Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL103l07.3                            6 END     2           7       33                synaptotagmin-like 2 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL103l07.3                            6 PI      86       1224     1922                synaptotagmin-like 2 [Xenopus laevis]
     3   0.0    0Xl3.1-XL011d17.5                            3 PI      89          7      324                synaptotagmin-like 2 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012838614 Xl3.1-IMAGE:4031025-IMAGp.5.5 - 27 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                         Xl3.1-IMAGE:4031025-IMAGp.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCTTGACAGGTGCCTAGAGAATATCTCTGCCTGACTCAGAGGTGGAATAGGACTTGTGCACTATAAGCATGAGAAGCATGTGACCTTCCTTCAATCAAAGCTGTAATGATCCCACGTGGGGAGACAATGGATCCGGGGGAGAGTGGAGAGCTTCTAGACCTCAGTTTCTTAACTGGAGAAGAGCAACTAATGATAGTACAGGTGCTAGAGCGAGACACAGAGCTGAAGGCCAAAGAAGATCAGCGCATAAACAAGCTGCGATCAACTCTGTCAGACAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGATGTGAGCACACTCAAAGATTGGGGACAGACGACAACTACTCTCCCTTATAGCCTTCCCGCTCTACGGAGGTCTGCAGGCAGAGGTGAATGTGATGTAAACTGGGGTCAAGATGACACGGAGGCCTGTGACGGACCAGAAGAAACAGAAACTGTATATCCTTACACAGACAATTATATATGTGAGTCTTCACATATATTCTTGTTTGTGTCTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTAGGATCTTACCGCTCCCGCGCTGAGACGGCTCCCCTGATAAAACTGCTCAGGGGAACTAACGGCTGCTGCCTTCTCTCCCAGCACCTCGGCCCACATTGCTCCTACTTGGGGCCCCTGCTTCTCAAATCTTCAGCGACCGCGCTCCTCTAGTCCAGGCAGACGTCTACAGGCAAGTATTCCTTCTCTTAAAGGGGCACTACACCTGGTATACATGGGTTTCCCCAGGGACTCTAAACCCTCTATTCTCTGTCTCCACAGCACCTTCTCTATTAGGAGGTTCTTATCCTTGCATTTGCCTTTGCAGTCGAGGTCGGCTTAGAGTTGCTGTGAAATATGTTCCACAAGGGGCAGAAGGCTTAGGGCTTCCTCCCACTGGTGAACTCCATGTTTGGATTAAGGAGGCACAGCAACTTGTACCTCACAAGGCTGGAAATGTCAGCACTTTTGTAAAGTGCTTTGTGCTTCCCGATTCCAGTCCATCCAACATACAGCGCACACGTGTGATCCCACATAGCTTGCATCCAGTGTTTAACCACACCATGGTGTATGATGGCTTCAGTGGAGAAGACCTCAAAGAAGCCTGTGTTGAATGCATCATTTGGGACCAGGGTAAAATAGGAAGTCGACCTCTTGGGGGCATTCGCCTCAGCACCGGAAAAGGAAGCAGCTATGAAAACAGTGTCAACTGGATGGATTCCACAGAAGAGGAGAAGGCATTCTGGAAATCAGTTATAAATAATCCTGCGGAGTGGGCAGAGATTGTGCTGCCACTAAGACAAAATTTAACTTCACGTTGACTGATTAATACCAGTTAAAGAGGTGACCTACAATGAAGATTACCCCAGACATAAATCATACAACCTAGGCTGAGGATAGACCCTTACTCTGGGTTTGCTGAAAACTGTTACACATAATGCCAAGTGGAACCGTTTGTGAATGAACTTGACCCTGCAAAATAAAAGGGTTACCTGTATGGCAGTTTCTATATTTTTTCAAATGATGCTTGATGTCAATGTTATTGATAAGGAAGAAAGCTAGAAATTTGTCTATT
                                                  Xl3.1-CHK-1012722045                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGGTGCCTAGAGAATATCTCTGCCTGACTCAGAGGTGGAATAGGACTTGTGCACTATAAGCATGAGAAGCATGTGACCTTCCTTCAATCAAAGCTGTAATGATCCCACGTGGGGAGACAATGGATCCGGGGGAGAGTGGAGAGCTTCTAGACCTCAGTTTCTTAACTGGAGAAGAGCAACTAATGATAGTACAGGTGCTAGAGCGAGACACAGAGCTGAAGGCCAAAGAAGATCAGCGCATAAACAAGCTGCGATCAACTCTGTCAGACAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGAxxxxxxCACACTxxxxxxTTGGGGACAGACxxxxxxTACTCTCCCTTATAGCCTTCCCGCTCTACGGAGGTCxxxAGxCAGAGGTGAATGTGATGTAAACTGGGGTCAAGATGAxAxxGxGGCCTGxxxCxGACCAGAAGAAACAGAAACxxTxxxxCCTxxxAxAxACAATTATATATGTGAGTCTTCACATATATTCTTGTTTGTGTCTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTAGGATCTTACCGCTCCCGCGCTGAGAxxxxxxCCCTGATAAAACTGCTCAxxxxxxCTAACGGCTGCTGCCTTCTCTCCCAGCACCTCGGCCCACATTGCTCCTACTTGGGGCCCCTGCTTCTCAAATCTTCAGCGACCGCGCTCCTCTAGTCCAGGCAGACGTCTACAGGCAAGTATTCCTTCTCTTAAAGGGGCACTACACCTGGTATACATGGGTTTCCCCAGGGACTCTAAACCCTCTATTCTCTGTCTCCACAGCACCTTCTCTATTAGGAGGTTCTTATCCTTGxxxxTxCCTTTGCAGTCGAGGTCGGCTTAGAGTTGCTGTGAAATATGTTCCACAAGGGGCAGAAGGCTTAGGGCTTCCTCCCACTGGTGAACTCCATGTTTGGATTAAGGAGGCACAGCAACTTGTACCTCACAAGGCTGGAAATGTCAGCACTTTTGTAAAGTGCTTTGTGCTTCCCGATTCCAGTCCATCCAACATACAGCGCACACGTGTGATCCCACATAGCTTGCATCCAGTGTTTAACCACACCATGGTGTATGATGGCTTCAGTGGAGAAGACCTCAAAGAAGCCTGTGTTGAATGCATCATTTGGGACCAGGGTAAAATAGGAAGTCGACCTCTTGGGGGCATTCGCCTCAGCACCGGAAAAGGAAGCAGCTATGAAAACAGTGTCAACTGGATGGATTCCACAGAAGAGGAGAAGGCATTCTGGAAATCAGTTATAAATAATCCTGCGGAGTGGGCAGAGATTGTGCTGCCACTAAGACAAAATTTAACTTCACGTTGACTGATTAATACCAGTTAAAGAGGTGACCTACAATGAAGATTACCCCAGACATAAATCATACAACCTAGGCTGAGGATAGACCCTTACTCTGGGTTTGCTGAAAACTGTTACACATAATGCCAAGTGGAACCGTTTGTGAATGAACTTGACCCTGCAAAATAAAAGGGTTACCTGTATGGCAGTTTCTATATTTTTTCAAATGATGCTTGATGTCAATGTTATTGATAAGGAAGAAAGCTAGAAATTTGTCTATTTTTGTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     4     4     5     5     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     