Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7390097.5.5                    33 PI      91         31     1001                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012838483 Xl3.1-IMAGE:8640824.5.5 - 56 ESTs
                                                                       .-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8640824.5.5                                          TCCCCTCAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAGAGGCGCAACGTTGACATGCAACAGAGGCTGCTCGAGCTCTCCTCCGAGAATGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCAGGCACTTCTTCAAGCAGCTGCCCCCCGCTGCCACCGGCCCCTTCCTGCCCAGCCTGACGGGCATCGACTGCCGGTAACCCGACCCCCCGACCCTGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGTCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGCGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCGCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATAAATATATATATATAAATATTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTTCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCATTTTTAATATGAATAATAAAAAAACAAAACA
                                                  Xl3.1-CHK-1012721559                                                CAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAGAGGCGCAACGTTGACATGCAACAGAGGCTGCTCGAGCTCTCCTCCGAGAATGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCAGGCACTTCTTCAAGCAGCTGCCCCCCGCTGCCACCGGCCCCTTCCTGCCCAGCCTGACGGGCATCGACTGCCGGTAACCCGACCCCCCGACCCTGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGTCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGCGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCGCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATAAATATATATATATAAATATTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTTCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCATTTTTAATATGAATAATAAAAAAAC
                                                      consensus depths                                               2     3    11    13    13    13    13    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    16    15    16    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    16    14    15    14    14    14    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    11    13    12    12    12    12    12    12    12    13    13    13    10    13    13    13    10    14     8    15    11    15    12    15    11    15     9    15     6    15     6    15     6    14     5    14     4    12     4    12     4    10     4    10     4    10     4    10     5     8     5     7     5     7     4     6     4     7     5     7     5     7     5     7     5     7     7     8     7     7     7     7     7     7     7     8     7     8     8     9     9     9     9     9     7     9     9     9     9     9     9     9     9     9     9     9    10    10     9    10     9    10     8    10     8    10     8    10     8    10     9    11     9    11     9    11     9    11    10    12    11    12    11    12    12    15    11    14    11    14    12    14    13    14    11    14    11    14    11    14    11    15    12    15    12    15    12    15    12    14    12    14    12    13    12    13    12    13    12    12    13    14    13    14    12    14    13    14    13    15    13    16    13    17    14    18    14    18    14    18    14    18    15    19    15    19    14    19    11    21    11    21     9    21    11    21    11    21    10    21    11    21    11    21    10    21    10    21    10    23    10    23    10    23     5    23     5    23     5    23     5    23     5    23     5    23     9    23     9    24    10    24    10    23    10    22     7    21     9    21     9    21    10    21    10    21    11    20    11    18    11    18    11    18    11    18    11    18    11    18    12    18    12    18    13    19    13    19    13    19    13    19    14    20    13    20    14    20    13    19    13    19    13    19    13    19    13    19    13    19    13    20    13    20    12    20    12    20    13    20    11    19    13    19    11    17    12    18    11    18    12    20    17    21    13    20    13    20    13    20    12    19    13    20    14    20    14    20    14    20    13    20    12    19    12    19    12    19     8    17     5    14     4    10     3     3
  5   1   2       e>3                            Xl3.1-IMAGE:6955705.5                                      TTCGTCCCCTCAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACTCGCCGTGAGGAAAGAGCCGCGACAAAGCCAAGAGG
