Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-xlk122e17ex.3                         9 END     2          11       22                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7983406.5                       4 PI      99       2105     2215                (no blast hit)
     3   0.0    0Xl3.1-xl263e06.3                            2 PI      100      1236     1391                MGC83530 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012838575 Xl3.1-IMAGE:8535493.5.5 - 17 ESTs
                                                                       ......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8535493.5.5       GAAACTTCTAGTTCACTGGTGCTCGGGAACACAGGCTCACGTCTGCTTAGTACAGCGCACCCAGCTGAGAGTGGCAGAGATTGAAAGATGGAGCCAAATGCGATCTCAATAATTCTGGTTAGTCTTTGCTGTATATGGCAAGTCCAGGCAGAGGTCTTCACATCAACAGGTCAGATGACCGATCTGATTTATAGGGAGAGAGATCTTGTGCAATCTTTGAAAGAATACATCCAGAAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGTATCTCAAGTAGATGAACTGACTAGCAGGTCAACTGCTGATCCAGAAGGATACCTTGGGCACCCGGTAAATGCGTATAAGCTTGTGAAGAGGTTTAACACGGACTGGACATCACTAGAGAACCTTGTGCTTCAGGACTCAACAAAAGGATTTATTGCCAACCTCACATTTCAGAGAGAATATTTTCCAACTGAAGAAGATGAAAAGGGGGCTGCCAAGGCTCTAATGCGCCTTCAGGACACATATAGACTTGACCCTGACATTATAGCTAAAGGAAAATTACCAGGAACAAATTATATTTCATCTTTATCTGCGGTTGACACGTTTGGTATGGGGAAAATTGCCTACCATGATGGTGATTATTACCACACCGTTCTTTGGATGCAGCAGGCCCTGAAGCAGTTGGATGAAGGGGAGGAAGCTAAAATTAGTAAAGTGGATGTTCTGGATTATCTCAGTTACACTGTCTTTCAGCTTGGTGATGTCCCCAGGGCAGTTGAGCTTACTAAAAGACTCTTGGTTTTAGACGCAAACCATGAACGAGCT------------AATATTTTGAGAAAATGCAGGAGCAACAGAAAGCAGAACTAAAGCAGAATGAAACTATTGAGACAGAGACAAGGCAACCAGGAGTCTATAACAGGCCACTGGACTATTTGCCAGAGCGGGATGTCTATGAAGCCCTGTGTCGAGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAAGAGACTTTTCTGTAGGTATCATGATGGCAATAGGAATCCTCGCCTTATCTTGGGTCCGATTAAAATGGAAGACGAGTGGGATAGNCCACGTATTGTCCGTTATCTTGATGTCTTATCTGATGAAGAAATAGAGAAAATAAAAGAACTNGCAAAACCAA------------CAACAGTGCGGGATCCTAAANCTG------------TGNCCAACTACAGAGTATCTAAAAGTGCATGGCTAGAAGAATATGATGATCCAGTCATAGGACGTGTGAATTCACGCATGCAGGCAATAACAGGGCTAACAAAAGACACAGCAGAATTACTTCAGGTTGCCAATTATGGTATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGAAGGAAATAGACTTGCAACATATCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCAACAGTATTTCCTGACTTTGGGGCAGCAATTTGGCCCAGAAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGTGAAGGAGATTATAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAGGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTAATGTCTAAATTTAGAAAAACAAATCCTTTTTTTATTATACTGGTGCTAGTTGGTTACCGAGGACTTAAATTATCTTTACAGATGTAGGATCAGTTGGTGCTACTAATCTACTGAACCATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAAATTGGTTTCAAACTGTAACTTTATTTTCAAAAAA