7     7     7     7     7     7     6     7     7     7     7     7     7     7     7     7     7     8     7    11     7    12     6    12     6    13     6    13     6    13     6    13     6    13     6    13     6    13     6    13     6    13     6    13     6    13     6    13     6    13     6    13     6    12     5    12     5    11     5    11     5    10     5    10     6    12     7    13     7    13     7    14     6    14     6    14     6    14     7    15     7    15     7    15     7    15     7    15     7    14     7    14     7    14     7    13     7    13     7    13     7    13     7    13     7    13     7    13     7    13     7    13     7    13     7    14     7    14     8    14     8    14     6    13     7    12     6    11     4     9     5     9     4     8     4     8     4     8     4     8     4     8     4     7     4     7     3     7     3     7     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     5     3     6     3     6     3     7     3     5     3     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     7     5     7     6     7     7     8     6     7     3     6     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      ests                      Xl3.1-IMAGE:4031025-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCTTGACAGGTGCCTAGAGAATATCTCTGCCTGACTCAGAGGTGGAATAGGACTTGTGCACTATAAGCATGAGAAGCATGTGACCTTCCTTCAATCAAAGCTGTAATGATCCCACGTGGGGAGACAATGGATCCGGGGGAGAGTGGAGAGCTTCTAGACCTCAGTTTCTTAACTGGAGAAGAGCAACTAATGATAGTACAGGTGCTAGAGCGAGACACAGAGCTGAAGGCCAAAGAAGATCAGCGCATAAACAAGCTGCGATCAACTCTGTCAGACAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGATGTGAGCACACTCAAAGATTGGGGACAGACGACAACTACTCTCCCTTATAGCCTTCCCGCTCTACGGAGGTCTGCAGGCAGAGGTGAATGTGATGTAAACTGGGGTCAAGATGACACGGAGGCCTGTGACGGACCAGAAGAAACAGAAACTGTATATCCTTACACAGACAATTATATATGTGAGTCTTCACATATATTCTTGTTTGTGTCTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTAGGATCTTACCGCTCCCGCGCTGAGACGGCTCCCCTGATAAAACTGCTCAGGGGAACTAACGGCTGCTGCCTTCTCTCCCAGCACCTCGGCCCACATTGCTCCTACTTGGGGCCCCTGCTTCTCAAATCTTCAGCGACCGCGCTCCTCTAGTCCAGGCAGACGTCTACAGGCAAGTATTCCTTCTCTTAAAGGGGCACTACACCTGGTATACATGGGTTTCCCCAGGGACTCTAAACCCTCTATTCTCTGTCTCCACAGCACCTTCTCTATTAGGAGGTTCTTATCCTTGCATTTG
  5   1   2      ests                                 Xl3.1-XL017a02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTCCAGAATTCCTTTGCAGTCGAGGTCGGCTTAGAGTTGCTGTGAAATATGTTCCACAAGGGGCAGAAGGCTTAGGGCTTCCTCCCACTGGTGAACTCCATGTTTGGATTAAGGAGGCACAGCAACTTGTACCTCACAAGGCTGGAAATGTCAGCACTTTTGTAAAGTGCTTTGTGCTTCCCGATTCCAGTCCATCCAACATACAGCGCACACGTGTGATCCCACATAGCTTGCATCCAGTGTTTAACCACACCATGGTGTATGATGGCTTCAGTGGAGAAGACCTCAAAGAAGCCTGTGTTGAATGCATCATTTGGGACCAGGGTAAAATAGGAAGTCGACCTCTTGGGGGCATTCGCCTCAGCACCGGAAAAGGAAGCAGCTATGAAAACAGTGTCAACTGGATGGATTCCACAGAAGAGGAGAAGGCATTCTGGAAATCAGTTATAAATAATCCTGCGGAGTGGGCAGAGATTGTGCTGCCACTAAGACAAAATTTAACTTCACGTTGACTGATTAATACCAGTTAAAGAGGTGACCTACAATGAAGATTACCCCAGACATAAATCATACAACCTAGGCTGAGGATAGACCCTTACTCTGGGTTTGCTGAAAACTGTTACACATAATGCCAAGTGGAACCGTTTGTGAATGAACTTGACCCTGCAAAATAAAAGGGTTACCTGTATGGCAGTTTCTATATTTTTTCAAATGATGCTTGATGTCAATGTTATTGATAAGGAAGAAAGCTAGAAATTTGTCTATTTTTGTCCAGATGGTAATCCAGGGAAAAAGCTTGATGCTTCAGTAGAGCTAACTACCCTCACTTAACACTGACTGGGAGTAATTAGCCTATGTGATCTTCGGAAAGAAGAAAATCGTAAGAAGTGACATCTGAATTCCAGAAGAATTCCTAAGCCCCAGAAAAGCAAGAATATTACACTCAAAAAAGTGGGATGCAGTCATACCAATTATAAAGGCCAGAACATGGCAAATATGTATACAAATTATTCTAATAAAGAATATGGCAGTTTCTGAGGAGATATTTACAGCAAAGCTGGAGAGTGTGTTTTGAGCACACTTGCACAATAGCTGCAAAATGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCTGGAGCAATTGATCAGGACTGCGTGTTAGGATCATGCCACATTATGGGGGCCACTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTACACGTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCTCTCCAGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGTGGTATTGACATTGTGCAGGCATCAATTAGGAGGAAAAAAAAAGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCGCTCCCTTCTTTCCCTACGCTGTCTTCCCGCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATGGAGAGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCAGCGCTCTACACCTCTTAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGGCACCTGTGAGAAAATTATCCACGGAATCCCTTCCAGATCGGCTCTCCAGTGATGCACAGGATTGGAGCAGCTCAAAAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGACACAACAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGAAGAACAGTATGGAAGAAATAAACTTATCTCCAGTAAATGGCACAGTTTCAAGTGAAGATACTAATGGGGAAAGCCTGGAAGAAAAAGAACACCGGAACCTCAACCACAGCCCATCAATTCGACAGCTGGCAAATAATTCTCAAATTTCTGGCAGTATGATGAGCCTGTTTAGCACAGGGGAAGTGCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGTGGCTGTGTCCAGTTCTCTCTTCAATACGATCCCTCCAAGAAGGAGCTGAATGTCTTAATTATTCAATGCAGGGACCTGACACCCGCACAGAGCAAAACCTCCAATCCGTATATAAAGTGTTATTTGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCTGGCGCCAAAGCCCCCTCACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGAAATCAAAGTTGAAAAAGAAGACTCTGGAACC
