Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6861962.5                      10 END     4          16       40                MGC82630 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk136i22ex.3.5                      94 PI      83        814     1001                (no blast hit)
     3   0.0    0Xl3.1-xlk79m23ex.5.5                       65 PI      79        741     1002                (no blast hit)
     4   0.0    0Xl3.1-xlk147d12ex.3.5                      48 PI      92          1      552                (no blast hit)
     5   0.0    0Xl3.1-XL079h05.3                           25 PI      78        741      970                (no blast hit)
     6   0.0    0Xl3.1-xlk117f04ex.3                        22 PI      78        726      970                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:3473164.5                      19 PI      87        835     1004                (no blast hit)
     8   0.0    0Xl3.1-xl276j14.3                           11 PI      80        747      952                (no blast hit)
     9   0.0    0Xl3.1-XL205o11.5                           11 PI      76        711     1003                (no blast hit)
    10   0.0    0Xl3.1-rxl266l19.3                          10 PI      82        795     1001                (no blast hit)
    11   0.0    0Xl3.1-XL096m15.3                           10 PI      81        751     1003                (no blast hit)
    12   0.0    0Xl3.1-XL508b19ex.5                          9 PI      80        727      970                (no blast hit)
    13   0.0    0Xl3.1-xlk151e18ex.5                         9 PI      79        728     1002                (no blast hit)
    14   0.0    0Xl3.1-xl291i05.3                            8 PI      78        725      970                LOC496864 protein [Xenopus tropicalis]
    15   0.0    0Xl3.1-IMAGE:7974934.3                       7 PI      80        813     1003                (no blast hit)
    16   0.0    0Xl3.1-IMAGE:8540698.5                       7 PI      79        727     1001                (no blast hit)
    17   0.0    0Xl3.1-IMAGE:4032777-IMAGp.5                 6 PI      87        719      910                (no blast hit)
    18   0.0    0Xl3.1-xl278b18.3                            6 PI      84        761      998                (no blast hit)
    19   0.0    0Xl3.1-XL162i16.3                            6 PI      83        769     1002                (no blast hit)
    20   0.0    0Xl3.1-IMAGE:6877132.5                       6 PI      82        752      970                (no blast hit)
    21   0.0    0Xl3.1-IMAGE:7768661.5                       5 PI      82        726      932                (no blast hit)
    22   0.0    0Xl3.1-XL166k20.3                            5 PI      81        728      909                (no blast hit)
    23   0.0    0Xl3.1-xlk117m15ex.3                         4 PI      82        751     1004                MGC108344 protein [Xenopus tropicalis]
    24   0.0    0Xl3.1-IMAGE:6951228.5                       4 PI      81        728      910                (no blast hit)
    25   0.0    0Xl3.1-XL008n03.5                            4 PI      80        802     1004                (no blast hit)
    26   0.0    0Xl3.1-XL464j04ex.5                          4 PI      79        728     1003                integral membrane nucleoporin gp210 [Xenopus laevis]
    27   0.0    0Xl3.1-IMAGE:8734456.3                       4 PI      79        728     1002                (no blast hit)
    28   0.0    0Xl3.1-XL443j07ex.5                          4 PI      79        813     1001                (no blast hit)
    29   0.0    0Xl3.1-XL200l03.3                            4 PI      78        728      970                (no blast hit)