                                                  Xl3.1-CHK-1012722491             TCTAGTTCACTGGTGCTCGGGAACACAGGCTCACGTCTGCTTAGTACAGCGCACCCAGCTGAGAGTGGCAGAGATTGAAAGATGGAGCCAAATGCGATCTCAATAATTCTGGTTAGTCTTTGCTGTATATGGCAAGTCCAGGCAGAGGTCTTCACATCAACAGGTCAGATGACCGATCTGATTTATAGGGAGAGAGATCTTGTGCAATCTTTGAAAGAATACATCCAGAAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGTATCTCAAGTAGATGAACTGACTAGCAGGTCAACTGCTGATCCAGAAGGATACCTTGGGCACCCGGTAAATGCGTATAAGCTTGTGAAGAGGTTTAACACGGACTGGACATCACTAGAGAACCTTGTGCTTCAGGACTCAACAAAAGGATTTATTGCCAACCTCACATTTCAGAGAGAATATTTTCCAACTGAAGAAGATGAAAAGGGGGCTGCCAAGGCTCTAATGCGCCTTCAGGACACATATAGACTTGACCCTGACATTATAGCTAAAGGAAAATTACCAGGAACAAATTATATTTCATCTTTATCTGCGGTTGACACGTTTGGTATGGGGAAAATTGCCTACCATGATGGTGATTATTACCACACCGTTCTTTGGATGCAGCAGGCCCTGAAGCAGTTGGATGAAGGGGAGGAAGCTAAAATTAGTAAAGTGGATGTTCTGGATTATCTCAGTTACACTGTCTTTCAGCTTGGTGATGTCCCCAGGGCAGTTGAGCTTACTAAAAGACTCTTGGTTTTAGACGCAAACCATGAAxxxxxxGAAGCAATCTGAAATATTTTGAGAAAATGCAGGAGCAACAGAAAGCAGAACTAAAGCAGAATGAAACTATTGAGACAGAGACAAGGCAACCAGGAGTCTATAACAGGCCACTGGACTATTTGCCAGAGCGGGATGTCTATGAAGCCCTGTGTCGAGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAAGAGACTTTTCTGTAGGTATCATGATGGCAATAGGAATCCTCGCCTTATCTTGGGTCCGATTAAAATGGAAGACGAGTGGGATAGTCCACGTATTGTCCGTTATCTTGATGTCTTATCTGATGAAGAAATAGAGAAAATAAAAGAACTGGCAAAACCAAGGTTAGCAAGAGCxACAGTGCGGGATCCTAAAACTGGTGTTCTAACAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTAGAAGAATATGATGATCCAGTCATAGGACGTGTGAATTCACGCATGCAGGCAATAACAGGGCTAACAAAAGACACAGCAGAATTACTTCAGGTTGCCAATTATGGTATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGAAGGAAATAGACTTGCAACATATCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCAACAGTATTTCCTGACTTTGGGGCAGCAATTTGGCCCAGAAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGTGAAGGAGATTATAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAGGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTAATGTCTAAATTTAGAAAAACAAATCCTTTTTTTATTATACTGGTGCTAGTTGGTTACCGAGGACTTAAATTATCTTTACAGATGTAGGATCAGTTGGTGCTACTAATCTACTGAACCATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAAATTGGTTTCAAACTGTAACTTTATTTTC
                                                      consensus depths            2     2     2     2     3     3     3     5     3     5     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     6     6     6     6     6     6     5     6     5     5     4     5     5     5     5     5     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     1     1     0     1     2     2     2     2     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     1     2     2     3     2     3     3     3     3     3     3     3     1     2     0     2     1     2     2     2     0     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     2     3     2     3     2     3     2     3     3     4     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     7     7     7     7     6     7     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     8     8     8     8     8     7     7     7     7     7     7     4     6     4     5     3     4