                                               BLH MIN    1165      61                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ci ---- 7e-007     FAA00229.1 TPA: zinc finger protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - ?? ---- 4e-009     XP_869170.3 PREDICTED: similar to Synaptotagmin-like 3 isoform 2 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 9e-025     XP_309076.4 AGAP005288-PA [Anopheles gambiae str. PEST] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 2e-026     NP_001097794.1 bitesize CG33555-PE, isoform E [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 3e-045     XP_701277.3 PREDICTED: synaptotagmin-like 2 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Gg ---- 7e-050     NP_001074358.1 hypothetical protein LOC771987 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ---- 2e-051     NP_113570.2 synaptotagmin-like 1 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Cf ---- 5e-053     XP_544472.2 PREDICTED: similar to synaptotagmin-like 1 [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Bt ---- 4e-053     XP_606038.3 PREDICTED: hypothetical protein [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Hs ---- 5e-054     NP_116261.1 NADPH oxidase-related, C2 domain-containing protein [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xt ---- 6e-086     NP_001006773.1 synaptotagmin-like 2 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Xl ---- 3e-095     NP_001086662.1 synaptotagmin-like 2 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                         Xl3.1-IMAGE:4031025-IMAGp.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGA---------------------------------------------------------TAA---TGA---------------------------------ATG------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TGA---------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TGA---------------TAA---------------TGA---------------TAA------------------------------------------------------------TAA------------------------------------------TAA---------------------------------------------TGA------------TGATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                        ]
  5   1   2      ests                      Xl3.1-IMAGE:4031025-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCTTGACAGGTGCCTAGAGAATATCTCTGCCTGACTCAGAGGTGGAATAGGACTTGTGCACTATAAGCATGAGAAGCATGTGACCTTCCTTCAATCAAAGCTGTAATGATCCCACGTGGGGAGACAATGGATCCGGGGGAGAGTGGAGAGCTTCTAGACCTCAGTTTCTTAACTGGAGAAGAGCAACTAATGATAGTACAGGTGCTAGAGCGAGACACAGAGCTGAAGGCCAAAGAAGATCAGCGCATAAACAAGCTGCGATCAACTCTGTCAGACAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGATGTGAGCACACTCAAAGATTGGGGACAGACGACAACTACTCTCCCTTATAGCCTTCCCGCTCTACGGAGGTCTGCAGGCAGAGGTGAATGTGATGTAAACTGGGGTCAAGATGACACGGAGGCCTGTGACGGACCAGAAGAAACAGAAACTGTATATCCTTACACAGACAATTATATATGTGAGTCTTCACATATATTCTTGTTTGTGTCTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTAGGATCTTACCGCTCCCGCGCTGAGACGGCTCCCCTGATAAAACTGCTCAGGGGAACTAACGGCTGCTGCCTTCTCTCCCAGCACCTCGGCCCACATTGCTCCTACTTGGGGCCCCTGCTTCTCAAATCTTCAGCGACCGCGCTCCTCTAGTCCAGGCAGACGTCTACAGGCAAGTATTCCTTCTCTTAAAGGGGCACTACACCTGGTATACATGGGTTTCCCCAGGGACTCTAAACCCTCTATTCTCTGTCTCCACAGCACCTTCTCTATTAGGAGGTTCTTATCCTTGCATTTG
                                                  Xl3.1-CHK-1012690090                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGGTGCCTAGAGAATATCTCTGCCTGACTCAGAGGTGGAATAGGACTTGTGCACTATAAGCATGAGAAGCATGTGACCTTCCTTCAATCAAAGCTGTAATGATCCCACGTGGGGAGACAATGGATCCGGGGGAGAGTGGAGAGCTTCTAGACCTCAGTTTCTTAACTGGAGAAGAGCAACTAATGATAGTACAGGTGCTAGAGCGAGACACAGAGCTGAAGGCCAAAGAAGATCAGCGCATAAACAAGCTGCGATCAACTCTGTCAGACAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGAxxxxxxCACACTxxxxxxTTGGGGACAGACxxxxxxTACTCTCCCTTATAGCCTTCCCGCTCTACGGAGGTCxxxAGxCAGAGGTGAATGTGATGTAAACTGGGGTCAAGATGAxAxxGxGGCCTGxxxCxGACCAGAAGAAACAGAAACxxTxxxxCCTxxxAxAxACAATTATATATGTGAGTCTTCACATATATTCTTGTTTGTGTCTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTAGGATCTTACCGCTCCCGCGCTGAGAxxxxxxCCCTGATAAAACTGCTCAxxxxxxCTAACGGCTGCTGCCTTCTCTCCCAGCACCTCGGCCCACATTGCTCCTACTTGGGGCCCCTGCTTCTCAAATCTTCAGCGACCGCGCTCCTCTAGTCCAGGCAGACGTCTACAGGCAAGTATTCCTTCTCTTAAAGGGGCACTACACCTGGTATACATGGGTTTCCCCAGGGACTCTAAACCCTCTATTCTCTGTCTCCACAGCACCTTCTCTATTAGGAGGTTCTTATCCTTGCATTTGCCGGAT