    30   0.0    0Xl3.1-xlk61h03ex.3                          4 PI      77        728     1004                (no blast hit)
    31   0.0    0Xl3.1-IMAGE:6948397.5                       4 PI      77        726     1001                (no blast hit)
    32   0.0    0Xl3.1-IMAGE:8743435.5                       4 PI      77        728      970                (no blast hit)
    33   0.0    0Xl3.1-IMAGE:8069656.5                       3 PI      87        806      950                (no blast hit)
    34   0.0    0Xl3.1-XL165d16.3                            3 PI      82        760     1006                (no blast hit)
    35   0.0    0Xl3.1-PBX0143H02.5                          3 PI      81        728      999                (no blast hit)
    36   0.0    0Xl3.1-XL192o03.3                            3 PI      79        767     1006                (no blast hit)
    37   0.0    0Xl3.1-XL163i04.5                            2 PI      85        728     1004                (no blast hit)
    38   0.0    0Xl3.1-XL429f03ex.5                          2 PI      85        726     1001                (no blast hit)
    39   0.0    0Xl3.1-rxl285m01.3                           2 PI      82        801     1001                Hypothetical protein LOC549618 [Xenopus tropicalis]
    40   0.0    0Xl3.1-XL433b23ex.3                          2 PI      82        724      910                (no blast hit)
    41   0.0    0Xl3.1-IMAGE:4174491.5                       2 PI      78        728      958                (no blast hit)
    42   0.0    0Xl3.1-XL199i20.3                            2 PI      78        776     1001                (no blast hit)
    43   0.0    0Xl3.1-XL484n23ex.3                          2 PI      78        728      948                (no blast hit)
    44   0.0    0Xl3.1-IMAGE:4407548-IMAGp.5                 2 PI      77        729     1001                MGC82812 protein [Xenopus laevis]
    45   0.0    0Xl3.1-IMAGE:3517696.5                       2 PI      77        728      970                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012838527 Xl3.1-XL100f05.3.5 - 24 ESTs
                                                                       .....-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL100f05.3.5                                                                                      AATGACAGTAAACAATTTACATCCCCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCTTTAAAGCGAGCCAGACTGCTTAGTCCTGGTGAGGCAGAAGTTGTTTTTGTGAGGAAGGACGATGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAATGCAATCTTCATGTGAATGGCAGTGTCATAACATCAGACCAACCTATTCTACTACGACTCAGCGACACACCATCTGCAACGAAAAAAGCAGAGATTCGAAGATCAAACACATTGTCTTCATCGAGTGCACCCAACCCACCTGCTGAAGTTGACCCCGACACCATTTTAAAAGCCTTGTTTAAATCTTCGGGCTCTTCAGCAGTTGTTCAGCCAACCGCATTTAAGATCAAACTCTGATGAGGCCAGCATGAGAACTAAAGAGGGAATGCTGGAGGGAATCAAAGATGGCTCTCGGTGTGACCAATTTTAAGATTTACCCAGAGAGAGACGAGACTTGTTTCAGAGAGATTTTGTTCGAACTGCTCATCGGTGGATTAGGGATTTTCAGACTGCTGCTCTGTTACCCTATCCTTTGTAGCGGCAGAATTACAGTTTCACTTTCCTTTTTGTTGAGCTGTTCCTGCAGTCCACATGCTGGTTTCTCTCCCAGGATGAAGTTCCTGTACAGTTTCTTGCCATTCTGTTTATTCTTATTAGGGATGCACCTAATCTACTAATTTGGATTCGGCCGAACCCCCAAATCCTTCGTGAAAGATTTGGCCGAATACCGAATCCTAATTTGCATATGCAAATTAGGAATGGGAAAACATTTTTTACTTCCTTGTTTTCTGACAAAAAGTCACGCGATTTCCCTCCCCATCCATAATTTGCATATGCCGATTCGGGTTTGGCTGGGCAGAAGGATTCGGCCGAATCCTGCTGAAAAAGACCGAATCCCGAACCGAATCCTGTATTCGGTGCATCCCTAATTCTTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGTTACTTTTTGGCTCTGGAATAAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTGTTTTTGTTTTTTTTGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTATTTCATACTAAGGCAGTACGTGATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGNAGTCGCTACTTGGGAGACGATCTGTGGAGTTAAAAGGCAAAGACAATAAAATAAGTCAGTGAAT