  5   1   2      ests                      Xl3.1-IMAGE:5078489-IMAGp.5       GAAACTTCTAGTTCACTGGTGCTCGGGAACACAGGCTCACGTCTGCTTAGTACAGCGCACCCAGCTGAGAGTGGCAGAGATTGAAAGATGGAGCCAAATGCGATCTCAATAATTCTGGTTAGTCTTTGCTGTATATGGCAAGTCCAGGCAGAGGTCTTCACATCAACAGGTCAGATGACCGATCTGATTTATAGGGAGAGAGATCTTGTGCAATCTTTGAAAGAATACATCCAGAAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGTATCTCAAGTAGATGAACTGACTAGCAGGTCAACTGCTGATCCAGAAGGATACCTTGGGCACCCGGTAAATGCGTATAAGCTTGTGAAGAGGTTTAACACGGACTGGACATCACTAGAGAACCTTGTGCTTCAGGACTCAACAAAAGGATTTATTGCCAACCTCACATTTCAGAGAGAATATTTTCCAACTGAAGAAGATGAAAAGGGGGCTGCCAAGGCTCTAATGCGCCTTCAGGACACATATAGACTTGACCCTGACATTATAGCTAAAGGAAAATTACCAGGAACAAATTATATTTCATCTTTATCTGCGGTTGACACGTTTGGTATGGGGAAAATTGCCTACCATGATGGTGATTATTACCACACCGTTCTTTGGATGCAGCAGGCCCTGAAGCAGTTGGATGAAGGGGAGGAAGCTAAA
  5   1   2      ests                            Xl3.1-IMAGE:8535493.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTACAGAGTATCTAAAAGTGCATGGCTAGAAGAATATGATGATCCAGTCATAGGACGTGTGAATTCACGCATGCAGGCAATAACAGGGCTAACAAAAGACACAGCAGAATTACTTCAGGTTGCCAATTATGGTATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGAAGGAAATAGACTTGCAACATATCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCAACAGTATTTCCTGACTTTGGGGCAGCAATTTGGCCCAGAAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGTGAAGGAGATTATAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAGGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTAATGTCTAAATTTAGAAAAACAAATCCTTTTTTTATTATACTGGTGCTAGTTGGTTACCGAGGACTTAAATTATCTTTACAGATGTAGGATCAGTTGGTGCTACTAATCTACTGAACCATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAAATTGGTTTCAAACTGTAACTTTATTTTCA
                                               BLH ATG      87      47       
                                               BLH MIN     830     213       
                                               BLH MPR      50     213       
                                               BLH OVR      87      49       
                                               EST CLI      -6       9       
                                               ORF LNG      87      47       
  5   1   2      ests                      Xl3.1-IMAGE:5078489-IMAGp.5       GAAACTTCTAGTTCACTGGTGCTCGGGAACACAGGCTCACGTCTGCTTAGTACAGCGCACCCAGCTGAGAGTGGCAGAGATTGAAAGATGGAGCCAAATGCGATCTCAATAATTCTGGTTAGTCTTTGCTGTATATGGCAAGTCCAGGCAGAGGTCTTCACATCAACAGGTCAGATGACCGATCTGATTTATAGGGAGAGAGATCTTGTGCAATCTTTGAAAGAATACATCCAGAAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGTATCTCAAGTAGATGAACTGACTAGCAGGTCAACTGCTGATCCAGAAGGATACCTTGGGCACCCGGTAAATGCGTATAAGCTTGTGAAGAGGTTTAACACGGACTGGACATCACTAGAGAACCTTGTGCTTCAGGACTCAACAAAAGGATTTATTGCCAACCTCACATTTCAGAGAGAATATTTTCCAACTGAAGAAGATGAAAAGGGGGCTGCCAAGGCTCTAATGCGCCTTCAGGACACATATAGACTTGACCCTGACATTATAGCTAAAGGAAAATTACCAGGAACAAATTATATTTCATCTTTATCTGCGGTTGACACGTTTGGTATGGGGAAAATTGCCTACCATGATGGTGATTATTACCACACCGTTCTTTGGATGCAGCAGGCCCTGAAGCAGTTGGATGAAGGGGAGGAAGCTAAA