  5   1   2       bld Tbd7                                 XL078h09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCACGAGGGCACACCTGGCTTGGATCTGCTCAGCCTTGACAGGTGCCTAGAGAATATCTCTGCCTGACTCAGAGGTGGAATAGGACTTGTGCACTATAAGCATGAGAAGCATGTGACCTTCCTTCAATCAAAGCTGTAATGATCCCACGTGGGGAGACAATGGATCCGGGGGAGAGTGGAGAGCTTCTAGACCTCAGTTTCTTAACTGGAGAAGAGCAACTAATGATAGTACAGGTGCTAGAGCGAGACACAGAGCTGAAGGCCAAAGAAGATCAGCGCATAAACAAGCTGCGATCAACTCTGTCAGACAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGATGTGAGGGCTACACGTCCTTGGGGACAGACAGGTGGTATTGACATTGTGCAGGCATCAATTAGGAGaaaaaaaaaaGTCAGAGGTGAATGTGATGTAAACTGGGGTCAAGATGAGAATGGAGAGAGTGACGGACCAGAAGAAACAGAAACGTTGGCACCTGTGAGAAAATTATCCACGGAATCCCTTCC
  5   1   2       bld Tbd7      in                         XL077h09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCACACCTGGCTTGGATCTGCTCGCCTTGACAGGTGCCTAGAGAATATCTCTGCCTGACTCAGAGGTGGAATAGGACTTGTGCACTATAAGCATGAGAAGCATGTGACCTTCCTTCAATCAAAGCTGTAATGATCCCACGTGGGGAGACAATGGATCCGGGGGAGAGTGGAGAGCTTCTAGACCTCAGTTTCTTAACTGGAGAAGAGCAACTAATGATAGTACAGGTGCTAGAGCGAGACACAGAGCTGAAGGCCAAAGAAGATCAGCGCATAAACAAGCTGCGATCAACTCTGTCAGACAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGATGTGAGGGCTACACGTCCTTGGGGACAGACAGGTGGTATTGACATTGTGCAGGCATCAATTAGGAGaaaaaaaaaaGTCAGAGGTGAATGTGATGTAAACTGGGGTCAAGATGAGAATGGAGAGAGTGACGGACCAGAAGAAACAGAAACGTTGGCACCTGTG
  5   1   2       bld Kid                             IMAGE:4031025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGTGCCTAGAGAATATCTCTGCCTGACTCAGAGGTGGAATAGGACTTGTGCACTATAAGCATGAGAAGCATGTGACCTTCCTTCAATCAAAGCTGTAATGATCCCACGTGGGGAGACAATGGATCCGGGGGAGAGTGGAGAGCTTCTAGACCTCAGTTTCTTAACTGGAGAAGAGCAACTAATGATAGTACAGGTGCTAGAGCGAGACACAGAGCTGAAGGCCAAAGAAGATCAGCGCATAAACAAGCTGCGATCAACTCTGTCAGACAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGATGTGAGGGCTACACGTCCTTGGGGACAGACAGGTGGTATTGACATTGTGCAGGCATCAATTAGGAGGaaaaaaaaaGTCAGAGGTGAATGTGATGTAAACTGGGGTCAAGATGAGAATGGAGAGAGTGACGGACCAGAAGAAACAGAAACGTTGGCACCTGTGAGAAAATTATCCACGGAATCCCTTCCAGATCGGCTCTCCAGTGATGCACAGGATTGGAGCAGCTCAAAAGAAGATGAGGGGGGAGACACAACAGATGGGAAGAACAGTATGGAAGAAATAAACTTATCTCCAGTAAATGGCACAGTTTCAAGTGAAGATACTAATGGGGGAAGCCTGGaaaaaaaaaaaaaCCGGAACCTCAACCACAGCCCCTCAATTTCGAACAGCTGGCAAAATAATTCTCCAAATTTCCTGGGCGGTATGATGAGCCCTGGTTTAACACCAGGGGGAAAGGGCGGATCAAGTTGACCGTTCCGGGGGCTGGTGTTCCACGGTTCCTCCTCCTTCTCAATAACCAATTCCCCTTCCCACAAAAAGGAGACCTGGAAATGGGCGCCTATAAATTTATTTTCT
  5   1   2       bld Tbd7 5g3  out                        XL065f06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAATCTCTGCTTGAATGAGAGGAGGAATAGGACTCATGCACTATGAGCATGAGAAGCATGTGACCTTCTTACTATCAAAGCTATAATGATCCCATGTGGGGAGACAATGGATGTGGGGCAGAGTGGAGACCTTCTGGACCTCAGTTTCCTCACTGGAGAAGAGCAACTAATGATAGTGCAAGTGCTAGAGCGAGACACAGAGCTGAAGGCAAAAGAAGATCAACGCATAAAGAATCTGCGGTCAAATCTCTCAGACAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGATGTGAGGTCTACACGTCCTTGGGGACAGACAGGTGGTGTTGACATTGTGCGGGCATCAATTAGAAGaaaaaaaaaGATCAGGGGTGAATGTGATGTAAACTGGGGTCAAGATGAGAATGGAGAAAGTGAAGGACCAGAGGAAACAGAAACATGCACACCTGTGAGAAAGTTATCTAGTGAATCCCTTCCAGATCGCCTCTCCAGTGATGCACAGGATTGGAGCAGCTCAAAGGAGGAAGAGGGAGGAGATACAACAGATGGAATGAACAGTATGGAAGAAATAAACTTGTCTCCAGTTAATGGCACAGTTTCAAGTGGAGATACTAAAGGAGAAAGCCTGGAAAGAAAAAAGCACCA
  5   1   2       add Tbd7 5g3  out                        XL103l07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGAGGAGGAATAGGACTCATGCACTATGAGCATGAGAAGCATGTGACCTTCTTACTATCAAAGCTATAATGATCCCATGTGGGGAGACAATGGATGTGGGGCAGAGTGGAGACCTTCTGGACCTCAGTTTCCTCACTGGAGAAGAGCANCTNNTGATAGTGCAAGTGCTAGAGCGAGACACAGAGCTGAAGGCAAAAGAAGATCAACGCATAAAGAATCTGCGGTCAAATCTCTCAGAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGATGTGAGGTCTACACGTCCTTGGGGACAGACAGGTGGTGTTGACATTGTGCGGGCATCAATTANAAGaaaaaaaaNGATCAGGGGTGAATGTGATGTAAACTGGGGTCAAGATGAGAATGGAGAAAGTGAAGGNCCANNAGGAAACAGA