  5   1   2       e>2                            Xl3.1-IMAGE:8640824.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAGAGGCGCAACGTTGACATGCAACAGAGGCTGCTCGAGCTCTCCTCCGAGAATGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCAGGCACTTCTTCAAGCAGCTGCCCCCCGCTGCCACCGGCCCCTTCCTGCCCAGCCTGACGGGCATCGACTGCCGGTAACCCGACCCCCCGACCCTGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGTCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGCGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCGCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATAAATATATATATATAAATATTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACACCATAGCAATGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCT
  5   1   2       e>2                            Xl3.1-IMAGE:8541603.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGTTACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTTCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCATTTTTAATATGAATAATAAAAAAACAAAACA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                               BLH ATG      93     590                                          
                                               BLH MIN      90      74                                          
                                               BLH OVR      93      79                                          
                                               CDS MIN      93      34                                          
                                               EST CLI       5      34                                          
                                               ORF LNG      93       4                                          
  5   1   2       e>3                            Xl3.1-IMAGE:6955705.5                                      TTCGTCCCCTCAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACTCGCCGTGAGGAAAGAGCCGCGACAAAGCCAAGAGG
                                                  Xl3.1-CHK-1012691291                                            CCCTCAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACxxxxCxxxxxGxAAGAGCCGCGACAAAGCCAAGAGGCGCAAC
  5   1   2       bld Int2 5g                         IMAGE:8825121.5p TCACCCACTGAACAAATAGGAGGACTCCAAAAATAAATTCGTCCCCTCAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGCCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAGCCAGAGCGCAACGTTGACATGCACAGAAGGCTGCTCGAGCTTCTCCTCCGAGAATGAGAAACTGCCCCAAAAAAATCGAAACTTTCTCCCACCCAGGGGAACTTTA
  5   1   2       bld Lmb1 5g                         IMAGE:8533404.5p      AAAACTTCGTGTCNGTGCAGAGACTCGAAAGAATTGTCCCCTCAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCTCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCAGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGGCAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACACATCGCCGTGAGGAAGAGCGCGACAAGCCAAGAGCGCACGTTGACTGCACAGAGCTGCTGACTCTCTCG
  5   1   2       bld Tail 5g3  in                    IMAGE:8543204.5p            AATGGNNNCCATGCATGNNGTNGAGAAGTACCTATATAAAATTCGTCCCGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCTTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCAGGAGCGCACAACATCGCCGTGAGAAGAGCGCGACAAAGCAAGAGCGCACGTTGAATGCACAGAGCTGTCGAGCTCTCTCGAGATGAAACTGCAAAAGATCAATTCCACAGGACTGACAGCTCGGAA
  5   1   2       bld Oo1  5g                         IMAGE:5084288.5p                                           ACAGCTCAGAAAGAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAGAGGCGCCAACGTTGACATGCCAACAGAGGGCTGGCTCGAAGCTCTCCCTCCGAAGAATGAAGAAACTGCCACAAAAAAGGATCGGAAC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4175429.5p                                              CTCAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAACAAACCGGTGGGGGA
  5   1   2       bld Kid  5g                         IMAGE:7007767.5p                                              CTCAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGTCCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGNAGCGCACACATCGCCGTGAGGAAGAGCGCGACA
  5   1   2       bld Tail 5g                         IMAGE:8544424.5p                                              CTCAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCTCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTGCTTCCCCAGCCGCTTCCTCCGGCTCGTGCGGAAAGACAAGTCGGGCAAGAATGCACTGATTGCTACACCCCAGTACCGCAGCGCCGGAGGCACACATCCCTTGAGGAAGCGCCACAAGCAAAAGGCACGTGAATGCACAAGCTGCTCACTTCTCTACAAGAAAAGCAAAAGATGAATTCCCGGACTGGCGCCCGCTTCTTCG
  5   1   2       bld He1  5g3  in                    IMAGE:4406972.5p                                               TCAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGGCGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTTATCTCTACCCCAACCAAATCGGAGCGTGTGCCCAGAA
  5   1   2       bld Brn1 5g                         IMAGE:6955705.5p                                               TCAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGCCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAGAGGGCGCAACGTTGACATGCAACAGAGGCTGCTCGAAGCTCTCCTCCGAGAATGAGAAACTGCACCAAAAAGATCCGAACTTTCTCACCAGGGAACTTTGAGCAGCCCTCAGGCACTTTT