                                                  Xl3.1-CHK-1012701219             TCTAGTTCACTGGTGCTCGGGAACACAGGCTCACGTCTGCTTAGTACAGCGCACCCAGCTGAGAGTGGCAGAGATTGAAAGATGGAGCCAAATGCGATCTCAATAATTCTGGTTAGTCTTTGCTGTATATGGCAAGTCCAGGCAGAGGTCTTCACATCAACAGGTCAGATGACCGATCTGATTTATAGGGAGAGAGATCTTGTGCAATCTTTGAAAGAATACATCCAGAAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGTATCTCAAGTAGATGAACTGACTAGCAGGTCAACTGCTGATCCAGAAGGATACCTTGGGCACCCGGTAAATGCGTATAAGCTTGTGAAGAGGTTTAACACGGACTGGACATCACTAGAGAACCTTGTGCTTCAGGACTCAACAAAAGGATTTATTGCCAACCTCACATTTCAGAGAGAATATTTTCCAACTGAAGAAGATGAAAAGGGGGCTGCCAAGGCTCTAATGCGCCTTCAGGACACATATAGACTTGACCCTGACATTATAGCTAAAGGAAAATTACCAGGAACAAATTATATTTCATCTTTATCTGCGGTTGACACGTTTGGTATGGGGAAAATTGCCTACCATGATGGTGATTATTACCACACCGTTCTTTGGATGCAGCAGGCCCTGAAGCAGTTGGATGAAGGGGAGGAA
  5   1   2       bld Gas9 5g                              BG409877.5p CTATGGGAAACTTCTAGTTCACTGGTGCTCGGGAACACAGGCTCACGTCTGCTTAGTACAGCGCACCCAGCTGAGAGTGGCAGAGATTGACAGATGGACCCAAATGCGATCTCAATAATTCTGGTTAGTCTTTGCTGTATATGGCAAGTCCAGGCAGAGGTCTTCACATCAACAGGTCAGATGACCGATCTGATTTATAGGGAGAGAGATCTTGTTCAATCTTTGAAAGAATACATCCAGAAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGTATCTCAAGTAGATGAACTGACTAGCAGGTCAACTGCTGATCCAGAAGGATACCTTGGGCACCCGGTAAATGCGTATAAGCTTGTGAAGAGGTTTAACACGGACTGGACATCACTAGAGAACCTTGTGCTTCAGGACTCAACAAAAGGATTTATTGCCAACCTCACATTTCAGAGAGAATATTTTCCAACTGAAGAAGATGAAAAGGGGGCTGCCAAGGCTCTAATGCGCCTTCAGGACACATATAGACTTGACCCTGACGTTNTAGCTAAAGGGAAAATTACCAGGAACAAATTATTTTCATCTTTATCTGCGGTTGACCCTTTGGTTGGGGAAAATTGCCTCCATGATGGNGATTATTACCCCACCCGTCTTTGGATGCAGCAGGCCC
  5   1   2      seed Oo1  5g                IMAGE:5078489-IMAGp.IMAGp       GAAACTTCTAGTTCACTGGTGCTCGGGAACACAGGCTCACGTCTGCTTAGTACAGCGCACCCAGCTGAGAGTGGCAGAGATTGAAAGATGGAGCCAAATGCGATCTCAATAATTCTGGTTAGTCTTTGCTGTATATGGCAAGTCCAGGCAGAGGTCTTCACATCAACAGGTCAGATGACCGATCTGATTTATAGGGAGAGAGATCTTGTGCAATCTTTGAAAGAATACATCCAGAAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGTATCTCAAGTAGATGAACTGACTAGCAGGTCAACTGCTGATCCAGAAGGATACCTTGGGCATCCGGTAAATGCGTATAAGCTTGTGAAGAGGTTTAACACGGACTGGACATCACTAGAGAACCTTGTGCTTCAGGACTCAACAAAAGGATTTATTGCCAACCTCACATTTCAGAGAGAATATTTTCCAACTGAAGAAGATGAAAAGGGGGCTGCCAAGGCTCTAATGCGCCTTCAGGACACATATAGACTTGACCCTGACATTATAGCTAAAGGAAAATTACCAGGAACAAATTATATTTCATCTTTATCTGCGGTTGACACGTTTGGTATGGGGAAAATTGCCTACCATGATGGTGATTATTACCACACCGTTCTTTGGATGCAGCAGGCCCTGAAGCAGTTGGATGAAGGGGAGGAAG