  5   1   2       bld Tbd7      in                         XL090c04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAATAGGACTTGTGCACTATAAGCATGAGAAGCATGTGACCTTCCTTCAATCGAAGCTGTAATGATCCCACGTGGGGAGACAATGGATCCGGGGGAGAGTGGAGAGCTTCTAGACCTCAGTTTCTTAACTGGAGAAGAGCAACTAATGATAGTACAGGTGCTAGAGCGAGACACAGAGCTGAAGGCCAAAGAAGATCAGCGCATAAACAAGCTGCGATCAACTCTGTCAGACAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGATGTGAGGGCTACACGTCCTTGGGGACAGACAGGTGGTATTGACATTGTGCAGGCATCAATTAGAAGGaaaaaaaaaGTCAGAGGTGAATGTGATGTAAACTGGGGTCAAGATGAGAATGGAGAGAGTGACGGACCAGAAGAAACAGAAACGTTGGCACCTGTGAGAAAATTATCCACGGAATCCCTTCCAGATCGGCTCTCCAGTGATGCACAGGATTGGAGCAGCTCAAAAGAGGATGAGGGGGGAGACACAACAGATGGGAAGAACAGNATGGAAGAAATAAACTTATCTCCAGTAAATGGCACAGTTTCAAGTGAAGATACTAATGGGGAAAGCCTGGAAGAAAAAGAACACCGGAACCTCAACCACAGCCCATCAATTCGACAGCTGC
  5   1   2       bld Kid                    IMAGE:4031025-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGGAGAGTGGAGAGCTTCTAGACCTCAGTTTCTTAACTGGAGAAGAGCAACTAATGATAGTACAGGTGCTAGAGCGAGACACAGAGCTGAAGGCCAAAGAAGATCAGCGCATAAACAAGCTGCGATCAACTCTGTCAGACAAGAAAGCATTCAAACGTCTGTCAGGGGAATGGTTCTGTGATGTGAGGGCTACACGTCCTTGGGGACAGACAGGTGGTATTGACATTGTGCAGGCATCAATTAGGAGGaaaaaaaaaGTCAGAGGTGAATGTGATGTAAACTGGGGTCAAGATGAGAATGGAGAGAGTGACGGACCAGAAGAAACAGAAACGTTGGCACCTGTGAGAAAATTATCCACGGAATCCCTTCCAGATCGGCTCTCCAGTGATGCACAGGATTGGAGCAGCTCAAAAGAGGATGAGGGGGGAGACACAACAGATGGGAAGAACAGTATGGAAGAAATAAACTTATCTCCAGTAAATGGCACAGTTTCAAGTGAAGATACTAATGGGGAAAGCCTGGAAGAAAAAGAACACCGGAACCTCAACCACAGCCCATCAATTCGACAGCTGGCAAATAATTCTCAAATTTCTGGCAGTATGATGAGCCTGTTTAGCACAGGGGAAGTGCGATCAGTTGACGTTCGTGGCTGTGTCCAGTTCTCTCTTCAATACGATCCCTCCAAGAAGGAGCTGAATGTCTTAATTATTCAATGCAGGGACCTGACACCCGCACAGAGCAAAACCTCCAATCCGTATATAAAGTGTTATTTGCTCCCTGATAAAACTGCTCAGGGGAAGAGGA
  5   1   2       bld Em10                            IMAGE:7979713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCCTCAGAAGGAGAAGACACATAGTTAGTGGCTGGAGCAATTGATCAGGACTGCGTGTTAGGATCATGCCACATTATGGGGGCCACTGACACACTCAAAGAGCCTCTCCAGCTGACAACTACTCTCCCTTATAGCCTTCCCGCTCTACGGAGGTCTGCAGGCTCGCTCCCTTCTTTCCCTACGCTGTCTTCCCGCTCCACGGAGGCCTGCAGCAGCGCTCTACACCTCTTAGGTGTATATCCTTACACAGACAATTATATATGTGAGTCTTCACATATATTCTTGTTTGTGTCTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGATGGGAAGAACAGTATGGAAGAAATAAACTTATCTCCAGTAAATGGCACAGTTTCAAGTGAAGATACTAATGGGGAAAGCCTGGAAGAAAAAGAACACCGGAACCTCAACCACAGCCCATCAATTCGACAGCTGGCAAATAATTCTCAAATTTCTGGCAGTATGATGAGCCTGTTTAGCACAGGGGAAGTGCGATCAGTTGACGTTCGTGGCTGTGTCCAGTTCTCTCTTCAATACGATCCCTCCAAGAAGGAGCTGAATGTCTTAATTATTCAATGCAGGGACCTGACACCCGCACAGAGCAAAACCTCCAATCCGTATATAAAGTGTTATTTTGCTCCTGATAAACTGCTCAGGGGAAAGAGAAATCAAGTTGAAAAGAAGATCTGGAANNCGTCTTATGAGACCTAAATACAGGTGAATGTCAAGTGCAAGCAAGTCTCATCTTCTGTTGACAGGGTCCTGGAGAC
  5   1   2       bld Ga12      in                         XL188l19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGGAAGACACATAGTTAGTGGCTGGAGCAATTGATCAGGACTGCGTGTTAGGATCATGCCACATTATGGGGGCCACTGACACACTCAAAGAGCCTCTCCAGCTGACAACTACTCTCCCTTATAGCCTTCCCGCTCTACGGAGGTCTGCAGGCTCGCTCCCTTCTTTCCCTACGCTGTCTTCCCGCTCCACGGAGGCCTGCAGCAGCGCTCTACACCTCTTAGGTGTATATCCTTACACAGACAATTATATATGTGAGTCTTCACATATATTCTTGTTTGTGTCTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTAAG
  5   1   2       bld Ga12      in                         XL201h09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGGAAGAACATAGTTAGTGGCTGGAGCAATTGATCAGGACTGCGTGTTAGGATCATGCCACATTATGGGGGCCACTGACACACTCAAAGAGCCTCTCCAGCTGACAACTACTCTCCCTTATAGCCTTCCCGCTCTACGGAGGTCTGCAGGCTCGCTCCCTTCTTTCCCTACGCTGTCTTCCCGCTCCACGGAGGCCTGCAGCAGCGCTCTACACCTCTTAGGTGTATATCCTTACACAGACAATTATATATGTGAGTCTTCACATATATTCTTGTTTGTGTCTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTANGATCTTACCGCTCCCGCGCTGAGACGGCTCTGCTG
  5   1   2       bld Ga18      in                       xlk59n24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAAGNNACATAGTTAGTGGCTGNNNNNTTGATCAGGACTGCGTGTTAGGATCATGCCACATTATGGGGGCCACTGACACACTCAAAGAGCCTCTCCAGCTGACAACTACTCTCCCTTATAGCCTTCCCGCTCTACGGAGGTCTGCAGGTTCGCTCCCTTCTTTCCCTACGCTGTCTTCCCGCTCCACGGAGGCCTGCAGCAGCNTCTACACCTCTTAGGTGTATATCCTTACACAGACAATTATATATGTGAGTCTTCACATATATTCTTGTTTGTGTCTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGATGGGAAGAACAGTATGGAAGAAATAAACTTATCTCCAGTAAATGGCACAGTTTCAAGTGAAGATACTAATGGGGAAAGCCTGGAAGAAAAAGAACACCGGAACCTCAACCACAGCCCATCAATTCGACAGCTGGCAAATAATTCTCAAATTTCTGGCAGTATGATGAGCCTGTTTAGCACAGGGGAAGTGCGATCAGTTGACGNTCGTGGCTGTGTCCAGTTCTCTCTTCAATACGATCCCTCCAAGAAGGAGCTGAATGTCTTAATTATTCAATGCAGGGACCTGACACCCGCACAGAGCAAAACCTCCAATCCGNATATAAAGNGTTATTTGCTCCCTGATAAAACTGCTCANGGGAAGAGGAAATCAAAGTTGAAAAAGAAGACTCTGGAACCNNTCTTTAATGAGACCNTAAAANA
