAGTATTCAAAAAATAACTTACCCAAACTGCGATTGAGCTCCTCTTCAGAAAAGGCGACAAGGCCACAATCCGTCATGCGGCGCTCGATTTCTCCTCCCTAGCTATCTCCTATAAGGAGGGCAGGGAGGAGAAATCGAGCACTGCACAACGGATCACCGGATTGCCTTTTCTGAAGAGGAGCGAGCGCAAGTGGAGTTTCGCTTAATTATTTCTTAATAAAGTTAACGATTTAAAAGTTTGTCCTTTCCGTTCTATACTAACA
  3   1   2       bld Gas5      in                    IMAGE:3749773.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAGCAGAAGCATATTTATTTTATATTTGAAAGTAGTACACATTGAGGTTTTGAGGAATTTGCACCTTGCCATTCTCTCTGCTTAAAGGGCCATATACCATATGACCGTGTACAATGTCTCAGAGTGTCCTGGTTAATTTTTCACTTTAACTGTTTTAGATTTCATGATGTTGGCAGTTTTTTTAATTCATGCATATATCTTGAATGTGTAACTTTTTGTGCCTCCTGTTGTTTGACCCATAAAATAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)