  5   1   2       bld Oo1  5g3  in                    IMAGE:5078489.5p                             TCGGGAACACAGGCTCACGTCTGCTTAGTACAGCGCACCCAGCTGAGAGTGGCAGAGATTGAAAGATGGAGCCAAATGCGATCTCAATAATTCTGGTTAGTCTTTGCTGTATATGGCAAGTCCAGGCAGAGGTCTTCACATCAACAGGTCAGATGACCGATCTGATTTATAGGGAGAGAGATCTTGTGCAATCTTTGAAAGAATACATCCAGAAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGTATCTCAAGTAGATGAACTGACTAGCAGGTCAACTGCTGATCCAGAAGGATACCTTGGGCATCCGGTAAATGCGTATAAGCTTGTGAAGAGGTTTAACACGGACTGGACATCACTAGAGAACCTTGTGCTTCAGGACTCAACAAAAGGATTTATTGCCAACCTCACATTTCAGAGAGAATATTTTCCAACTGAAGAAGATGAAAAGGGGGCTGCCAAGGCTCTAATGCGCCTTCAGGACACATATAGACTTGACCCTGACATTATAGCTAAAGGAAAATTACCAGGAACAAATTATATTTCATCTTTATCTGCGGTTGACACGTTT
  5   1   2       bld Tbd7 5g3  in                         XL074f19.5p                                       GGCTCACGTCTGCTTAGTACAGCGCACCCAGCTGAGNAGTGGCAGAGATTGAAAGATGGAGCCAAATGCGATCTCAATAATTCTGGTTAGTCTTTGCTGTATATGGCAAGTCCAGGCAGAGGTCTTCACATCAACAGGTCAGATGACCGATCTGATTTATAGGGAGAGAGATCTTGTGCAATCTTTGAAAGAATACATCCAGAAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGTATCTCAAGTAGATGAACTGACTAGCAGGTCAACTGCTGATCCAGAAGGATACCTTGGGCACCCGGTAAATGCGTATAAGCTTGTGAAGAGGTTTAACACGGACTGGACATCACTAGAGAACCTTGTGCTTCAGGACTCAACAAAAGGATTTATTGCCAACCTCACATTTCAGAGAGAATATTTTCCAACTGAAGAAGATGAAAAGGGGGCTGCCAAGGCTCTAATGCGCCTTCAGGACACATATAGACTTGACCCTGACATTATAGCTAAAGGAAAATT
  5   1   2       bld Neu7 5g3  in                         XL019l08.5p                                         TCACGTNCTGCTTAGTACAGCGCACCCAGCTGAGNAGTGGCAGAGATTGAAAGATGGAGCCAAATGCGATCTCAATAATTCTGGTTTGTCTTTGCTGTATGTGGCAAGTCCAGGCAGAGGTCTTCACATCAACAGGTCAGATGACCGATCTGATTTATAGGGAGAGAGATCTTGTTCAATCTTTGAAAGAATACATCCAGAAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGTATCTCAAGTAGATGAACTGACTAGCAGGTCAACTGCTGATCCAGAAGGATACCTTGGGCACCCGGTAAATGCGTATAAGCTTGTGAAGAGGTTTAACACGGACTGGACATCACTAGAGAACCTTGTGCTTCAGGACTCAACAAAAGGATTTATTGCCAACCTCACATTTCAGAGAGAATATTTTCCAACTGAAGAAGATGAAAAGGGGGCTGCCAAGGCTCTAATGCGCCTTCAGGACACATATAGACTTGACCCTGACATTATAGCTAAAGGAAAATTACCAGGAACAAATTATATTTCATCTTTATCTGCGGTTGACACGTTTGGTATGGGGAAAATTGCCTACCATGATGGTGATTATTACCACACCGTTCTTTGGATGCAGCAGGCCCTGAAGCAGTTGGATGAAGGGGAGGAAGCTAAAA
  5   1   2       bld Ga18      in                        xlk8j22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAAGAAGATGAAAAGGGGNCTGCCAANNTCTAATGCGCCTTCAGGACACATATAGACTTGACCCTGACGTTATAGCTAAAGGAAAATTACCAGGAACAAATTATATTTCATCTTTATCTGCGGTTGACACGTTTGGTATGGGGAAAATTGCCTACCATGATGGTGATTATTACCACACCGTTCTTTGGATGCAGCAGGNCCTGAAGCAGTTGGATGAAGGGGAGGAAGCTAAAATTAGTAAAGTGGATGTTCTGGATTATCTCAGTTACACTGTCTTTCAGCTTGGTGATGTCCCCAGGGCAGTTGAGCTTACTAAAAGACTCTTGGTTTTAGACGCAAACCATGAACGAGCTGNNNNNNTCTGAAATATTTTGAGAAAATGCAGGAGCAACAGAAAGCAGAACTAAAGCAGAATGAAACTATTGAGACAGAGACAAGGCAACCAGGAGTCTATAACAGGCCACTGGACTATTTGCCAGAGCGGGATGTCTATGAAGCCCTGTGTCGAGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAAGAGACTTTTCTGTAGGTATCATGATGGCAATAGGAATCCTCGCCTTATCTTGGGTCCGATTAAAATGGAAGACGAGTGGGATAGNCCACGTATTGTCCGTTATCTTGATGTCTTATCTGATGNAGAAATAGAGAAAATAAAAGAACTNGCAAAACCAAGGNTAGCAAGANNNACAGTNNNNGNTCCTAAAACTGGNG