                                                  Xl3.1-CHK-1012722479                                                                                            AGTAAACAATTTACATCCCCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCTTTAAAGCGAGCCAGACTGCTTAGTCCTGGTGAGGCAGAAGTTGTTTTTGTGAGGAAGGACGATGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAATGCAATCTTCATGTGAATGGCAGTGTCATAACATCAGACCAACCTATTCTACTACGACTCAGCGACACACCATCTGCAACGAAAAAAGCAGAGATTCGAAGATCAAACACATTGTCTTCATCGAGTGCACCCAACCCACCTGCTGAAGTTGACCCCGACACCATTTTAAAAGCCTTGTTTAAATCTTCGGGCTCTTCAGCAGTTGTTCAGCCAACCGCATTTAAGATCAAACTCTGATGAGGCCAGCATGAxxxxxAAAGAGGxxxxxxTGGAGGGAATCAAAGATGGCTCTCGGTGTGACCAATTTTAAGATTTACxCxxAGAGAGACGAxxxTTGTTTCAGAGAGATTTTGTTCGAACTGCTCATCGGTGGATTAGGGATTTTCAGACTGCTGCTCTGTTACCCTATCCTTTGTAGCGGCAGAATTACAGTTTCACTTTCCTTTTTGTTGAGCTGTTCCTGCAGTCCACATGCTGGTTTCTCTCCCAGGATGAAGTTCCTGTACAGTTTCTTGCCATTCTGTTTATTCTTATTAGGGATGCACCTAATCTACTAATTTGGATTCGGCCGAACCCCCAAATCCTTCGTGAAAGATTTGGCCGAATACCGAATCCTAATTTGCATATGCAAATTAGGAATGGGAAAACATTTTTTACTTCCTTGTTTTCTGACAAAAAGTCACGCGATTTCCCTCCCCATCCATAATTTGCATATGCCGATTCGGGTTTGGCTGGGCAGAAGGATTCGGCCGAATCCTGCTGAAAAAGACCGAATCCCGAACCGAATCCTGTATTCGGTGCATCCCTAATTCTTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGTTACTTTTTGGCTCTGGAATAAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTGTTTTTGTTTTTTTTGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTATTTCATACTAAGGCAGTACGTGATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGNAGTCGCTACTTGGGAGACGATCTGTGGAGTTAAAAGGCAAAGACAATAAAATAAGTCAGTGAATGTTCAA
                                                      consensus depths                                                                                           2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     3     5     3     5     3     5     3     5     3     6     3     6     3     6     3     6     3     7     3     7     3     7     3     6     3     6     3     6     3     6     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     4     4     5     5     5     5     4     5     4     5     4     6     4     6     4     6     5     6     4     7     4     8     4     8     4     8     4     8     4     9     4     8     3     8     4     8     4     8     4     8     4     8     5     8     5     7     5     6     5     6     5     6     5     7     7     7     7     7     7     9     8     9     8     9     8     9     8    10     9    10     8    10    10    10    10    11    10    11    10    11     9    11     8    11    10    12    10    11    10    11    10    11    10    11    10    11    12    13    12    13    12    13    12    13    10    11    11    11    11    11    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    10    13     9    13     9    13     9    13     9    13     8    13     9    12     6    11     7    11     7    13     8    13     8    13     8    13     7    12     8    12     7    12     5     7     5     7     5     6     2     4     2     2     2     2     2     2     2     2     2     2
  5   1   2       e50                                 Xl3.1-XL100f05.5                                                                                      AATGACAGTAAACAATTTACATCCCCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCTTTAAAGCGAGCCAGACTGCTTAGTCCTGGTGAGGCAGAAGTTGTTTTTGTGAGGAAGGACGATGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAATGCAATCTTCATGTGAATGGCAGTGTCATAACATCAGACCAACCTATTCTACTACGACTCAGCGACACACCATCTGCAACGAAAAAAGCAGAGATTCGAAGATCAAACACATTGTCTTCATCGAGTGCACCCAACCCACCTGCTGAAGTTGACCCCGACACCATTTTAAAAGCCTTGTTTAAATCTTCGGGCTCTTCAGCAGTTGTTCAGCCAACCGCATTTAAGATCAAACTCTGATGAGGCCAGCATGAGAACTAAAGAGGGAATGCTGGAGGGAATCAAAGATGGCTCTCGGTGTGACCAATTTTAAGATTTACCCAGAGAGAGACGAGACTTGTTTCAGAGAGATTTTGTTCGAACTGCTCATCGGTGGATTAGGGATTTTCAGACTGCTGCTCTGTTACCCTATCCTTTGTAGCGGCAGAATTACAGTTTCACTTTCCTTTTTGTTGAGCTGTTCCTGCAGTCCACATGCTGGTTTCTCTCCCAGGATGAAGTTCCTGTACAGTTTCTTGCCATTCTGTTTATTCTTATTAGGGATGCACCTAATCTACTAATTTGGATTCGGCCGAACCCCCAAATCCTTCGTGAAAGATTTGGCCGAATACCGAATCCTAATTTGCATATGCAAATTAGGAATGGGAAAACATTTTTTACTTCCTTGTTTTCTGACAAAAAGTCACGCGATTTCCCTCCCCATCCATAATTTGCATATGCCGATTCGGGTTTGGCTGGGCAGAAGGATTCGGCCGAATCCTGCTGAAAAAGACCGAATCCCGAACCGAATCCTGTATTCGGTGCATCCCTAATTCTTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGTTACTTTTTGGCTCTGGAATTAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCA
  5   1   2       e50                                 Xl3.1-XL100f05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATTCTTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGTTACTTTTTGGCTCTGGAATAAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTGTTTTTGTTTTTTTTGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTATTTCATACTAAGGCAGTACGTGATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGNAGTCGCTACTTGGGAGACGATCTGTGGAGTTAAAAGGCAAAGACAATAAAATAAGTCAGTGAATGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGTTTGAGAG
  5   1   2       e50                                 Xl3.1-XL100f05.5                                                                                      AATGACAGTAAACAATTTACATCCCCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCTTTAAAGCGAGCCAGACTGCTTAGTCCTGGTGAGGCAGAAGTTGTTTTTGTGAGGAAGGACGATGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAATGCAATCTTCATGTGAATGGCAGTGTCATAACATCAGACCAACCTATTCTACTACGACTCAGCGACACACCATCTGCAACGAAAAAAGCAGAGATTCGAAGATCAAACACATTGTCTTCATCGAGTGCACCCAACCCACCTGCTGAAGTTGACCCCGACACCATTTTAAAAGCCTTGTTTAAATCTTCGGGCTCTTCAGCAGTTGTTCAGCCAACCGCATTTAAGATCAAACTCTGATGAGGCCAGCATGAGAACTAAAGAGGGAATGCTGGAGGGAATCAAAGATGGCTCTCGGTGTGACCAATTTTAAGATTTACCCAGAGAGAGACGAGACTTGTTTCAGAGAGATTTTGTTCGAACTGCTCATCGGTGGATTAGGGATTTTCAGACTGCTGCTCTGTTACCCTATCCTTTGTAGCGGCAGAATTACAGTTTCACTTTCCTTTTTGTTGAGCTGTTCCTGCAGTCCACATGCTGGTTTCTCTCCCAGGATGAAGTTCCTGTACAGTTTCTTGCCATTCTGTTTATTCTTATTAGGGATGCACCTAATCTACTAATTTGGATTCGGCCGAACCCCCAAATCCTTCGTGAAAGATTTGGCCGAATACCGAATCCTAATTTGCATATGCAAATTAGGAATGGGAAAACATTTTTTACTTCCTTGTTTTCTGACAAAAAGTCACGCGATTTCCCTCCCCATCCATAATTTGCATATGCCGATTCGGGTTTGGCTGGGCAGAAGGATTCGGCCGAATCCTGCTGAAAAAGACCGAATCCCGAACCGAATCCTGTATTCGGTGCATCCCTAATTCTTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGTTACTTTTTGGCTCTGGAATTAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCA
                                                  Xl3.1-CHK-1012697954                                                                                            AGTAAACAATTTACATCCCCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCTTTAAAGCGAGCCAGACTGCTTAGTCCTGGTGAGGCAGAAGTTGTTTTTGTGAGGAAGGACGATGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAATGCAATCTTCATGTGAATGGCAGTGTCATAACATCAGACCAACCTATTCTACTACGACTCAGCGACACACCATCTGCAACGAAAAAAGCAGAGATTCGAAGATCAAACACATTGTCTTCATCGAGTGCACCCAACCCACCTGCTGAAGTTGACCCCGACACCATTTTAAAAGCCTTGTTTAAATCTTCGGGCTCTTCAGCAGTTGTTCAGCCAACCGCATTTAAGATCAAACTCTGATGAGGCCAGCATGAxxxxxAAAGAGGxxxxxxTGGAGGGAATCAAAGATGGCTCTCGGTGTGACCAATTTTAAGATTTACxCxxAGAGAGACGAxxxTTGTTTCAGAGAGATTTTGTTCGAACTGCTCATCGGTGGATTAGGGATTTTCAGACTGCTGCTCTGTTACCCTATCCTTTGTAGCGGCAGAATTACAGTTTCACTTTCCTTTTTGTTGAGCTGTTCCTGCAGTCCACATGCTGGTTTCTCTCCCAGGATGAAGTTCCTGTACAGTTTCTTGCCATTCTGTTTATTCTTATTAGGGATGCACCTAATCTACTAATTTGGATTCGGCCGAACCCCCAAATCCTTCGTGAAAGATTTGGCCGAATACCGAATCCTAATTTGCATATGCAAATTAGGAATGGGAAAACATTTTTTACTTCCTTGTTTTCTGACAAAAAGTCACGCGATTTCCCTCCCCATCCATAATTTGCATATGCCGATTCGGGTTTGGCTGGGCAGAAGGATTCGGCCGAATCCTGCTGAAAAAGACCGAATCCCGAACCGAATCCTGTATTCGGTGCATCCCTAATTCTTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGTTACTTTTTGGCTCTGGAATTAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAATAT
  5   1   2       bld Tbd7      in                         XL077j04.5p TCTCGTACACTTGTAACCAAGGAGGATACCGCTCACTGCAGTTGGCATCTACAGAGCCGGTCCTCAGCCCACTAGAAGGTACTAAAATGACAGTAAACAATTTACATCCCCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCTTTAAAGCGAGCCAGACTGCTTAGTCCTGGTGAGGCAGAAGTTGTTTTTGTGAGGAAGGACGATGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAATGCAATCTTCATGTGAATGGCAGTGTCATAACATCAGACCAACCTATTCTACTACGACTCAGCGACACACCATCTGCAACGAAAAAAGCAGAGATTCGAAGATCAAACACATTGTCTTCATCGAGTGCACCAACCCACCTGCTGAAGTTGACCCCGACACCATTTTAAAAGCCTTGTTTAAATCTTCGGGCTCTTCAGCAGTTGTTCAGCCAACCGCATTTAAGATCAAACTCTGATGAGGCCAGCATGAACTACAGAGGAGGAATGCTGGAGGGAATCAAAGATGGCTCTCGGTGT
  5   1   2      seed Tbd7      in                         XL100f05.5p                          GGNCTGCAGGNAATTCGGCACGAGGCAGAGCCGGTCCTCAGCCCACTAGNAAGGTACTAAAATGACAGTAAACAATTTACATCCCCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCTTTAAAGCGAGCCAGACTGCTTAGTCCTGGTGAGGCAGAAGTTGTTTTTGTGAGGAAGGACGATGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAATGCAATCTTCATGTGAATGGCAGTGTCATAACATCAGACCAACCTATTCTACTACGACTCAGCGACACACCATCTGCAACGAAAAAAGCAGAGATTCGAAGATCAAACACATTGTCTTCATCGAGTGCACCCAACCCACCTGCTGAAGTTGACCCCGACACCATTTTAAAAGCCTTGTTTAAATCTTCGGGCTCTTCAGCAGTTGTTCAGCCAACCGCATTTAAGATCAAACTCTGATGAGGCCAGCATGAACTACAGAGGAGGAATGCTGGAGGGAATCAAAGATGGCTCTCGGTGTGACCAATTTTAAGATTTACCCAGAGAGACGAGACTTTTGTTTCAGAGAGATTTTGTTCGAACTGCTCATCGGTGGATTAGGGATTTTCAGACTGCTGCTCTGTTACCCTATCCTTTGTAGCGGCAGAATTACAGTTTCACTTTCCTTTTTGTTGAGCTGTTCCTGCAGTCCA
  5   1   2       bld Ga18      in                      xlk124f08ex.5p                                                                                                                                                                      GAGCCAGACTGCTTAGTCCTGGTGAGGCAGAAGTTGTTTTTGTGAGGAAGGACGATGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAATGCAATCTTCATGTGAATGGCAGTGTCATAACATCAGACCAACCTATTCTACTACGACTCAGTGACACACCATCTGCAATGAAAAAAGCAGAGATTCGAAGATCAAACACATTGTCTTCATCGAGTGCACCCAACCCACCTGCTGAAGTTGACCCCGACACCATTTTAAAAGCCTTGTTTAAATCTTCGGGCTCTTCAGCAGTTGTTCAGCCAACCGCATTTAAGATCAAACTCTGATGAGGCCAGCATGAACTAAAGAGGGGGAATGCTGGAGGGAATCAAAGATGGCTCTCGGTGTGACCAATTTTAAGATTTACCCAGAGAGACAAGACTTTTGTTTCAGAGAGATTTTGTTCGAACTGCTCATCAGTGGATTAGGGATTTTCAGACTGCTGCTCTGTTACCCTATCCTTTGTAGCGGCAGAATTACAGTTTCACTTTCCTTTTTGTTGAGCTGTTCCTGCAGTCCACATGCTGGNTTCTCTCCCAGGATGAAGTTCCTGTACAGTTTCTTGCCATGCTGTTTATTCTTATTAGGG
  5   1   2       bld Ga15      in                       XL505a14ex.5p                                                                                                                                                                                                                                  TTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAATGCAATCTTCATGTGAATGGCAGTGTCATAACATCAGACCAACCTATTCTACTACGACTCAGTGACACACCATCTGCAATGAAAAAAGCAGAGATTCGAAGATCAAACACATTGTCTTCATCGAGTGCACCCAACCCACCTGCTGAAGTTGACCCCGACACCATTTTAAAAGCCTTGTTTAAATCTTCGGGCTCTTCAGCAGTTGTTCAGCCAACCGCATTTAAGATCAAACTCTGATGAGGCCAGCATGAACTAAAGAGGGGGAATGCTGGAGGGAATCAAAGATGGCTCTCGGTGTGACCAATTTTAAGATTTACCCAGAGAGACAAGACTTTTGTTTCAGAGAGATTTTGTTCGAACTGCTCATCAGTGGATTAGGGATTTTCAGACTGCTGCTCTGTTACCCTATCCTTTGTAGCGGCAGAATTACAGTTTCACTTTCCTTTTTGTTGAGCTGTTCCTGCAGTCCACATGCTGGTTTCTCTCCCAGGATGAAGTTCCTGTACAGTTTCTTGCCATGCTGTTTATTCTTATtagggatgcacctaatctactaatttggattcggccgaacccccaaatccttcgtgaaagatttggcctaataccgaatcctgatttgcatatgcaaattagggatgggaatgggaaaacattttttacttccttgttttctgacaaaaagtcacgcgatgtccctccccatccctggntttgcatgtgcCGAT