  5   1   2      seed FaBN      in                    IMAGE:8075968.5p                                               CTAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCTCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCAGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACACATCGCCGTGAGGAAGAGCCGCGACAAACCAAGAGGCGCACCTTT
  5   1   2       bld Lu1  5g3  in                    IMAGE:4058447.5p                                                CAGAAAGAAACAAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCANGAGGGAGACTACCTGATGAGCGGGCTGCTG
  5   1   2       bld Lmb1 5g                         IMAGE:8535885.5p                                                TCAGAAAGAAACAGTGATAGCGCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGTCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACACCCCCAGTACCGGAGCCCGGGAGCGCACAAATCGCGGTGAAGAGAGCGCAACAAGCAAGAGCGCACGTGACTGCAAAAAGTGCCGAGCTTCTCCAAAGAAAATG
  5   1   2       bld FaB  5g                         IMAGE:8072427.5p                                                    GAAGAACAAGTGATAGCGCCTGACAGGTAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGCCACTTTAGAGGCAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCTCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAACACCTCCGCCTGTCCTTCCCAAGCCGCTTCCTCCGGCTCGTGCGGCAAAACAGGTCTGGCAAGAAGTGCACTGATCTCTACAGCCCTCAATACCGGCAGCGCCGGGAGCGCAACACATCTCCGTGAGGAAAAGCCGCAAAAAGCTAGAAG
  5   1   2       bld Tail 5g3  in                    IMAGE:8541841.5p                                                                     GCCTGACAGGCAGCAGACCCGCATCAGCGCTAGAAGAGCAACAGTCACTTTAGAGACAGTCAATGAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTGCCCAACCAAATCGCAGCGTGTGGNCCAGACAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAAGCCAGCACCTCCGCCTGTCCTTCCCCGGGCGCTTCTCTCGGCTCGTGCGGCNAAGACAGGTCGGGGCAGAAGTGCACTGATCGCTACAGCCCGAGTACGGCAGCGCCGGGACGCACAACATCGCCGTGAGAGAGCGGCGACAAGCCAGAGCGCACGTGAATGCACAAA
  5   1   2       add He1                             IMAGE:4408492.5p                                                                                                                                     GAGTTCGCTGTCCATGAGCCTGGAGGCGCGCTGGCTGTCCCCCTATGCAGACTGCTCCATGGAGCCCACCAACTTATACCAGCAGCGGCTGAGCGGCTCCCCCGCCCCGCTCAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGAACCCTGGCGGAACTAAGCGCTGCCCCTGCCATGTATGATGACCAGAGCGCCATATACTTCAGCTCGCACATCGACTACATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACTAGCTCTTCCACGACCTCTTCAACTGCAGCACAAGCGGTGGGGGAGCGGCAGGAGGCACA
  5   1   2       chi Tail      in                    IMAGE:8541811.5p                                                                                                                                                                    AAAAANNNCCAGTCGNAGNNAAGAAGTACTAAATAAATTGNTCCCTACGAGCAGCGGCTGAGCGGCTCCCCCGCCCCGTACAAGCCGAGAGGCATGTGCGAGGAGCCCGAGGCTGCTGTGGGCACAGGCGGGACCCTGGTGGAACTAAGCGCTGCCCCTGCCATGTATGATGACGAGAGCGCCATAGACTTCAGCTCGTACATCGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTCTTCGCCGACCTCTTCAACTCCAGCAAAGCGGTGGGGGAGCGGCAGGAGGGAGACTACCTGATGAGCGGGCTGCTGGCGGCACCTCACTGTCCTCCTGGCCCGGCCAAAGTGCAGCTGAAGCAAGAGCCGGAGTGGAGCGACAGCGACATGTCCTCATCTCTACCCAACCAAATCGCAGCGTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCGGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAGAGGCGCAACGTTGACATGCAACAGAGGCTGCTCGAGCTCTCCTCCGAGAATGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCAGGCACTTCTCAAGCAGCTGCCCCCGCGTGCACGGCCTCTANCTGCCAGCTGACGGCATAACTGCGGTACCGACCCTCGACCTGGACTTTTACTCCTAACTCT
  5   1   2       e>2                            Xl3.1-IMAGE:8640824.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAGAGGCGCAACGTTGACATGCAACAGAGGCTGCTCGAGCTCTCCTCCGAGAATGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCAGGCACTTCTTCAAGCAGCTGCCCCCCGCTGCCACCGGCCCCTTCCTGCCCAGCCTGACGGGCATCGACTGCCGGTAACCCGACCCCCCGACCCTGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGTCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGCGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCGCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATAAATATATATATATAAATATTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACACCATAGCAATGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCT
                                                  Xl3.1-CHK-1012689865                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAGAGGCGCAACGTTGACATGCAACAGAGGCTGCTCGAGCTCTCCTCCGAGAATGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCAGGCACTTCTTCAAGCAGCTGCCCCCCGCTGCCACCGGCCCCTTCCTGCCCAGCCTGACGGGCATCGACTGCCGGTAACCCGACCCCCCGACCCTGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGTCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGCGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCGCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATAAATATATATATATAAATATTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACxxxAxAGCAATxAxACxATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCA
  5   1   2       bld FaB                             IMAGE:8070675.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTCCCCGGAGCCCAGCACCTCCGCCTGTCCTTCCCCAGCCGCTTCCTCCGGCTCGTGCGGCAAAGACAGGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAGAGGCGCAACGTTGACATGCAACAGAGGCTGCTCGAGCTCTCCTCCGAGAATGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCAGGCACTTCTTCAAGCAGCTGCCCCCCGCTGCCACCGGCCCCTTCCTGCCCAGCCTGACGGGCATCGACTGCCGGTAACCCGACCCCCCGACCCTGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGTCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGCGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCGCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAatataaatatatatatataaatatTTAGTGCAATAAGAAGAGATTTGCAGGTAT
  5   1   2       bld Tail      in                    IMAGE:8541915.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGCCATCGATACGAATTCGTCCCGTCGGGCAAGAAGTGCACTGATCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAGAGGCGCAACGTTGACATGCAACAGAGGCTGCTCGAGCTCTCCTCCGAGAATGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAGCAGCTGCCCCCCGCTGCCACCGGCCCCTTCCTGCCCAGCCTGACGGGCATCGACTGCCGGTAACCCGACCCCCCGACCCTGGACTTTAAAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGAGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAATCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTNatataaatatatatatataaatatTTAGTGCAATAAGAAGAGATTTGCAGGTATTTGCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAGTGGGCACAGTTTNACCCTTCAGTGCAGAGCTTGTTCATCTGCATGTTGCCATGCAGTGTCAGGAGAGTTGTGCCCATGGCATGTTCCACCTGTGATATGATACTGTAGTGCCTCTAC
  5   1   2       bld Tail      in                    IMAGE:8541870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GNGGAGTACCGATAAGAATTCGTCCCCGCTACAGCCCCGAGTACCGGCAGCGCCGGGAGCGCAACAACATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAGAGGCGCAACGTTGACATGCAACAGAGGCTGCTCGAGCTCTCCTCCGAGAATGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCAGGCACTTCTTCAAGCAGCTGCCCCCCGCTGCCACCGGCCCCTTCCTGCCCAGCCTGACGGGCATCGACTGCCGGTAACCCGACCCCCCGACCCTGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGTCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGCGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCGCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAatataaatatatatatataaatatTTAGTGGCATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCCAGTTACCCCTTCAGTGCAGAGCTTGTTCATCTGCATGTTGCCATGGCAGTGTCAGGAGAGTTGTGCCCATGGCATGTTCCACCTGTGATATGATACTGTAGGCACTCCACTGCAGTGCTGATGACATGTAGTGC
  5   1   2       bld Tail      in                    IMAGE:8541603.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGACAAGCCAAGAGGCGCAACGTTGACATGCAACAGAGGCTGCTCGAGCTCTCCTCCGAGAATGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCAGGCACTTCTTCAAGCAGATGCCCCCCGCTGCCACCGGCCCCTTCCTGCCCAGCCTGACGGGCATCGACTGCCGGTAACCCGACCCCCCCGACCCTGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGTCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGAGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCTCTTACAGACTGAGCCAAATACTTATCACATCTTTaatataaatatatatatatatataaatatTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCATCTTAACCGCTTCAGTGCCAGAGCTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATT
  5   1   2       bld Tail      in                    IMAGE:8542071.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANGAGTACTCTAAAAAATTCGTCCCCTTCTCACCAGGGACTTGAGCAGCCTCAGGCACTTCTTCAAGCAGCTGCCCCCCGCTGCCACCGGCCCCTTCCTGCCCAGCCTGACGGGCATCGACTGCCGGTAACCCGACCCCCCGACCCTGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGTCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGCGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCGCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAatataaatatatatatataaatatTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAACTTGTTNCATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTCTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCTGCTCTGCACTCAAGCGTTGAATTAGGGAGCCAGCTGTGGCCTGTGGCTCTGACATCGCTCTGGCCTGCTGTGACTAGGTGTGTAGTTCACACAAATGTATA
  5   1   2      seed Sp1                             IMAGE:4965133.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGACGCGTGGGCGCTTCACCGGCCCCTTCCTGCCCAGCCTGACGGGCATCGACTGCTGGTAACCCGACCCCCCGACCCTGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGTCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGCGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCGCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAatataaatatatatatataaatatTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATTTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGGCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGA
  5   1   2       bld Lmb1                            IMAGE:8534156.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ccgaccccccgacccTGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCTGCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGATGGAGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAatataaatatatatatataaatatTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGCCCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACACTGGGGCTGCATCAGTACTCAGGATAGGGT
  5   1   2       bld Int2                            IMAGE:8823531.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAATTTTATTTTAGCTCCTGGTTTTTTTCTTTCAAATTCGTCCCGGCATGAAGATCGGCATCAGATGGAGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAatataaatatatatatataaatatTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGCCCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGATAAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGCTAACTCAAAGCTGCAGAGCTTCACCACACCATAGCAATAAGAACACTACTGAGTGGGACAGTAATGCCAATAAGCTGGCCAGCCTGTGTTCTCAGCCGTCTAACTGCAACTCCCACAATGCTCCATGGCAATGTGCTGTAGAGGAACAATAG
  5   1   2       bld Brn1      in                    IMAGE:6956554.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGATCTCCAGTCCAACGCTTGGCATGAAGATCGGCATCAGCTGGCGCTGGAGGGCTGCAAGTGACACTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCGCGACCCCACAACCAGCATCTCTCACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAatataaatatatatatataaatatTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATTTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTNGTCACAACTGGGCTTGCATCAGTCACTCAGGATTAAGGTTCATTGATGCCACATTTGTAATCCTATTAAACCTGTTGGGATGTATGCCAAGCCTGCAGCCATACTCCCCTTACTGGTTCCATTCATCTCCGGCTTCAAAAAGTAAAGGGCTTAACTCAAAAACTGCCAAAGCTTTCCAACCCCCTTTACCAATTAAGGAAACTTATTGGAGTGGGGAAACCGTTAATGGCAAATAAGGGGCTGCCCAGCCTTTGTGGGGTTTCCTCAAGCCCAGGTTTCTTAAACTG
  5   1   2       add Lmb1                            IMAGE:8535900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTGCTGCAGCATCTCTCACACAGCTAGAGGGGCCCGACCCCACAACCAGCATCTCTCACAGCGAGAGGGGCCCGACCCCACAACTCTGAGACACTTGCTCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTtaatataaatatatatataaatatTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGACGTGGGCACCATCTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCTCCTCTCACCTGCCAGTGGCCTGCATTGCCCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACGTAGGGTGTTGTAGTTCAGCAGCTAGAGTGCTAGTACTGGATTATGAAGTGTTCACAATGGGTTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACCGTTTCATTCATCTCTGCTTTCATAGTAAGGGCTAAACTCAAGCTGCAGAGCTTCACACATAGNCATAGACACTACTGAGTGGGACAGTAGTGCATAAGGCTGCAGCTGTGGTACTCAGCATGCTACTGCACTCCACATGCAATGCTGAGGACTCAGCGATCCATACCC
  5   1   2       chi Tad1                            IMAGE:6939105.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAACTCTGAGACACTTGCTCTGCCCCCCCTTACAGACTGAGCCAAAGACTTATCACATCTTTAatataaatatatatatataaatatTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCCTTACTGGTTCATTTCCTCTCTGCTTCAATTAGTAAAGGGCTAACTTCAAAGCTTGCAAAGCTTCCCACACCCATAGCAATTAAAAAACTTTTTGAAGTGGGAAACAGGTAGTGGCATTAAGGGCGTGCCAACCTGTGTGGGTTCCCTTAACCCCACGTTCTAAACTTGGCAACCTCCCCACAAATGGCTCCATGGGGCCAAA
  5   1   2       bld Tad1                            IMAGE:6880151.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATCTTTAatataaatatatatatataaatatTTAGTGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAACTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTCTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAAGGTTCTTTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACCCACCATAGCAATAAGACACTATTGAGTGGGAAACAGTAGTGCAATAAGGCTGCCAGCTTTGTGGTTCCTCAGCCACCTTCTAACTGCCACTCCCACAATGCTCATGGCAAAAGGGCTGAGGGACTACCAGCTGATCACCTTTACCCACTTAGGTAAGGGGCCCCAAATTTTTTCCCCGGAAGCATTTAAACCCTGGCCAACCCAT
  5   1   2       bld Tad1                            IMAGE:6878840.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGCAATAAGAAGAGATTTGCAGGTATTGCCAGTGGGTAGTGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATTTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAAGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAAGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGACCAGTAAACCCTTGGCAAACT
  5   1   2       bld Lmb1                            IMAGE:8534450.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAANNCTTAACAGTTTNNNNANAGAGTCACTAAAAANTATTCGTCCCCTGCGAGAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAGCTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACATGGCACCAAATAGATGCTTGCTTTTAACAGCTGAAAAGTAAAGCTGCCCC
