Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk119j12ex.5                         6 END     6          40      100                TGF-beta family member lefty-A [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk71b13ex.3                          2 PI      84         89      641                TGF-beta family member lefty-B [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012838616 Xl3.1-xlk141c05ex.3.5 - 15 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-CHK-1012722047                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAAAACCAGAACTTGTCTTGTTCACTCTCAACCTTGATGAGCATGGGGCCCGTGGAGACTGTTCAGCATCAGGTGCTAAAAAAGACAACATCTGCTGCAGAGAGGAATATTTCATTAACTTTCGGGAGCTTACCTGGACACAGTACTGGATTATTGAGCCAGCAGGATATAATGCTTTTCGGTGCGCAGGAAGTTGCAAGCAACCAAAGTACCCCTTGTCTCATCACTATGGAGAGAGAATGTGCGCCGTGGTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGTTGCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGGCCAAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGGTGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGCACAGGGCAGxxxCCCTGCTTGxxxCCxACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTCGGCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAACAGAAACTTTAATCAAACAATAAAGTTTGTGAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     4     2     4     2     5     3     5     3     5     2     5     2     5     3     5     4     5     4     5     4     5     4     5     3     5     3     5     3     5     4     6     4     6     5     7     6     8     5     8     7     8     7     8     7     8     8     9     8     9     9     9     7     9     7     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9    10     9    10     9    10     9    10     8    10     8    10     8    10     7    10     7    10     7    10     7    10     7    10     7    10     3    10     7    10     8    10     8    10     8    10     7    10     3    10     5    12     6    12     6    12     6    12     6    12     6    12     6    12     6    12     6    12     6    13     7    14     7    14     7    14     8    13     8    13     8    13     8    13     7    13     8    13     8    13     8    13     8    13     8    13     8    13     8    13    11    12     6    11     2     3     2     2     2     2
  5   1   2       e50                              Xl3.1-xlk141c05ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTGATGTGACC------------ACTGGATGAAAAGTGGCGGACATTCATCGATGCACTTAGAGATCCACGTGGATGGTGAACGACATGGAAGTCATGCATCTGAGATGGCAAAAATGGTTCGTTTCACCACCCAGAGCCCATCAGACAACTCTCTGGGAAAACCAGAACTTGTCTTGTTCACTCTCAACCTTGATGAGCATGGGGCCCGTGGAGACTGTTCAGCATCAGGTGCTAAAAAAGACAACATCTGCTGCAGAGAGGAATATTTCATTAACTTTCGGGAGCTTACCTGGACACAGTACTGGATTATTGAGCCAGCAGGATATAACGCTTTTCGGTGCGCAGGAAGTTGCAAGCAACCAAAGTACCCCTTGTCTCATCACTATGGAGAGAGAATGTGCGCCGTGGTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGTTNCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGNCCAAACGAAGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGGTGC------------AAAAAAGTTGNCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAA------------------------GCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGNTTAACCTAGNGCAAATATCACCGCTCCTTCTGG------------------------CCGATCTCAGTGATCAGAATGGCAGAATGATAGAAG
  5   1   2       e50                              Xl3.1-xlk141c05ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGATTATTGAGCCAGCAGGATATAATGCTTTTCGGTGCGCAGGAAGTTNCAAGCAACCAAAGTACCCCTTGTCTCATCACTATGGAGAGAGAATGTGCGCCGTGGTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGTTGCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGGCCAAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGGTGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGCACAGGGCAGATGCCCTGCTTGCACCCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTCGGCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAACAGAAACTTTAATCAAACAATAAAGTTTGTGATGAA
                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-009     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-009     NP_722840.1 CG16987-PB, isoform B [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                          PROTEIN --- Sp ---- 2e-018     NP_001123281.1 lefty [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 7e-021     NP_034224.1 endometrial bleeding associated factor [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Bt ---- 5e-022     XP_613627.3 PREDICTED: similar to signaling molecule LEFTY-A [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                PREDICTED - Cf ---- 4e-023     XP_547508.2 PREDICTED: similar to left-right determination, factor B preproprotein [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Hs ---- 1e-024     NP_003231.2 endometrial bleeding associated factor preproprotein; transforming growthfactor, beta-4 (endometrial bleeding-associated factor; LEFTY A) [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 2e-033     NP_001071997.