  5   1   2      ests                            Xl3.1-IMAGE:8535493.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTACAGAGTATCTAAAAGTGCATGGCTAGAAGAATATGATGATCCAGTCATAGGACGTGTGAATTCACGCATGCAGGCAATAACAGGGCTAACAAAAGACACAGCAGAATTACTTCAGGTTGCCAATTATGGTATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGAAGGAAATAGACTTGCAACATATCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCAACAGTATTTCCTGACTTTGGGGCAGCAATTTGGCCCAGAAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGTGAAGGAGATTATAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAGGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTAATGTCTAAATTTAGAAAAACAAATCCTTTTTTTATTATACTGGTGCTAGTTGGTTACCGAGGACTTAAATTATCTTTACAGATGTAGGATCAGTTGGTGCTACTAATCTACTGAACCATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAAATTGGTTTCAAACTGTAACTTTATTTTCA
                                                  Xl3.1-CHK-1012695247                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTATCTAAAAGTGCATGGCTAGAAGAATATGATGATCCAGTCATAGGACGTGTGAATTCACGCATGCAGGCAATAACAGGGCTAACAAAAGACACAGCAGAATTACTTCAGGTTGCCAATTATGGTATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGAAGGAAATAGACTTGCAACATATCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCAACAGTATTTCCTGACTTTGGGGCAGCAATTTGGCCCAGAAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGTGAAGGAGATTATAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAGGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTAATGTCTAAATTTAGAAAAACAAATCCTTTTTTTATTATACTGGTGCTAGTTGGTTACCGAGGACTTAAATTATCTTTACAGATGTAGGATCAGTTGGTGCTACTAATCTACTGAACCATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAAATTGGTTTCAAACTGTAACTTTATTTTCAAAAAAA
  5   1   0       add Tbd7      out                        XL094g09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCTTGGTTTTAGACGCAAACCTGAACGAGCTGGAAGCAATCTGAAATATTTTGAGAAAATGCAGGAGCGACAGAAAGGAGAACTAAAGCAGAATGAAACTATTGAGACAGAGACAAGGCAACCAGGAGTCTATAACAGGCCACTGGACTATTTGCCAGAGCGGGATGTCTATGAAGCCCTGTGTCGAGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAAGAGACTTTTCTGTAGGTATCATGATGGCAATAGGAATCCTCGCCTTATCTTGGGTCCGATTAAAATGGAAGACGAGTGGGATAGTCCACGTATTGTCCGTTATCTTGATGTCTTATCTGATGAAGAAATAGAGAAAATAAAAGAACTGGCAAAACCAAGGTTAGCAAGAGCCACAGTGCGGGATCCTAAAACTGGTGTTCTAACAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTAGAAGAATATGATGATCCAGTCATAGGACGTGTGAATTCACGCATGCAGGCAATAACAGGGCTAACAAAAGACACAGCAGAATTACTTCAGGTTGCCAATTATGGTATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGAAGGAAATAGACTTGCAACATATCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCAACAGTATTTCCTGACTTTGGGGCAGCA