  5   1   2       bld FaB                             IMAGE:8070439.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCGCGAACGTTAGAGAGTTTGCGTCCGGAATTCGCGGGATGCCCCTGCGAGAAAAGGGAGAGAAGTGGGCACCAGTTTAACCCCTTCAGTGCCAGAACTTGTTCAATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCAGCCTGTGTATAATGAATACATGTAAGTGCACCTCTCACCTGCCAGTGGCCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAACCATGGGCACCAATAGATGCTTG
  5   1   2       add Lmb1                            IMAGE:8536238.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGAGCTTGTTCATCTGCATGTTGCCCATGGCAGGTGTCAGGAGGAGTTTGTGCCCCATGGGCATGTTTCCCACCCTGTGTATAATGAATACATGTAAGTGCTCCTCTCACCTGCCAGTGGCCTGCATTGCCCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACGTAGGGTGTTGTAGTTCAGCAGCTAGAGTGCTAGTACTGGATTATGAAGTGTTCACAATGGGTTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACCGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTACTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTACCTCAGCCATGCCTAACTGCAACTCCCACAATGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCANGAGCAGTAACCATGGCAACCATAAGATGCTTGCTTTTAACAGCTGATAAGTAATGCTGCTGCTGATTGGTGCTATAGTTGTGCTCTGGGCAACTAGTGCTGTATACATNGGGCTTTGCATTCTGTGCTGTATCACTGACTACTGTCATGCATGCTGACAGTGCTACCCTAGCACGAGTTATACTACAAGATGCAGCTCTACGTACAGCATCAGGATCGCACT
  5   1   2       bld Skin      in                    IMAGE:8640824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTAAAATAAAAAATAACATTAGATTCGAATTCGTCCCCTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTTATTATTTTCTAGTTACCACGGCAGCTGACATTTACACAGAGATAGAAAATGTATTTCCTCTCACTCAGTATAAACAAGGCTAAACATTTCCCTTAccccccccccccGACTTCGTTAATAAGC
  5   1   2       bld Bone                            IMAGE:8743627.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATTGACCAGTGTTAGTTGCACCCCCTGCTCTGCCACTCAAGCGGTTGAATTAGGGAGGCCAAGCTGTGGCCCTGTGGCTTCTGAGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCTATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAAGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACGAGTGTCATTAGCCCCTTACAGCAGCCGACAGTATACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAGGCAGTGCCATGTGGATCTGGCCGACTGCAGTTCTAATTTCTAGTACATGCAGCTGACATTTACAACGAGAATGAAATGTATTTTCCTCTCCCACTCC
  5   1   2       bld Lmb1      in                    IMAGE:8532640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATCCATAATTACAGAGCTCATCGATTCGTATTCGTCCCGCATCGGCTCTGGGCCCTGCTGGTGCACATAGGGTGTTGTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTC
  5   1   2       bld FaB                             IMAGE:8069689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAGTTCAGCAGCCAGAGTGCTAGTACTGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACTCAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTTAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATGAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATACATAAAGGGCTTTTGCATTTCTTGTGCCTGTTATCAACTGAACTAACTTGGTTCATGCCATTGCTTGACTAGGTGTCTTAACCCCCTTCAGCAGCCCACATATAACTCTTACCCAAAGTATTGGCATGCTCCAATACTGTATACACAAGGATTGCCAATGGAATTGGGAAACCGCAATACCGCCAGGGAGCTAAATTTCACaaaaaaaaaTTTTTCCCTCCCCCAAATAAA
  5   1   2       e>2                            Xl3.1-IMAGE:8541603.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGTTACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTTCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCATTTTTAATATGAATAATAAAAAAACAAAACA
                                                  Xl3.1-CHK-1012689816                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTTCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCATTTTTAATATGAATAATAAAAAAAC
  3   1   2       bld Tail      in                    IMAGE:8541811.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTCCACTATCAAGCGTGTAATTAGGGAGCCAAGCTGGCATGGGCTCTGAGCATCGGCTGACCTGCATGCATAGGGTGTAGTCAGCAAGCAGAGTGCTAGTACTGATTAGAGTGTCACAACTGGGCTGCATCAGTCATCAGATAAGGGTTCATGATGCCACATTGTATCCTATAACTGTGGATGTATGGCAAGCTGCAGCCATACTCCTTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGGTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTCCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATCTACAACCATTAACAAAAAACCA
  3   1   2       bld Tail      in                    IMAGE:8541870.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGTTACTCCCCGTTGCACATCACCGTGATAGGAGCCAGCTGGACTTGGCTTGGCATGCTCGACTGTGGGCAATAGGGTGTGAGTTCACAGCAGAGTGCTAGTACTGAATAGAAGTGTCACAACTGGCTGCATCAGTCATCAGGATAGGGTCATGATGCCACATGTAATCTATAACTGTGGATGTATGCAAGCTGCAGCCATACTCCTTACTGTTTCAATCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCCAATACCTGCCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTCCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTTACT
  3   1   2       bld Tail      in                    IMAGE:8541915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCCTCTCAGGGTGAATAGGAGTCAAGCTGGACTTGACTTGGCATCGATGGCTGTGTGCATCGATTGTAGTCAGCAGCAGAGTGCTAGTACTGATATGGAGTTCACAACTGGGCTGCATCAGTCATCAGATAAGGTTCATGATGCACAATGTAATCTATTAACTGTTGATGTTGCAGCTGCAGCCATACTCCTTACTGTTTCATCATCTCTGCTTCATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTCCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGTTACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTTCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTCTACACCATTAAAATAACAAAAGAACAAA