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Gg ---- 4e-040     NP_990095.1 lefty [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dr ---- 4e-053     NP_571035.1 lefty1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xt ---- 8e-069     AAI67366.1 Unknown (protein for MGC:135826) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Xl ---- 9e-075     NP_001079214.1 TGF-beta family member lefty-A [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-xlk141c05ex.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------------------------------ATG------------------------------------------------------ATG------------------------ATG------------------TGA---ATG------------------------------------------------------------------------TAG------------------------------------------------------------------------------------TAA---------------------------------ATGTAA------------------------------------------------------------------TAA---------------------------------------ATG---------------------------------------TGATGA---------TAGTAA---------------ATG---TAA------------------------------------TAA---------------------------------ATG------TGATAG---------------------------------------TAG---------------TGA------------------------------------------------------------------TGA---------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       e50                              Xl3.1-xlk141c05ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTGATGTGACC------------ACTGGATGAAAAGTGGCGGACATTCATCGATGCACTTAGAGATCCACGTGGATGGTGAACGACATGGAAGTCATGCATCTGAGATGGCAAAAATGGTTCGTTTCACCACCCAGAGCCCATCAGACAACTCTCTGGGAAAACCAGAACTTGTCTTGTTCACTCTCAACCTTGATGAGCATGGGGCCCGTGGAGACTGTTCAGCATCAGGTGCTAAAAAAGACAACATCTGCTGCAGAGAGGAATATTTCATTAACTTTCGGGAGCTTACCTGGACACAGTACTGGATTATTGAGCCAGCAGGATATAACGCTTTTCGGTGCGCAGGAAGTTGCAAGCAACCAAAGTACCCCTTGTCTCATCACTATGGAGAGAGAATGTGCGCCGTGGTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGTTNCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGNCCAAACGAAGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGGTGC------------AAAAAAGTTGNCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAA------------------------GCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGNTTAACCTAGNGCAAATATCACCGCTCCTTCTGG------------------------CCGATCTCAGTGATCAGAATGGCAGAATGATAGAAG
                                                  Xl3.1-CHK-1012717366                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGACCCAGGCT------------TGAAAAGTGGCGGACATTCATCGATGCACTTAGAGATCCACGTGGATGGTGAACGACATGGAAGTCATGCATCTGAGATGGCAAAAATGGTTCGTTTCACCACCCAGAGCCCATCAGACAACTCTCTGGGAAAACCAGAACTTGTCTTGTTCACTCTCAACCTTGATGAGCATGGGGCCCGTGGAGACTGTTCAGCATCAGGTGCTAAAAAAGACAACATCTGCTGCAGAGAGGAATATTTCATTAACTTTCGGGAGCTTACCTGGACACAGTACTGGATTATTGAGCCAGCAGGATATAACGCTTTTCGGTGCGCAGGAAGTTGCAAGCAACCAAAGTACCCCTTGTCTCATCACTATGGAGAGAGAATGTGCGCCGTGGTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGTTNCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGAT------------AxxxAxGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGGTGCTGCTGC------------GTTGNCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGNACA------------CTGCTTGCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGNTTAACCTAGNGCAAATATCACCGCTCC------------------------CAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGNATTTA
  5   1   2      seed Ga18      in                      xlk141c05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTGATGTGACCCAGGCTGNNNTTACTGGATGAAAAGTGGCGGACATTCATCGATGCACTTAGAGATCCACGTGGATGGTGAACGACATGGAAGTCATGCATCTGAGATGGCAAAAATGGTTCGTTTCACCACCCAGAGCCCATCAGACAACTCTCTGGGAAAACCAGAACTTGTCTTGTTCACTCTCAACCTTGATGAGCATGGGGCCCGTGGAGACTGTTCAGCATCAGGTGCTAAAAAAGACAACATCTGCTGCAGAGAGGAATATTTCATTAACTTTCGGGAGCTTACCTGGACACAGTACTGGATTATTGAGCCAGCAGGATATAACGCTTTTCGGTGCGCAGGAAGTTGCAAGCAACCAAAGTACCCCTTGTCTCATCACTATGGAGAGAGAATGTGCGCCGTGGTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGNTNNACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGANNCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTNCTGGGAGNTNNNCTTTAACAGCAACTGAAGGGANNNCGTTTGNCCAAACGAATNNNNTGTNTNCCCTACTATCANC