  3   1   2       bld Ga18      in                        xlk8j22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ANNAAAATGGAAGACGAGNNGGATAGNCCACGTATNNNCNGTTATCNTNGATGTCTTATCTGATGAAGAAATAGAGAAAATAAAAGAACTGGNAAANCCAAGGTTANNAAGAGCAACAGTGCGGGATCCTAAANCTGGTGNTCTNACAGTGNCCAACTACAGAGTATCTAAAAGTGCATGGCTAGAAGAATATGATGATCCAGTCATAGGACGTGTGAATTCACGCATGCAGGCAATAACAGGGCTAACAAAAGACACAGCAGAATTACTTCAGGTTGCCAATTATGGTATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGAAGGAAATAGACTTGCAACATATCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCAACAGTATTTCCTGACTTTGGGGCAGCAATTTGGCCCAGAAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGTGAAGGAGATTATAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAGGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTAATGTCTAAATTTAGAAAAACAAATCCTTTTTTTATTTAGTTACGCGACCCCCGGCGGTCGNNGNCCAACTTCTTAGAGGGACANNNNNNTCANCCACACGAGNTCG
  5  -1   2       bld Bla2                            IMAGE:7298485.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTTTTTTAAAACCATAACGCTATTCGCAATTAACGAAATACCTTGGGATCGCGCAAAGGCAAACCGGATTTGTCATTGTGAGGCATTGCCATTGTTTCAGGTCCTTATCATTCACGGAGGATACTGCACTTTTACTATGAGACTGAGCTGAGAGCACGTATTCTGACTTGGCAGCATTGCCAGAAAGGTATGCGTATCTGTATACTCTTCAGAGTGGTGAGGAGATATAGACACGACACGCAGCTGTCCTGTATAGTAGGTAGTAAATGGGTTCTATNAAATGTTCCACGAAAGAGGACAGGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTAATGTCCAAATTTAGaaaaaaaaaTCCTTTTTTTATTATACTGGTGCTAGTTGGTTACTGAGGACTTAAATTATCTTTACAGATGCAGGATCAGTTGGTGCTACTAATCTACTGAACTATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTGGCATTCATCATGGGACTCAAAGTATTTCAACTTTAAGTGCATAATCTTGGCTGGAGATGCAATTATAGGTATACTGCTGCCCATTTAGGAATTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAAATTGATTTCAAACTGTAACTTTATTTTCAGGCaaaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCAATCGCCCAAAAATCGG
  3   1   2      seed Neu7 5g3  in                         XL019l08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAGAAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGTGAAGGAGATTATAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAGGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTAATGTCTAAATTTAGAAAAACAAATCCTTTTTTTATTATACTGGTGCTAGTTGGTTACCGAGGACTTAAATTATCTTTACAGATGTAGGATCAGTTGGTGCTACTAATCTACTGAACCATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAA
  3   1   2       bld Tbd7 5g3  in                         XL074f19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGGAGATTATAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAGGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTAATGTCTAAATTTAGAAAAACAAATCCTTTTTTTATTATACTGGTGCTAGTTGGTTACCGAGGACTTAAATTATCTTTACAGATGTAGGATCAGTTGGTGCTACTAATCTACTGAACCATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCATTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAAATGGTTTCAAAC
  5   1   2       bld Lmb1                            IMAGE:8535493.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGATTAAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAGGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTAATGTCTAAATTTAGAAAAACAAATCCTTTTTTTATTATACTGGTGCTAGTTGGTTACCGAGGACTTAAATTATCTTTACAGATGTAGGATCAGTTGGTGCTACTAATCTACTGAACCATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAAATTGGTTTCAAACTGTAACTTTATTTTCAGGCaaaaaaaataaaaaaTATGCTGACGTTTCAGCAGTACTCTGGGGCCTACTCAAACTGGCGGTCTGTGTACTGCACATTCAGTGACATGCCACAAAAGATCACAGATGCTCCATGCATCCACATGATCACAGACTTTGCGTACTTTACCTGAGCGTTATGAAAATATGTGATAGTAACGAA
  5   1   2       bld Neu4      in                    IMAGE:4084351.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGTCTAAATTTAGAAAAACAAATCCTTTTTTTATTATACTGGTGCTAGTTGGTTACCGAGGACTTAAATTATCTTTACAGATGTAGGATCAGTTGGTGCTACTAATCTACTGAACCATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGG
  3   1   2       bld Oo1  5g3  in                    IMAGE:5078489.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAATTTAGAAAAACAAATCCTTTTTTTATTATACTGGTGCTAGTTGGTTACCGAGGACTTAAATTATCTTTACAGATGTAGGATCAGTTGGTGCTACTAATCTACTGAACCATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAAATTGGTTTCAAACTGTAACTTTATTTTCAGGC
  3   1   2       bld Neu4      in                    IMAGE:4084351.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATACTGGTGCTAGTTGGTTACCGAGGACTTAAATTATCTTTACAGATGTAGGATCAGTTGGTGCTACTAATCTACTGAACCATTGAAGTCATTATAGGGAGATTTTCAAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAAATGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGGCCATATAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGTCAAGGGAAGTTTCAAACTGTAACTTTTTGTCTGTCGAA
  5   1   2       bld Ga12                                 XL180g19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGGGAGATTTTCAACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAAATTGGTTTCAAACTGTAACTTTATTTTCaaaaaaaaaa
  5   1   2       bld Ga12      out                        XL181g19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACTGTGTAGCAATAAAAACGAATGGGTAGACAGCAGGGTCTGGCTGCCACATTGTCCATATTATTTCACTTACTGTATGTTTGCTCAGGCAGCTGTGGAGCAGTTAACTCTTTGAGCAGTAGCATTCATCATGTGACTCAAAAGTATTTCAACTTTAAGTGCATAAACTTGGCTGGAGATTATTATATTGTTAGTGAGAGGAAAACTATACCAGTTTACTGGATTCAACCTTAGGTTTTGGCATAGCCTGTACAGGGAAACTGCATCAAGTTATGCAATTATAGGTATACTGCTGCCCATTTAGGATTTTTTGCGGAACCCTCTGCTTGGTGTATTTAATTTGGGGAAAGCAAAATTGGTTTCAAACTGTAACTTTATTTTCaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)