  3   1   2       bld Tail 5g3  in                    IMAGE:8541841.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTCGGCCTGTGTGGCCGTAGGGTGTTTAGTTCACGCAGCCAAGAGGCTAGTACTGATTAGAAGTTTCACAACTGGGCTGCATCAGCATCAGATAGGGTTCATGATGCCACATTGTATCTATTACTGTGATGTATGCAAGCTGCAGCCATACTCGTACTGTTTCATCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTACTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTACTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATGACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGATATAAGTTACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATGAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTCACAACAGAGATAGAAATGTATTTTCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTACAGCAGGCAACTATAGAAA
  3   1   2       add Tail 5g3  in                    IMAGE:8543204.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGTGTGTATCACATTGGGGCTGCATACAGGTCCAGTTCAGGATAAGGATCCATGATGCCACATGGTATCTATTACATGTCGAATGTAGGCAAGGCTGCAGCCATACTTCCATTACTGATTCATTCATCTCTGCTCATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACACCATAGCAATCAGACACTACTGAGTGGGAAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTTCCTCAGCCACGTCTAAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGTTACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTTCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTGCGATGCAGTTATGGTACATTTGTATAATGATTTCCCACAGACGAGCCTTCGTATTGTAGATAATAGGGACAGAGAAATGCGCATGCTCAATTTTTCTACACGATAACTCGTCTCCCGAAACATAACATATACC
  3   1   2      seed Tail      in                    IMAGE:8541603.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATCTGGGCCTGGGCAATCAGTCATTCAGATACGGTTCAATGCATGCACATTTGTAATCCTATTACTGTCGGATGTATGGCAAGCTGCAGCCATACTCCTTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACCATAGCAATAAGACACTACTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGGTACCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATGACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGATATAAGTTACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATGAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTCACAACAGAGATAGAAATGTATTTTCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCCGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATCATAATGCTCGCCTCTCGAAACATTATACACATAGC
  3   1   2       chi Brn1      in                    IMAGE:6956554.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTCCAGTAAAAAGGGTTCCATGGGGGGCCAACAACTGTGATTCCCTAATTAACCCTTTTGGAGTGATATGCCAAGGGGGGAAGCCCAATCTCCCCTTAAGGGTTGCAGTCATTTTGTGGTTCAAGAAGGAAGGGCTAAATAAAAAGGTGCAGAGGGTTCGACCCCCCCATAGCAATTAAGACCACTATTGAGGGGGGAACAGTAGGGCAAAAAAGGGTGCCAGGTTGTGGGTCCTCAAGCCACGTTTAAATTGAACTTCCCACAATGCTCAGGCAAAAGGGCGGGGGACTACAAGCTGATCACATTACCCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCNTGCTGATTGGTTGCTATGAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCCAATACCTGCCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTCCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCGAA
  3   1   2       bld Tail      in                    IMAGE:8542071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGAGTTCCACACGGCTGCATCTGTACATCAGATAAGGTCCATGATGCCCATGTATTCATTAACTTTGATGTATGCCAAGTGCAGCCATACTCCTACTGTTCAATCATCTCTCTTCAATAGTAAGGGCTAATCCAAAGCGCAGAGCTTCACACACCATAGCAATAAGACACTATTGAGTGGGACAGTAGTGCATAAGGCTGCCAGCTTGTGGTTCTCAGCCACGTCTAACTGCAACTCCCACAATGCTCATGGCACATGGCTGAGGGACTACAAGCTGATCACATTTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCCAATACCTGCCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTCCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACA
  3   1   2       bld Ga18                             rxlk106b22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TNNNTNATCTCTGCNTNNNANNAGNCTNNCNNAAAGCTNNAGANCTTCANNNNNCNTAGCAATAAGACACTNTTGAGTGGGANCAGTAGTGNAATANGGCTGNCAGCTTGNGNTCNTCAGCCACGTCTAACTNNAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGNTCACATTTNCCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAANCCATGGCANCCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAANCTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGTGATAGAAATGTATTTCCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCNNNTTAAT
  3   1   2       bld Lmb1      in                    IMAGE:8532640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTGCTTCAATAGTAACGAGATAACTCAAAGCCTGCAGAGCTTCACACCATAGCAATCAGACACTACTGAGTGGGAACAGTAGTGCAATAAGGCTGCCAGCTTGTGCTCCTCAGCCACGTCTAACTACAACTCCCACAATGCTCATGGCAAATGGCTGAGGGACTACAAGCTGATCACATCTACCCACTTATGTAGGCACTAAGTTTTCTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTCCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTGCGATGCAGTTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTCTACACAATGGCTCGTCTCTGGAATCATTATACATATAGCA