  5   1   2       bld Thy                             IMAGE:8546765.5p                                                                                                                                                                                                                                                              GNGACCATATATCTATTCGTCCATGAATGCAATCTTCATGTGAATGGCAGTGTCATAACATCAGACCAACCTATTCTACTACGACTCAGCGACACACCATCTGCAACGAAAAAAGCAGAGATTCGAAGATCAAACACATTGTCTTCATCAAGTGCACCCAACCCACCTGCTGAAGTTGACCCCGACACCATTTTAAAAGCCTTGTTTAAATCTTCGGGCTCTTCAGCAGTTGTTCAGCCAACCGCATTTAAGATCAAACTCTGATGAGGCCAGCATGAACTAAAGAGGAGGAATGCTGGAGGGAATCAAAGATGGCTCTCGGTGTGACCAATTTTAAGATTTACCCAGAGAGACGAGACTTTTGTTTGAGAGATTTTGTTCGAACTGCTCATCGGTGGATTAGGGATTTTCAGACTGCTGCTCTGTTACCCTATCCTTTGTAGCGGCAGAATTACAGTTTCACTTTCCTTTTTGTTGAGCTGTTCCTGCAGTCCACATGCTGGTTTCTCTCCCAGGATGAAGTTCCTGTACAGTTTCTTGCCATTCTGTTTATTCTTATTAGGGATGCACCTAATCTACTAATTTGGATTCGGCCGAACCCCCAATCCTTCGTGAAAGATTTGGCGAATACGAATCCTATTTGCTATGCAATTANGATGGGAAACATTTTACTTCTTGTTTCGACAAAGTCCGCGATTCCTCCCATCATATTTGCTTGCGATCGGTGGCTGCAGAGATCGCGATCTGTGAANACGATCCGACGTCTGATCGGCACTATCTATCATACTGTTACTACTTGGTTATCTACTTGCTGAATACGAGAGATGAGCAAA
  5   1   2       bld Tbd7                                 XL099j08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTTAGCAGTTGTTCAGCCAACCGCATTTAAGATCAAACTCTGATGAGGCCAGCATGAACTAAAGAGGAGGAATGCTGGAGGGAATCAAAGATGGCTCTCGGTGTGACCAATTTTAAGATTTACCCAGAGAGACGAGACTTTTGTTTGAGAGATTTTGTTCGAACTGCTCATCGGTGGATTAGGGATTTTCAGACTGCTGCTCTGTTACCCTATCCTTTGTAGCGGCAGAATTACAGTTTCACTTTCCTTTTTGTTGAGCTGTTCCTGCAGTCCACATGCTGGTTTCTCTCCCAGGATGAAGTTCCTGTACAGTTTCTTGCCATTCTGTTTATTCTTATtagggatgcacctaatctactaatttggattcggccgaacccccaaatccttcgtgaaagatttggccgaataccgaatcctaatttgcatatgcaaattaggaatgggaaaacattttttacttccttgttttctgacaaaaagtcacgcgatttccctccccatccataatttgcatatgccgattcgggtttggctgggcagaaggattcggccgaatcctgctgaaaaagaccgaatcccgaaccgaatcctgtattcggtgcatccctaATTCTTATTTTCAA
  5   1   2      skin Thy       in                    IMAGE:8546466.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGAACTAAAGAGGAGGAATGCTGGAGGGAATCAAAGATGGCTCTCGGTGTGACCAATTTTAAGATTTACCCAGAGAGACGAGACTTTTGTTTGAGAGATTTTGTTCGAACTGCTCATCGGTGGATTAGGGATTTTCAGACTGCTGCTCTGTTACCCTATCCTTTGTAGCGGCAGAATTACAGTTTCACTTTCCTTTTTGTTGAGCTGTTCCTGCAGTCCACATGCTGGTTTCTCTCCCAGGATGAAGTTCCTGTACAGTTTCTTGCCATTCTGTTTATTCTTATtagggatgcacctaatctactaatttggattcggccgaacccccaaatccttcgtgaaagatttggccgaataccgaatcctaatttgcatatgcaaattaggaatgggaaaacattttttacttccttgttttctgacaaaaagtcacgcgatttccctccccatccataatttgcatatgccgattcgggtttggctgggcagaaggattcggccgaatcctgctgaaaaagaccgaatcccgaaccgaatcctgtattcggtgcatccctaATTCTTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGTTACTTTTTGGCTCTGGAATTAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAATATGTCCTTTAATTGGACATCCGTATTCTTTAGATATATTAGTATATTTGTCAAAGTATGATCTCTGGACACTATCCAGCTGAAAATTTTGACGATTCCAACGTGATTAATTAGCCATATTTGTTCATATAATATCAAGCCACAGATTAACCTTTTCCA
  5   1   1       add Ga18      in                      xlk131a12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   tncacctaatctactaatttggattcggccgaacccccaaatccttcgtgaaagatttggccgaataccgaatcctaatttgcatatgcaaattaggaatgggaaaacattttttacttccttgttttctgacaaaaagtcacgcgatttccctccccatccataatttgcatatgccgattcgggtttggctggnnagaaggattcggccgaatcctgctgaaaaagancgaatcccgaaccgaatcctgtattcggtgcatccctaATTCTTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGNTACTTTTTGGCTCTGGAATAAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTNATTTATTGCTTANGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAANATGTCCTTAAATTGGNCATCCGNATTCNTTAGATATATNAGGNNAA
  5   1   2       e50                                 Xl3.1-XL100f05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATTCTTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGTTACTTTTTGGCTCTGGAATAAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTGTTTTTGTTTTTTTTGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTATTTCATACTAAGGCAGTACGTGATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGNAGTCGCTACTTGGGAGACGATCTGTGGAGTTAAAAGGCAAAGACAATAAAATAAGTCAGTGAATGTT