  5   1   2       bld Ga18      in                      xlk157a22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNCATCAGACAACTCTCTGGGAAAACCAGAACTTGTCTTGTTCACTCTCAACCTTGATGAGCATGGGGCCCGTGGAGACTGTTCAGCATCAGGTGCTAAAAAAGACAACATCTGCTGCAGAGAGGAATATTTCATTAACTTTCGGGAGCTTACCTGGACACAGTACTGGATTATTGAGCCAGCAGGATATAATGCTTTTCGGTGCGCAGGAAGTTGCAAGCAACCAAAGTACCCCTTGTCTCATCACTATGGAGAGAGAATGTGCGCCGTGGTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGTTNCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTNNNNNAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGGTGCTGCTGCNNATTAAAAAAAGTTGNCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGNACAGGNCAGATNNCCCTGCTTGCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGNTTAACCTAGNGCAAATATCACCGCTCCTTCTGGGANTTNTAAAAGCANNGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGNATTTAGAGAA
  5   1   2       e50                              Xl3.1-xlk141c05ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGATTATTGAGCCAGCAGGATATAATGCTTTTCGGTGCGCAGGAAGTTNCAAGCAACCAAAGTACCCCTTGTCTCATCACTATGGAGAGAGAATGTGCGCCGTGGTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGTTGCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGGCCAAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGGTGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGCACAGGGCAGATGCCCTGCTTGCACCCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTCGGCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAACAGAAACTTTAATCAAACAATAAAGTTTGTGATGAA
                                                  Xl3.1-CHK-1012693236                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATTGAGCCAGCAGGATATAATGCTTTTCGGTGCGCxGxAAGTTGNAAGCAACCAAAGTACCCCTTGTCTCATCACTATGGAGAGAGAATGTGCGCCGTGGTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGTTGCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGGCCAAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGNNGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGCACAGGGxxxxxxCCCTGCxTxxxxCCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTCGGCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAACAGAAACTTTAATCAAACAATAAAGTTTGT
  3   1   2       bld Ga18      in                      xlk141c05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCNCTCTCNNCCTTGATGNNCATGGGGCCCGTNGNNNNCTNNTCAGCATCAGGTNCTAAAAAAGNNAACNTCTNCTGCAGAGNGNAATNTTTCATTAACTTTCGGGANCTTACCTGGACACAGTACTGGATTATTGAGCCAGCAGGATATAACGCTTTTCGGTGCGCAGGAAAGTTGNAAGCANNCAAANTACCCCTTGTCTCATCNCTATGGAGAGAGAATGTGCGCCGTGNTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGNTTGCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGNCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGGCCAAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGGTGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGCACANGGCAGATGCCCCTGCTTGCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTCGNCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAACAGAA
  3   1   2       bld Ga18 5g3  out                      xlk74k11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNNCTCTCANNTGATGANCANGGGGCCCGNGAGACTNNTCAGCNTCAGNTNCTAAAAAAGACAACNTCTGCTGNAGAGAGGANNNTTCNTTAACTTTCGGGAGCTTACCTGGACACAGTNCTGGATTATTGAGCCAGCAGGATATAATGCTTTNCGGTGCGCAGGAAGTTGNAAGCANCCAAANTNCCCCTTGTCTCATCACTATGGAGAGAGAATGTGCGCCGTGGTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGANTTCCCCAATATGATTGTGGAAAAATGCGGTTGCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGNCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGGCCAAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGNNGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGCANNGNCAGATGCCCCTGCTTGCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTNNNCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAANAGAANCTTTA
  3   1   2       bld Ga18      in                      xlk157a22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CNNNGGNCNNNNAGACTNTTCAGCATCAGNTGCTAAAAAAGACANCNNCTNCTGCANAGNGNAATNTTTCATTAACTTTNNGGANCTTACCTGGACACAGTACTGGATTATTGAGCCAGCAGGATATAATGCTTTTCGGTGCGCAGGAANTTNCAAGCAACCAAAGTACCCCTTGTCTCATCACTATGNAGAGAGAATGTGCGCCGTGGTGGAAANTNNCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGTTGCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGNCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGGCCAAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGNNGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGCACNGNCAGATGCCCCTGCTTGCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTTNNCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAACAGAANCNNNATCANNC
  3   1   2       bld Ga18 5g3  out                     xlk160j12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ANCNAAANNNNCCCTNNCTCATNNCTATGAGNNAGNATGTGCGCCGNNNTNNAAANNNNCCCNCTGCCCGTTATGTNCCTGGTCAAAAAGGGAGACTACNCGGAAATCGNAGTGGCAGANTTNCCCAATATGATTGTGGAAAAATGNGNNTGCACAATGGANAATATCGCTATNATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGGCCAAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGNNGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGCACAGGGCAGATNNCCCTGCTTGCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTCGNCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAACAGANC
  3   1   2       bld Ga18 5g3  out                     xlk119j12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCNCTATGNNNNNNGAATGTGCGCCGNNGTGNAAAGTGCCCCNCTGCCCGTTATGTNCCTGNTCAAAAAGGAGNCTACNCGGAAATCGAAGTGGCAGANTTCCCCAATATGATTGTGGAAAAATGNGGTTGCACAATGGACAATATCGCTATAATATGAGGAATGNCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGGCCAAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGNNGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGCACNGGCAGATGCCCCTGCTTGCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTTGNCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAANAGAA
  3   1   2      seed DMZ  5g3  out                        xl329m19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGCGCCGTGGTGGAAAGTGCCCCACTGCCCGTTATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGTTGCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATCTGCTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAAGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGGCCAAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGGTGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAATGGATGTGGAAGGCACAGGGCAGATGCCCCTGCTTGCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTCGGCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAACAGA
  3   1   2       add DMZ                                 rxl249e04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GANTACACGGAAATNGAAGTGGCAGAATTCCCCAATATGATTGTGGAAAAATGCGGTTGCACAATGGACAATATCGCTATAATATGAGGAATGGCAGCACTGAGTTCTTGCAGATNTGNTGTGTGTAGTACTTGCAAATGTGCTCTTAGTANGCAGGCATGTCTGTAGTGCTGGCAGGAGCCCATTATATATAGTAGAACTGTGCACCTTTTGGCCTCTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTNAACAGCAANTGAAGGGATGCCGTTTGNCCAAACGAATGTAATGTGTGCCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACNATAGGTGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAATGGATGTGGAAGGCACAGGGCAGATGCCCCTGCTTGCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTNTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGNGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTNGACTCGGCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATCGGANGATCATTGCAGCATATTTTNTCAATTATATATATATACAAAGAAAAC
  3   1   2       bld Ga18 5g3  out                      xlk53m24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCNTNNNANNNNAGTAGNACTNNNNNCCTTTNGNCNNNTCCAGCTGTCAAAAGGGTGCTGGGAGTTGTGCTTTAACAGCAACTGAAGGGATGCCGTTTGGCCCAAACGAATGTAATGTGTGNCCTACTATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGGTGNTGCTGCACATTAAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGCACAGGCAGATNNCCCTGCTTGCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTANCCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTNNNNACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAACAGAANCTT
  3   1   2       bld Ga15 5g3  out                      XL470c19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATCACCATCTTGCCTTACTGACAAGTGTTACTACTATAGGTGCTGCTGCACATTAAAAAAAGTTGCCTTCCCCAGACTTTATCTGCTTCAAAGGGATGTGGAAGGCACAGGGCAGATGCCCCTGCTTGCACCCACCCTGATGAACGCTCTGTTAGTAACTGAACCTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTCGGCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTAAATATA
  5   1   2       bld Ga18      in                      xlk109g10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTAGATCGCGAGCGGCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTCGGCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATtatatatatatataAAGAAAACAGAAACTTTAATCAAACAATAAAGTTTGTGATGAAACTNANaaaaaaaa
  3   1   2       bld Ga18      in                      xlk109g10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTAGATCGCGAGCGGCCACCCTGATGAACGCTCTGTTAGTAACTGAACCATAAACCTATGGTTTAACCTAGTGCAAATATCACCGCTCCTTCTGGGAGTTTATAAAAGCAACGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTCGNCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAANAGANCTTNA
  3   1   2       bld Ga18      in                      xlk113p03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNCGCGACAATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTNGNNNCACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATTATATATATATATAAAGAAAACAGAANCTTTAA
  5   1   2       bld Ga18      in                      xlk113p03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATTTCCGATCTCAGTGATCAGAATGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTCGTTGACTCGGCCACACTGCGGCATGGAGATGGCTCATAAAATATGAATTTGACAGAGGTATTTCTATTGGATGATCATTGCAGCATATTTTTTCAATtatatatatatataAAGAAAACAGAAACTTTAATCAAACAATAAAGTTTGTGATGAAACTATaaaaaaaaaa

In case of problems mail me! (