  5   1   2       bld Ga12      in                         XL152c04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGCTGGNAGCAATTGATNCAGGACTGCGTGTTAGGATCATGCCACATTATGGGGGCCACTGACACACTCAAAGAGCCTCTCCAGCTGACAACTACTCTCCCTTATAGCCTTCCCGCTCTACGGAGGTCTGCAGGCTCGCTCCCTTCTTTCCCTACGCTGTCTTCCCGCTCCACGGAGGCCTGCAGCAGCGCTCTACACCTCTTAGGTGTATATCCTTACACAGACAATTATATATGTGAGTCTTCACATATATTCTTGTTTGTGTCTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTAGGATCTTACCGCTCCCGCGCTGAGAC
  5   1   2      seed Ga12                                 XL141e07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACTGCGTGTTAGGATCATGCCACATTATGGGGGCCACTGACACACTCAAAGAGCCTCTCCAGCTGACAACTACTCTCCCTTATAGCCTTCCCGCTCTACGGAGGTCTGCAGGCTCGCTCCCTTCTTTCCCTACGCTGTCTTCCCGCTCCACGGAGGCCTGCAGCAGCGCTCTACACCTCTTAGGTGTATATCCTTACACAGACAATTATATATGTGAGTCTTCACATATATTCTTGTTTGTGTCTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTANGATCTTACCGCTCCCGCGCTGAGACGGCTCTGCTG
  5  -1   2       bld Bla2                            IMAGE:7300563.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAACCGATAAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTGAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTCCCTACAGTGCTCCATTGCTCCCTGTTCTTTTCAAATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATAGGCGCATCGCTACTCTTCTCGCGCCCTTTTTTCTCCTGCTTCGCCGTCAGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCTTCCGCCCAGTCTCTGCCTCATGCGCATTAGGATTTTACCGCTCCCGCGCTGAGACGGCTCTTCTGGCGCCAAAGTCCCCTCACTCTAACGGCTGCTGCCTTCTCTCCCAGCACCTCGGCCCACATTGCTCCTACTTGGGGCCCCTGCTTCTCAAATCTTCAGCGACCGCGCTCCAGGCAGTCCAGGCAGACGGTTACAGGCAAGTATTCCTTCTCTTAAAGGGGCACTACACCTGGTATACATGGGTTTCCCCAGGGACTCTAAACCCTCTATTCTCTGTCTCCACAGCACCTTCTCTATTAGGAGGTTCTTATCCTTGCATTTGCCGGATTCCCCTGCCTCAGCNAAAATTTaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGTACTCA
  3   1   2       bld Ga12      in                         XL201h09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGTGACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTAGGATCTTACCGCTCCCGCGCTGAGACGGCTCTGCTGGCGCCAAAGCCCCCTCACCCTAACGGCTGCTGCCTTCTCTCCCAGCACCTCGGCCCACATTGCTCCTACTTGGGGCCCCTGCTTCTCAAATCTTCAGCGACCGCGCTCCTCTAGTCCAGGCAGACGTCTACAGGCAAGTATTCCTTCTCTTAAAGGGGCACTACACCTGGTATACATGGGTTTCCCCAGGGACTCTAAACCCTCTATTCTCTGTCTCCACAGCACCTTCTCTATTAGGAGGTTCTTATCCTTGCATTTGCCGGA
  3   1   2       bld Ga12      in                         XL188l19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGGGAAACCGATTAAAAGGGCACAGTACAGCTGGCAACGGTGGTGAGTACATTCCACCCTTCTACCCTCTCTTTTCTCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTAGGATCTTACCGCTCCCGCGCTGAGACGGCTCTGCTGGCGCCAAAGCCCCCTCACCCTAACGGCTGCTGCCTTCTCTCCCAGCACCTCGGCCCACATTGCTCCTACTTGGGGCCCCTGCTTCTCAAATCTTCAGCGACCGCGCTCCTCTAGTCCAGGCAGACGTCTACAGGCAAGTATTCCTTCTCTTAAAGGGGCACTACACCTGGTATACATGGGTTTCCCCAGGGACTCTAAACCCTCTATTCTCTGTCTCCACAGCACCTTCTCTATTAGGAGGTTCTTATCCTTGCATTTGCCGGATTC
  5   1   2      shim Neu7      in                         XL017a02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGCAACGGTGATGGGAAGAACAGTATGGAAGAAATAAACTTATCTCCAGTAAATGGCACAGTTTCAAGTGAAGATACTAATGGGGAAAGCCTGGAAGAAAAAGAACACCGGAACCTCAACCACAGCCCATCAATTCGACAGCTGGCAAATAATTCTCAAATTTCTGGCAGTATGATGAGCCTGTTTAGCACAGGGGAAGTGCGATCAGTTGACGTTCGTGGCTGTGTCCAGTTCTCTCTTCAATACGATCCCTCCAAGAAGGAGCTGAATGTCTTAATTATTCAATGCAGGGACCTGACACCCGCACAGAGCAAAACCTCCAATCCGTATATAAAGTGTTATTTGCTCCCTGATAAAACTGCTCAGGGGAAGAGGAAATCAAAGTTGAAAAAGAAGACTCTGGAACCGTTCTTTAATGAGACCCTAAAATACAAGGTGGAATGGTCAGAGTTGCAAAGCAGAGTCCTCAATCTGTCTGTGTGGCACAGGGGGTCACTGGGAAGAAACCTTTTTCTTGGTGAGGTGGAAGTGGATCTTGTGTCCTGGGACTGGAGCAAAACTCAG
  3   1   2       bld Ga12      in                         XL152c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTACATAGCCTGGAAGTATTTATGTAGAAAGTGCTTGGAATACAGTGTTAAAACAATGTTTTGTCTGTCTGTCTAAACACTGTCCTTGCTGGTGTTTCCTACAGCTCCCTGTTCTTTTCACATGCCCCTGGAGCCCTCTTGGTATCGCCTACCTTCCTATATGCGCATCGCTACTCTTCTCGCGCCTTTTTTCTCCTGCTTCGCCGTCGGCGCCAACGTGCGTTCCACCTTGGAACGCACTTCCGCCCAGTCTCTGCCTCATGCGCATTAGGATCTTACCGCTCCCGCGCTGAGACGGCTCTGCTGGCGCCAAAGCCCCCTCACCCTAACGGCTGCTGCCTTCTCTCCCAGCACCTCGGCCCACATTGCTCCTACTTGGGGCCCCTGCTTCTCAAATCTTCAGCGACCGCGCTCCTCTAGTCCAGGCAGACGTCTACAGGCAAGTATTCCTTCTCTTAAAGGGGCACTACACCTGGTATACATGGGTTTCCCCAGGGACTCTAAACCCTCTATTCTCTGTCTCCACAGCACCTTCTCTATTAGGAGGTTCTTATCCTTGCATTTGCCGGATTCCCCTGCCTCAGCAAAAA