                                                  Xl3.1-CHK-1012691308                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGTTACTTTTTGGCTCTGGAATAAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTGTTTTTGTTTTTTTTGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTATTTCATACTAAGGCAGTACGTGATTTTCATGGCAATAAAAGGCTTTGATTAAxAxxAxAAGTCGCTACTTGGGAGACGATCTGTGGAGTTAAAAGGCAAAGACAATAAAATAAGTCAGTGAATGTTCAATAT
  5   1   2       bld Ov1                             IMAGE:6316375.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGAATaccgaatcctaatttgcatatgcagattagggatgggaatgggaaaacattttttacttccttgttttctgacaaaaagtcacgcgatgtccctccccatccctagtttgcatatgccgattcgggtttggctgggcagaaggattcggccgaatcctgctgaaaaagaccgaatcccgaaccgaatcctgtattcggtgcatccctaATTCTTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGTTACTTTTTGGCTCTGGAATAAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGGCTTAGAAACCGGGTTAAGAATGCATGCAACCCCAAGTGCCAAGCTGTTTCTTTGTTAAAAAAAGCAATTTTCCCATTAATGGTAAAAT
  3   1   2       bld Ga18      out                      xlk74h17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANGGGAAANNNTTTTTNCTTNCNTNTTTTCTGACAAANANTCNNNCGATGTCCCTCCCCANCCNNANTTTNNATATGCCGATTNGGGTTTGNCNGGGNAGAAGGNTTCGGNCGAATCCNGCTGAAAAAANNCCGAATCCCGANNCGAATCCTGTNTTCGGNGCATCCCTAATTCTTATTTTCAATATCATTGTTTATACATAACTTTTTGTGTTTTATTTCGTTNCTTTTTGGCTCTGGAATAAATAACTGNCTGACATGAAATGTGCAGNCCCCAAAAAACTAGAAGGGAGCTTCNCCTTNACACATGCAGTTTTAATTTATTGCTTAAAATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGNCTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATANCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGNNNNNNAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTTTTTTTTTTTTTTTTGGGTGCAAATTTACTCTGNCCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTNTTTCATACTAAGGCAGTANAT
  3   1   2       bld Ga18      in                      xlk124f08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ANNNNTTTNNNNNNNTTTNCTGANNAAAANTCACGCGATNNCCCTCCCCNNCCCNNATTTNCANATGCCGATTNGGNTTTGGCNGGGNAGAAGGATTNGGCCNNNNCCTGCTGAAAAAGACCGANTNCCNGAACCGAATCNNGTATTCGGTGCATNCCTNATTCTTATTTTCAATATCATNGTTTATACATANCTTTTTGTGTTTTATTTCGTTNCTTTTTGGCTCTGGAATAAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCNNCTTAACACATGCAGTTTTAATTTATTGCTTAAAATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCNGNCAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTGTTTTTGTTTTTTTTGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTNNNCATACTAAGNCAGTACAT
  3   1   2       bld Thy       in                    IMAGE:8546466.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATCTGTTTTGAAAAGCACGGTTTCTCCCATCATATTGCTAGCGATCGTTGGCGGGAGAAGATCGCCGATCTGCGAAAAGACGATCCCGAACGAATCTGTATCGTGCATCCCTAATCTTATTTCAATATCATGTTTATACATAACTTTTGTGTTTATTTCGTTACTTTTGGCTCTGGAATTAATAACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATAACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTTGTTTTTGTTTTTAAGGGTGAAAAAATCCTCTGACCTCCATCACAATTACACGCACGGCTCTTGAGAAATAGGCTACGTGTGAGCCATTAAGTCTACAATCGGATCCAATTTCTCAATATCCTGCAAATAAATGGACGAGGCGATATCA
  5   1   2       bld Egg1                               PBX0113A07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ttttttttATTTCGTTACTTTTTGGCTCTGGAATAAATAACTGACTGATATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCC
  3   1   2       bld Ga15      in                       XL505a14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AANAAATAACTGGNTAACANGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCNCCTTAACACATGCAGTTNNAANTTATNGCNTTAAGATGGCNCTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGNCATCCGTANTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACNCGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTANGTAAAATCTGCAATCAAATTTGTTTTTGTTTTTTTTTGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTTGAGAAATTGGACTCTGTCCTGTGAGCTTTAA
