Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.3300000000000001    0Xl3.1-xl229p03.5                           12 END     3           6       25                Fibroblast growth factor receptor 4 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6954990.5.5                    35 PI      74       1710     2598                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:8528261.5                      18 PI      76       2107     2576                (no blast hit)
     4   0.0    0Xl3.1-xl229p03.5                           12 PI      89       1671     3232                Fibroblast growth factor receptor 4 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012838618 Xl3.1-rxlk71l07ex.3.5 - 47 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                    3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     6     4     6     4     6     5     7     5     7     5     8     5     8     5     8     5     8     5     8     4     7     6     8     5     8     5     8     6     8     6     8     7     8     7     8     7     8     6     8     6     8     7     8     7     8     6     8     7     8     6     8     7     8     6     8     6     7     6     7     6     7     6     7     6     7     7     8     6     7     6     7     7     7     7     7     5     6     5     6     4     5     4     5     3     4     3     3     3     3     3     3     2     3     3     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     4     4     4     4     4     4     4     4     5     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     7     6     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     4     7     7     7     6     6     5     6     4     5     4     5     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     6     4     6     4     6     4     6     5     6     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     7     7     7     7     7     6     6     6     6     6     6     6     6     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     7     5     7     4     5     4     5     4     5     5     6     5     6     5     6     5     7     5     9     5    10     5    10     4    10     3    10     3    10     4    10     3    10     3    10     3    10     4    10     4    10     4    10     4    10     4    10     4    10     4    10     4    10     5    11     4    11     4    11     5    11     6    12     7    14    10    15    10    15    11    15    11    15    11    15    11    15    10    13    10    14    10    14    10    14    10    15    10    15    10    15    10    16    10    16    10    17    11    17    12    17    12    17    12    17    12    17    12    17    13    19    13    19    13    20    14    20    15    20    16    20    16    20    16    20    15    20    14    19    14    19    12    19     9    19    10    19     6    14     6    13     3     6
  5   1   2      ests                              Xl3.1-rxlk71l07ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGATATCACCAAGGTTCCAGATGAACTTTTGTCCTTTAAGGACCTAGTGTCTTGTGCTTATCAGGTTGCCCGTGGCATGGAGTACCTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTGGCAGAAGATAATGTCATGAAGATTGCAGATTTTGGCTTGGCACGAGGGGTTCACGATATTGACTATTACAAGAAAACTAGTAATGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGACAGAGTTTACACCCACCAAAGTGACATTTGGTCATTTGGAGTGTTGACATGGGAGATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATTCCAGTAGAAGAACTATTTAAACTCTTACGGGAAGGACATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTACATGTTGATGAGGGAGTGCTGGCATGCAGTTCCATCTCAGAGACCAACATTTAAACAGCTGGTTGAACAACTGGATAGGATCCTCACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCCTCCTGTGAAGATTCTTCAAGCACATGCTCTTCATCCGATGACTCTGTTTTTGCCCACGATCCAGTGCCATCCTCTCCCTGTGTCTTTAATTACCACAATGTTCACACTCACCTTGGGACTTGAAAACAAAGGAGACGGTTTGCCTGTATTGGGAGATCTGGACAATGTAAAACAGAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATATAAAAAAAAAGCCATATGCGGTATTATGAACTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGAAAAATCCAAGCCAGTTTCAAATCGCTGGTACAGCGGATGCATAGCACTGAAAGCCCAAAGCCACCCCGGTCCGTGACGAATGTCGCCTTGCTCCAGATTCCAAAGGTCTAGAGATGCAGCCCCAAGAGATGGACAAAAGTAGCACTGTGATCCCACTTGCCCTCCAAGGGCACATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATATTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTAAAAAAAAGTTACTTTTAATATAAAGATTTTAAATTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGCCAACTGTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------C
                                               BLH ATG     318     428                                                                               
                                               BLH MIN     318     349                                                                               
                                               BLH OVR     249      20                                                                               
                                               ORF LNG     249      90                                                                               
                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 6e-113     NP_001024723.1 EGg Laying defective family member (egl-15) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 9e-126     NP_732287.1 CG7223-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN --- Sp ---- 2e-140     NP_999702.1 fibroblast growth factor receptor [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ag ---- 1e-148     XP_562866.3 AGAP003108-PA [Anopheles gambiae str. PEST] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 6e-150     Q4H3K6 Fibroblast growth factor receptor precursor (Ci-FGFR) [Ciona intestinalis]  =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - ?? ---- 0          XP_001789758.1 PREDICTED: fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 0          NP_032037.2 fibroblast growth factor receptor 4 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 0          NP_998812.1 fibroblast growth factor receptor 4 isoform 1 precursor [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Bt ==== 0          XP_602166.3 PREDICTED: similar to fibroblast growth factor receptor 4 [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PREDICTED - Cf ---- 0          XP_546211.2 PREDICTED: similar to Fibroblast growth factor receptor 4 precursor (FGFR-4) [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Gg ---- 0          NP_990840.1 tyrosine kinase (cek2) [Gallus gallus] --------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                    PROTEIN --- Dr ---- 0          NP_571505.1 fibroblast growth factor receptor 4 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          AAI61582.1 Fibroblast growth factor receptor 4 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          NP_001081187.1 FGF receptor 4a [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-rxlk71l07ex.3.5                                                                                                                                                                                                                                     