  5   1   2       bld Tbd5                            IMAGE:3581754.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGAATGTCTTAATTATTCAATGCAGGGACCTGACACCCGCACAGAGCAAAACCTCCAATCCGTATATAAAGTGTTATTTGCTCCCTGATAAAACTGCTCAGGGGAAGAGGAAATCAAAGTTGAAAAAGAAGACTCTGGAACCGTTCTTTAATGAGACCCTAAAATACAAGGTGGAATGGTCAGAGTTGCAAAGCAGAGTCCTCAATCTGTCTGTGTGGCACAGGGGGTCACTGGGAAGAAACCTTTTTCTTGGTGAGGTGGAAGTGGATCTTGTGTCCTGGGACTGGAGCAAAACTCAGCCAGCCTGGTACAATCTCCAGCCAAGGACTCCCCTATCTNCAGAATTCCTTTGCAGTCGAGGTCGGCTTAGAGTTGCTGTGAAATATGTTCCACAAGGGGCAGAAAGCTTANGGC
  5   1   2      ests                                 Xl3.1-XL017a02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTCCAGAATTCCTTTGCAGTCGAGGTCGGCTTAGAGTTGCTGTGAAATATGTTCCACAAGGGGCAGAAGGCTTAGGGCTTCCTCCCACTGGTGAACTCCATGTTTGGATTAAGGAGGCACAGCAACTTGTACCTCACAAGGCTGGAAATGTCAGCACTTTTGTAAAGTGCTTTGTGCTTCCCGATTCCAGTCCATCCAACATACAGCGCACACGTGTGATCCCACATAGCTTGCATCCAGTGTTTAACCACACCATGGTGTATGATGGCTTCAGTGGAGAAGACCTCAAAGAAGCCTGTGTTGAATGCATCATTTGGGACCAGGGTAAAATAGGAAGTCGACCTCTTGGGGGCATTCGCCTCAGCACCGGAAAAGGAAGCAGCTATGAAAACAGTGTCAACTGGATGGATTCCACAGAAGAGGAGAAGGCATTCTGGAAATCAGTTATAAATAATCCTGCGGAGTGGGCAGAGATTGTGCTGCCACTAAGACAAAATTTAACTTCACGTTGACTGATTAATACCAGTTAAAGAGGTGACCTACAATGAAGATTACCCCAGACATAAATCATACAACCTAGGCTGAGGATAGACCCTTACTCTGGGTTTGCTGAAAACTGTTACACATAATGCCAAGTGGAACCGTTTGTGAATGAACTTGACCCTGCAAAATAAAAGGGTTACCTGTATGGCAGTTTCTATATTTTTTCAAATGATGCTTGATGTCAATGTTATTGATAAGGAAGAAAGCTAGAAATTTGTCTATTTTTGTCCAGATGGTAATCCAGGGAAAAAGCTTGATGCTTCAGTAGAGCTAACTACCCTCACTTAACACTGACTGGGAGTAATTAGCCTATGTGATCTTCGGAAAGAAGAAAATCGTAAGAAGTGACATCTGAATTCCAGAAGAATTCCTAAGCCCCAGAAAAGCAAGAATATTACACTCAAAAAAGTGGGATGCAGTCATACCAATTATAAAGGCCAGAACATGGCAAATATGTATACAAATTATTCTAATAAAGAATATGGCAGTTTCTGAGGAGATATTTACAGCAAAGCTGGAGAGTGTGTTTTGAGCACACTTGCACAATAGCTGCAAAATGA
                                                  Xl3.1-CHK-1012698199                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------------------------------------GTGAAATATGTTCCACAAGGGGCAGAAGGCTTAGGGCTTCCTCCCACTGGTGAACTCCATGTTTGGATTAAGGAGGCACAGCAACTTGTACCTCACAAGGCTGGAAATGTCAGCACTTTTGTAAAGTGCTTTGTGCTTCCCGATTCCAGTCCATCCAACATACAGCGCACACGTGTGATCCCACATAGCTTGCATCCAGTGTTTAACCACACCATGGTGTATGATGGCTTCAGTGGAGAAGACCTCAAAGAAGCCTGTGTTGAATGCATCATTTGGGACCAGGGTAAAATAGGAAGTCGACCTCTTGGGGGCATTCGCCTCAGCACCGGAAAAGGAAGCAGCTATGAAAACAGTGTCAACTGGATGGATTCCACAGAAGAGGAGAAGGCATTCTGGAAATCAGTTATAAATAATCCTGCGGAGTGGGCAGAGATTGTGCTGCCACTAAGACAAAATTTAACTTCACGTTGACTGATTAATACCAGTTAAAGAGGTGACCTACAATGAAGATTACCCCAGACATAAATCATACAACCTAGGCTGAGGATAGACCCTTACTCTGGGTTTGCTGAAAACTGTTACACATAATGCCAAGTGGAACCGTTTGTGAATGAACTTGACCCTGCAAAATAAAAGGGTTACCTGTATGGCAGTTTCTATATTTTTTCAAATGATGCTTGATGTCAATGTTATTGATAAGGAAGAAAGCTAGAAATTTGTCTATTTTTGTCCAGATGGTAATCCAGGGAAAAAGCTTGATGCTTCAGTAGAGCTAACTACCCTCACTTAACACTGACTGGGAGTAATTAGCCTATGTGATCTTCGGAAAGAAGAAAATCGTAAGAAGTGACATCTGAATTCCAGAAGAATTCCTAAGCCCCAGAAAAGCAAGAATATTACACTCAAAAAAGTGGGATGCAGTCATACCAATTATAAAGGCCAGAACATGGCAAATATGTATACAAATTATTCTAATAAAGAATATGGCAGTTTCTGAGGAGATATTTACAGCAAAGCTGGAGAGTGTGTTTTGAGCACACTTGCACAATAGCTGCA
  3   1   2      seed Neu7      in                         XL017a02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCTGGTACAATCTCCAGCCAAGGACTCCCCTATCTCCAGAATTCCTTTGCAGTCGAGGTCGGCTTAGAGTTGCTGTGAAATATGTTCCACAAGGGGCAGAAGGCTTAGGGCTTCCTCCCACTGGTGAACTCCATGTTTGGATTAAGGAGGCACAGCAACTTGTACCTCACAAGGCTGGAAATGTCAGCACTTTTGTAAAGTGCTTTGTGCTTCCCGATTCCAGTCCATCCAACATACAGCGCACACGTGTGATCCCACATAGCTTGCATCCAGTGTTTAACCACACCATGGTGTATGATGGCTTCAGTGGAGAAGACCTCAAAGAAGCCTGTGTTGAATGCATCATTTGGGACCAGGGTAAAATAGGAAGTCGACCTCTTGGGGGCATTCGCCTCAGCACCGGAAAAGGAAGCAGCTATGAAAACAGTGTCAACTGGATGGATTCCACAGAAGAGGAGAAGGCATTCTGGAAATCAGTTATAAATAATCCTGCGGAGTGGGCAGAGATTGTGCTGCCACTAAGACAAAATTTAACTTCACGTTGACTGATTAATACCAGTTAAAGAGGTGACCTACAATGAAGATTACCCCAGACATAAATCATACAACCTAGGCTGAGGATAGACCCTTACTCTGGGTTTGCTGAAAACTGTTACACATAATGCCAAGGGAACCGTTTG
  3   1   2       bld Tbd7      in                         XL090c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGNACTCCCCTATCTCCAGAATTCCTTTGCAGTCGAGGTCGGNTTAGAGTTNCTGTGAAATATGTTCCACAAGGGGCAGAAGGCTTAGGGCTTCCTCCCACTGGTGAACTCCATGTTTGGATTAAGNAGGCNCAGCAACTTGTACCTCACAAGGCTGNAAATGTCAGCACTTTTGTAAAGTGCTTTGTGCTTCCCGATTCCAGTCCATCCAACATACAGCGNACANGTGTGATCCCACATAGCTTGCATCCAGTGTTTAACCACACCATGGTGTATGATGGCTTCAGTGGAGAAGACCTCAAAGAAGCCTGTGTTGAATGCATCATTTGGGACCAGGGTAAAATAGGAAGTCGACCTCTTGGGGGCATTCGCCTCAGCACCGGAAAAGGAAGCAGCTATGAAAACAGTGTCAANTGGATGGATTCCACAGAAGAGGAGAAGGCATTACTGGAAATCAGTTATAAATNATCCTGCGGAGTGGGCAGAGATTGNGCTGCCNCTAAGACNNAATTTANCTTCACGTTGACTGATNAAGACCAGTTAAAGCAGGTGACCTGACAATNNAGATNACCCCAGACATAAATCANACAACCTAGNCTGAGGATAGACCCTTACNCTGGGTTTGCTGAAAACTGTTACACATAATGCCACAGTGGAAC