  3   1   2       bld Tbd7      in                         XL100f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTGACTGACATGAAATGTGCAGCCCCCAAAAAACTAGAAGGGAGCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTGTTTTTGTTTTTTTTGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTNAATGGTTAACTGTTGNATTTCATACNAAGGCAGTACG
  3   1   2      seed Ov1       out                   IMAGE:5048801.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTTCACCTTAACACATGCAGTTTTAATTTATTGCTTAAGATGGCACTGTTCATTTTCTCACATCCAGATGAGTAGCAAAAATATGTCCTTAAATTGGACATCCGTATTCTTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTGTTTTTGTTTTTTTTGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTATTTCATACTAAGGCAGTACGTGATTTTCATGGCAATAAAAGGCTTTGATTAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd7      in                         XL077j04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTTCATTTTNTCACATNCANATNAGTAGCAAAAATATGTCCTTAAATTGNACATCNGTATTCTTTANATATATTAGGTTAATATTTGTTCAAAGTATGATCTNTGGAACACTATCCAGCTGAAAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTNTTTTTGTTTTTTTAG
  3   1   2       bld Emb4 5g3  out                   IMAGE:4201827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTAGATATATTAGGTTAATATTTGTTCAAAGTATGATCTCTGGAACACTATCCAGCTGANAATTTTGAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATAACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTTGTTTTTGTTTTTTTGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTATTTCATACTAAGGCAGTACGTGATATTTTCATGGCAATAAAAGGCTTTGATTAATATTA
  5   1   2       bld Ga15      in                       XL486p12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAAtttgtttttgttttttttGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTATTTCATACTAAGGCAGTACGTGATTTTCATGGCAATAAAAGGCTTTGATTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL486p12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACCGATTCACACGTGATTATAATAGCAATATTTGGTCATTATAATATCAGCACAGATGACTTCCCAATCAATAACCTAACAGGCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTGTTTTTGTTTTTTTTGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTATTTCATACCTAAGGCAGTAC
  5   1   2       bld Ga18      in                      xlk101g16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGNCAGTGCAGTTGNTTAGAAACGGGTTAAGATGCATGCAGCACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAAtttgtttttgttttttttGGGTGCAAATTTACTCTGACCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTATTTCATACTAAGGCAGTACGTGATTTTCATGGCAATAAAAGGCTTTGATTAATaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk101g16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTATTTTTCTGCTAAACCATAGATCTGTTTTAGATAAATCTGCCTGGTGGTATTTTTTTCCACTTCCTTGTTATCCAGGATTGGATTATAATAGCATAGCCAGTGCAGTTGCTTAGAAACGGGTTAAGATGCATGNAGACAAGTGCAGCTGTTCTTGTAAAAAAGCATTTCCATTATGTAAAATCTGCAATCAAATTTGTTTTTGTTTTTTTTGGGTGCAAATTTACTCTGNCCTCTTACACATTTATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTNTTTNATACTAAGGCAGTANGTGNT
  3   1   2       add Ga18 5g3  out                     xlk142l21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TNTNNCCTCTTACACATTAATTTGCAAGGATATTGAGAAANNGGCTCTGTCTGTGACTTTAATGGTTAACTGTTGTATTTCATACTAAGGCAGTACATGATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGNAGTCGCTACTTGGGAGATGATCTGTGGAGTTAAAAGGCAAAGACAATAAAATAAGTCAGTGAATGTTCAATATNCCANTT
  3   1   2       bld Ga18      in                      xlk131a12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGNCCTNTTACACATTNATTTGCAAGGATATTGAGAAATTGGCTCTGTCTGTGACTTTAATGGTTNACTGTTGTATTTCATACTAAGGCAGTACGTGATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGNAGTCGCTACTTGGGAGACGATCTGTGGAGTTAAAAGGCAAAGACAATAAAATAAGTCAGTGAATGTTCAATATTCCGNTTNNNNNACNNAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)