ATG---------TGA------------------------------------------------------------------------TAG------TGAATG------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------TAATAG------------------------------------------TGA---ATG------------------------------------------------TAA---------------------------ATG---------------------------------------------------------------------TAG------------------------------------TGA------------------------TGA------TAGTAA------TAA------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------ATG---------TAAATG------------------------------------------------------------------------------TGA---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2       add DMZ                                  xl303p05.5p                                                                                                                                                                                                                                                                                                                                                                                         TTTGCCCATACGCACCANTCATGTCTGGATCCATAANAAGAAGCTATACTGCCATGCANAACTTTCCCAGGTTGCTGTTGGGTGTCCTGTTTGTTGCCACATTAAGCTCGTGCAGGCCAGCGTTATCCGAAGATGAAGCCAACTGGAAAGGCCAAACAGAAACATCTGAGTCTGAGGTTGAAGAACATCTGCTATTGGACCCTGGGAATGCTCTGCGGCTGTTTTGTGACACCAACCAAAGCANCAGTATCAACTGGTACCGCGAGCAGGAGCGTTTGTTGTCAGGAG
  5   1   2       bld Ga15      out                      XL488e11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAGAATTGGTGGGATCCAGATTCGCCACCAACACTGGAGCCTGGTAATGGAGAGTGTGGTTCCATCAGACCGTGGCAACTACACTTGTGTGGTGGAGAACAGAGTTGGCAGCCTCACATATACCTACTTTCTGGATGTGCTCGAGAGGTCATCTCACCGGCCTATCCTACAGGCTGGCCTTCCAGCAAACACCACAGCACGTGTAGGTAGCGATGTTGAATTCTACTGCAAAGTATACAGTGATGCTCAGCCACATATCCAATGGCTTAAACACATTGAAGTGAATGGAAGCCATTTTGGCCCTGATGACTTTCCATATGTACAAGTGCTGAAGACAGCAGATATTAACACTTCGGATGTAGAGGTGCTTCACCTACGGAATATCACTATGGAAGATGCAGGGGAGTACACATGTCTGGCGGGCAATTCTATTGGTCTTTCTCATCAGTCTGCTTGGCTGACTGTGCTTCCAAATGAAGATTTCCTTGAGCAAGCCGAGCCAGCAGAGTCAAGATATATGGACATAATAATATACACTTCTGGATTCCTGGCTGTAGCCATGGCCATCGTGATAGTGATTCTGTGCCGAATGCANACACCCCACAGCAAGCAGACTCTGCAAACGCCAACTGTCCATAAACTGGCAAAGTTCCCCCTCATACGGCANTTCTCTTTGGAG
  3   1   2       bld Gas6                            IMAGE:3473881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGAACACATGAAAGTGAATGGAAGCCGATTTGGTCCTGATGATTTTCCATATGTACAGGTGCTGAAGACTGCAGATATCAACACTTGGGAGGTAGAGGTGCTTCACCTACGGAATATCACTATGGAGGATGCAGGGGAATACACATGTCTGGCGGGCAATTCTATTGGTCTTTCTCATCAGTCTGCTTGGCTGACTGTGCTTTCAAACGAAGATTTCCTTGAGCAAGCTGAGCCAGCAGAGTCAAGATATATGGACATAATAATATACACTTCTGGATTCCTGGCTGTAGCCATGGCCATCGTGATAGTGGTTCTGTGCCGCATGCAGACACCGCACAGCAAGCAGACTCTGCAACCACCAGCTGTTCATAAACTGGCCAAGTTCCCCCTCATACGGCAGTTCTCTTTGGAGTCCAGCTCATCTGGGAAGTCCAGTGCTCCACTGATTCGCATAACTCGTCTCTCCTCAAGCTGTGCCCCCATGCTGCCTGGTGTCATGGAGGTTGAGTTACCACTGGACGCTAAATGGGAGTTCCCTAGAGACAGGCTTGTTCTGGGAAAGCCGCTTGGAGAGGGCTGCTTTGGCCAAGTGGTAAGAGCAGAGGGATATGGAATTGAGAAAGACCGGCCTGAGAAACCAGTTACCGTTGCAGTTAAGATGCTCAAAGATAATGGCACTGACAAGGACTTATCAGATCTGATCTCTGAAATGGAGTTG
  5   1   2       bld Tbd7      in                         XL071i21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTAAACACATCGAAGTGAATGGAAGCCGATTTGGTCCTGATGATTTTCCATATGTACAGGTGCTGAAGACTGCAGATATCAACACTTCGGAGGTAGAGGTGCTTCACCTACGGAATATCACTATGGAGGATGCAGGGGAATACACATGTCTGGCGGGCAATTCTATTGGTCTTTCTCATCAGTCTGCTTGGCTGACTGTGCTTTCAAACGAAGATTTCCTTGAGCAAGCTGAGCCAGCAGAGTCAAGATATATGGACATAATAATATACACTTCTGGATTCCTGGCTGTAGCCATGGCCATCGTGATAGTGGTTCTGTGCCGCATGCAGACACCGCACAGCAAGCAGACTCTGCAACCACCAGCTGTTCATAAACTGGCCAAGTTCCCCCTCATACGGCAGTTCTCTTTGGAGTCCAGCTCATCTGGGAAGTCCAGTGCTCCACTGATTTGCATAACTCGTCTCTCCTCAAGCTGTGCCCCCATGCTGCCTGGTGTCATGGAGGTTGAGTTACCACTGGACGCTAAATGGGAGTTCCCTAGAGACAGGCTTGTTCTGGGAAAGCCGCTTGGAGAGGGCTGCTTTGGCCAAGTGGTAAGAGCAGAGGGATATGGAATTGAGAAAG