  3   1   0       chi FaBN      in                    IMAGE:8075968.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTAANGAATCTGGTCAAATAAGCCAATAGTAATACCCAGTCGTTCATAAGATAGGACCAACACTATATTGGGTACAATAAGTAATTCAGCCCCGACTAGTATTACGTAACCAAGTTTACTAGCAACACCACAACGTTCATGGGCAATGGACCAGGGACTCCAAAGTGATCACCTCTCCCCATATATGCAGGCACTAAGTTTCTTCAGGAGCAGTAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGCTATTAAGATACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTTGCTTGACTAGGTGTCATTTAGCCCTTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATTTGGGTCAGACCTGCCAATACCTTCCTAAGGGCAGTTGAACATTTACAACTAGAGATAGAAATGTATTTCCTTTCCATTTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCCGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACACACAAATGACCATGCTCAATTTCTTTACACGAAACTCGACACCCGNAACCATATCTTGATACTATGTTTCTAAAA
  5   1   2       chi Emb4                            IMAGE:5514865.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTATGAAGTGTTCACAATCCAGTACTAGCACTCTGGTTAGGATAAGGGTTCATTGATGCCACATTTGTAATCCTATTAACCTGTTGGATGTATGCCAAGCTGCAGCCATACTCCCTTACTGTTTCATTCATCTCTGCTTCAATAGTAAGGGCTAACTCAAAGCTGCAGAGCTTCACACACCATAGCAATAAGACACTATTGAGTGGGAACAGTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCCAATACCTGCCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTCCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTAccccccccccccAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCATTTTTAATATGAATAATaaaaaaaaaaaaaaaaG
  3   1   2       bld Int2                            IMAGE:8820877.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCCAGTTATGTAGGCACTTAGTTTTCTCAGGAGCAGTAAAACCATGGCAACCAATAAGATGCTTGCTTTTAAACAGCTGATAAGTAAATGCTGCCTGCTGATTGGTTGATATAAGTTACTGCTCCTGGGCAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATGAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTCACAACAGAGATAGAAATGTATTTTCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTCACATCATAGGCTCGTCTCTCGGAAATCATTTACAAATGAACCA
  3   1   2       bld Skin      in                    IMAGE:8640824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGATAAGTAAATGATGCCTGCTGATTGGTTGCTATAAGATACTGCTCCTGGGCAAAACTTAGTGCCTGTTATTACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTCCTCTCCACTCAAGTATAAACAAAGCTAAAACATTTCCCCTTTACCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATCTCGACACCATAACATAACAAAAAAAACCAA
  3   1   2       bld He1  5g3  in                    IMAGE:4406972.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACATAAGGGGCTTTTGCATTTCTTGTGCCTGTTATCAGCTGAGCTAACTTGTTCATTGCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCTAGTTACCAAGGGCAGCTGAACATTTACAACAGAGATAGAAATGTATTTTCTCTCCACTCAAGTATAAACAAAGCTAAAACCAATTTCCCCCTTTACCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCATTTTTAATATGAATAAT
  3   1   2       add Lu1  5g3  in                    IMAGE:4058447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCATTGCTTGACTAGGTGTCATTAGCCCCTTACAGCAGCCGACAGTATAACTACTAGCCCAGAGGTATTGGCAGTGCTGCACATACTGTATCAGCAAGGGCAGTGCCAATGTGGATCTGGGCAGACCTGCAGTTTCTATATTTCAAGTTACCAAGGGCAACTCACCATTTCCACCAAAAAAANAAATGTATTTTCTNTCCANTCAAGTATAAACAAAGNTNNAACATTTCCCCTTTACCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTTCTGATGCAGNCTATGGTACATNTTGTATAATGATTTCCCAGAGACGAGCCCTTNTGTATTGTAGATAATAAGGGACAGAGAAATNNGAGCATGCTNCAATTTTTTTACATGATAATTTTTACAGCATTTTTAATATGAATAATA
  3   1   2       bld DMZ                                 rxl243d01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGCAAGGGCAGNGCCAANGNGGNTNTGGGCAGNCCTGCCAANACCNGCCAAGGGCAGNTGAACNTTTNCAACNGNGATAGAAANGNATTTCCNNTCCNCNCAAGNATAAACAAAGGTAAAACNTTTNCCCTTTACCCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCATTT
  3   1   2       bld Ov1                             IMAGE:4055225.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATTTCCCCTTTACCCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCATTTTTAATATGAATAATAAAAAAACAAAACAAAAGC
  5  -1   2       add Tbd7                                 XL073n04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTCCCCTTTAcccccccccccAACTTCCTTAAATTATTTTTGTAANGTAGTTTTTCTGTATTCTTTTCTGANGCAGCTATGGNACATTTGTATAATGATTTCCCANAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCaatttttttacatgataatttttacagcatttttaatattaataataaaaaaacaaaac
  3   1   2       bld Sp1  5g3  in                    IMAGE:4175429.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCCCCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTTCTGTATTCTTTTCTGATGCAGCTATGGTACATTTGTATAATGATTTCCCAGAGACGAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAATTTTTTTACATGATAATTTTTACAGCATTTTTAATATGAATAATAAAAAAACAAAACAAAAGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)