  3   1   2       bld Tbd7                                 XL101a09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTAGAGTTGCTGTGAAATATGTTCCACAAGGGGCAGAAGGCTTAGGGCTTCCTCCCACTGGTGAACTCCATGTTTGGATTAAGGAGGCACAGCAACTTGTACCTCACAAGGCTGGAAATGTCAGCACTTTGTAAAGTGCTTTGTGCTTCCCGATTCCAGTCCATCCAACATACAGCGCACACGTGTGATCCCACATAGCTTGCATCCAGTGTTTAACCACACCATGGTGTATGATGGCTTCAGTGGAGAAGACCTCAAAGAAGCCTGTGTTGAATGCATCATTTGGGACCAGGGTAAAATAGGAAGTCGACCTCTTGGGGGCATTCGCCTCAGCACCGGAAAAGGAAGCAGCTATGAAAACAGTGTCAACTGGATGGATTCCACAGAAGAGGAGAAGGCATTCTGGAAATCAGTTATAAATAATCCTGCGGAGTGGGCAGAGATTGTGCTGCCATTAAGACAAAATTTAACTTCACGTTGACTGATTAATACCAGTTAAAGAGGTGACCTACAATGAAGATTACCCCAGACATAAATCATACAACCTAGGCTGAGGATAGACCCTTACTCTGGGTTTGCTGAAAACTGTTACACATAATGCCAAGGGAACCGTTTG
  3   1   2       bld Neu7                                 XL026m12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGAGTTGCTGTGAAATATGTTCCACAAGGGGCAGAAGGCTTAGGGCTTCCTCCCACTGGTGAACTCCATGTTTGGATTAAGGAGGCACAGCAACTTGTACCTCACAAGGCTGGAAATGTCAGCACTTTTGTAAAGTGCTTTGTGCTTCCCGATTCCAGTCCATCCAACATACAGCGCACACGTGTGATCCCACATAGCTTGCATCCAGTGTTTAACCACACCATGGTGTATGATGGCTTCAGTGGAGAAGACCTCAAAGAAGCCTGTGTTGAATGCATCATTTGGGACCAGGGTAAAATAGGAAGTCGACCTCTTGGGGGCATTCGCCTCAGCACCGGAAAAGGAAGCAGCTATGAAAACAGTGTCAACTGGATGGATTCCACAGAAGAGGAGAAGGCATTCTGGAAATCAGTTATAAATAATCCTGCGGAGTGGGCAGAGATTGTGCTGCCACTAAGACAAAATTTAACTTCACGTTGACTGATTAATACCAGTTAAAGAGGTGACCTACAATGAAGATTACCCCAGACATAAATCATACAACCTAGGCTGAGGATAGACCCTTACTCTGGGTTTGCTGAAAACTGTTACACATAATGCCAAGGGAACCGTT
  3   1   2       bld Tbd7      in                         XL077h09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGCATTCGCNTCAGCACCGGAAAAGGAAGCAGCTATGAAAACAGTGTCAACTGGATGGATTCCACAGAAGAGGAGAAGGCATTCTGGAAATCAGTTATAAATAATCCTGCAGAGTGGGCAGAGATTGTGCTGCCACTAAGACAAAATTTAACTTCACGTTGACTGATTAATACCAGTTAAAGAGGTGACCTACAATGAAGATTACCCCAGACATAAATCATACAACCTAGGCTGAGGATAGACCCTTACTCTGGGTTTGCTGAAAACTGTTACACATAATGCCAAGTGGAACCGTTTGTGAATGAACTTGACCCTGCAAAATAAAAGGGTTACCTGTATGGCAGTTTCTATATTTTTTCAAATGATGCTTGATGTCAATGTTATTGATAAGAAAGAAAGCTAGAAATTTGTCTATTTTTGTCCANANNGNAATCCAGGGAAAAGCTTGATGCTTCAGTAGAGCTAACTACCCTCACTTAACACTGACTGGGAGTAATTAGCCTATGTGATCTTCGGAA
  3   1   2       bld Ga18      in                       xlk59n24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CNCAGCNCCGGAAAAGGAAGCAGCTATGAAAACAGTGTCAACTGGATGGATTCCACAGAAGAGGAGAAGGCATTCTGGAAATCAGTTATAAATNANCNGCGGAGTGGGCAGAGATTGTGCTGCCACTAAGACAAAATTTAACTTCACGTTGACTGATTAATACCAGTTAAAGAGGTGACCTACAATGAAGATTACCCCAGACATAAATCATACAACCTAGGCTGAGGATAGACCCTTACTCTGGGTTTGCTGAAAACTNTTACACATAATGCCAAGTGGAACCGTTTGTGAATNNACT
  5   1   2       add Tbd7      out                        XL082m10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATCATACAACCTAGGCTGAGGNTAGNACCCTTACTCTGGGTTTGCTGAAAACTGTTACACATAATGCCAAGTGGAACCGTTTGTGAATGAACTTGACCCTGCAAAATAAAAGGGTTACCTGTATGGCAGTTTCTATATTTTTTCAAATGATGCTTGATGTCAATGTTATTGATAAGGAAGAAAGCTAGAAATTTGTCTATTTTTGTCCAGATGGTAATCCAGGGAAAAAGCTTGATGCTTCAGTAGAGCTAACTACCCTCACTTAACACTGACTGGGAGTAATTAGCCTATGTGATCTTCGGAAAGAAGAAAATCGTAAGAAGTGACATCTGAATTCCAGAAGAATTCCTAAGCCCCAGAAAAGCAAGAATATTACACTCAAAAAAGTGGGATGCAGTCATACCAATTATAAAGGCCAGAACATGGCAAATATGTATACAAATTATTCTAATAAAGAATATGGCAGTTTCTGAGGAGATATTTACAGCAAAGCTGGAGAGTGTGTTTTGAGCACACTTGCACAATAGCTGCAAAATGATAAAT
  5   1   0       add Tbd7                                 XL098d19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGCCTGAAAACTGTTACACATAATGNCCAAGTGGAACCGTTTGTGAATGAACTTGACCCTGCAAAATAAAAGGGTTACCTGTATGGCAGTTTCTATATTTTTTCAAATGATGCTTGATGTCAATGTTATTGATAAGGAAGAAAGCTAGAAATTTGTCTATTTTTGTCCAGATGGTAATCCAGGGAAAAGCTTGATGCTTCAGTAGAGCTAACTACCCTCACTTAACACTGACTGGGAGTAATTAGCCTATGTGATCTTCGGAAAGAAGAAAATCGTAAGAAGTGACATCTGAATTCCAGAAGAATTCCTAAGCCCCAGAAAAGCAAGAATATTACACTCAAAAAAGTGGGATGCAGTCATACCAATTATAAAGGCCAGAACATGGCAAATATGTATACAAATTATTCTAATAAAGAATATGGCAGTTTCTGAGGAGATATTTACAGCAAAGCTGGAGAGTGTGTTTTGAGCACACTTGCACAATAGCTGCAAAATGATAAATAAGAATAAAATATTTTTAGGGGTGAATTATAAATATATTATTTGGAAATTATTACTTTGGAACTATTACCCTATGCAATATTGTACACAAAGCAAAGCTGAATCATTGCCAAAGTAACACAATCTCACAAGCAATTATCGAGGAAACACAACAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)