  3   1   2      seed Gas6      in                    IMAGE:3474361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATATGTACAGGTGTTGAAGACTGCAGATATCAACACTTCGGAGGTAGAGGTGCTTCACCTACGGAATATCACTATGGAGGATGCAGGGGAATACACATGTCTGGCGGGCAATTCTATTGGTCTTTCTCATCAGTCTGCTTGGCTGACTGTGCTTTCAAACGAAGATTTCCTTGAGCAAGCTGAGCCAGCAGAGTCAAGATATATGGACATAATAATATACACTTCTGGATTCCTGGCTGTAGCCATGGCCATCGTGATAGTGGTTCTGTGCCGCATGCAGACACCGCACAGCAAGCAGACTCTGCAACCACCAGCTGTTCATAAACTGGCCAAGTTCCCCCTCATACGGCAGTTCTCTTTGGAGTCCAGCTCATCTGGGAAGTCCAGTGCTCCACTGATTCGCATAACTCGTCTCTCCTCAAGCTGTGCCCCCATGCTGCCTGGTGTCATGGAGGTTGAGTTACCACTGGACGCTAAATGGGAGTTCCCTAGAGACAGGCTTGTTCTGGGAAAGCCGCTTGGAGAGGGCTGCTTTGGCCAAGTGGTAAGAGCAGAGGGATATGGAATTGAGAAAGACCGGCCTGAGAAACCAGTTACCGTTGCAGTTAAGATGCTCAAAGATAATGGCACTGACAAGGACTTATCAGATCTGATCTCTGAAATGGAGTTGATGAAGGTCATTGGAAA
  5   1   2       bld Tbd7                                 XL101d15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATTCTATTGGTCTTTCTCATCAGTCTGCTTGGCTGACTGTGCTTTCAAACGAAGATTTCCTTGAGCAAGCTGAGCCAGCAGAGTCAAGATATATGGACATAATAATATACACTTCTGGATTCCTGGCTGTAGCCATGGCCATCGTGATAGTGGTTCTGTGCCGCATGCAGACACCGCACAGCAAGCAGACTCTGCAACCACCAGCTGTTCATAAACTGGCCAAGTTCCCCCTCATACGGCAGTTCTCTTTGGAGTCCAGCTCATCTGGGAAGTCCAGTGCTCCACTGATTCGCATAACTCGTCTCTCCTCAAGCTGTGCCCCCATGCTGCCTGGTGTCATGGAGGTTGAGTTACCACTGGACGCTAAATGGGAGTTCCCTAGAGACAGGCTTGTTCTGGGAAAGCCGCTTGGAGAGGGCTGCTTTGGCCAAGTGGTAAGAGCAGAGGGATATGGAATTGAGAAAGACCGGCCTGAGAAACCAGTTACCGTTGCAGTTAAGATGCTCAAAGATAATGGCACTGACAAGGACTTATCAGATCTGATCTCTGAAATGGAGTTGATGAAGGTCATTGGAAAAC
  5   1   2       add Bla1                   IMAGE:3380025-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ggggggggggAAATAAATAATTATAACACTTCTGGGATTCCTGGCTGTAGCCATGGCCATCGTGATAGTGATTCTGTGCCGAATGCAGACACCCCACAGCAAGCAGACTCTGCAAACGCCAACTGTCCATAAACTGGCAAAGTTCCCCCTCATACGGCAGGTGAGAAATATACCTAATATTTACTTTATTCTCATAATCCTAATGCGCCAGTTGCaaaaaaaaaaaaaaa
  5   1   2       add Bla1                            IMAGE:3380025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGGGACATAATAATATACACTTCTGGATTCCTGGCTGTAGCCATGGCCATCGTGATAGTGATTCTGTGCCGAATGCAGACACCCCACAGCAAGCAGACTCTGCAAACGCCAACTGTCCATAAACTGGCAAAGTTCC
  5   1   2      ests                              Xl3.1-rxlk71l07ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGATATCACCAAGGTTCCAGATGAACTTTTGTCCTTTAAGGACCTAGTGTCTTGTGCTTATCAGGTTGCCCGTGGCATGGAGTACCTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTGGCAGAAGATAATGTCATGAAGATTGCAGATTTTGGCTTGGCACGAGGGGTTCACGATATTGACTATTACAAGAAAACTAGTAATGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGACAGAGTTTACACCCACCAAAGTGACATTTGGTCATTTGGAGTGTTGACATGGGAGATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATTCCAGTAGAAGAACTATTTAAACTCTTACGGGAAGGACATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTACATGTTGATGAGGGAGTGCTGGCATGCAGTTCCATCTCAGAGACCAACATTTAAACAGCTGGTTGAACAACTGGATAGGATCCTCACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCCTCCTGTGAAGATTCTTCAAGCACATGCTCTTCATCCGATGACTCTGTTTTTGCCCACGATCCAGTGCCATCCTCTCCCTGTGTCTTTAATTACCACAATGTTCACACTCACCTTGGGACTTGAAAACAAAGGAGACGGTTTGCCTGTATTGGGAGATCTGGACAATGTAAAACAGAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATATAAAAAAAAAGCCATATGCGGTATTATGAACTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGAAAAATCCAAGCCAGTTTCAAATCGCTGGTACAGCGGATGCATAGCACTGAAAGCCCAAAGCCACCCCGGTCCGTGACGAATGTCGCCTTGCTCCAGATTCCAAAGGTCTAGAGATGCAGCCCCAAGAGATGGACAAAAGTAGCACTGTGATCCCACTTGCCCTCCAAGGGCACATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATATTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTAAAAAAAAGTTACTTTTAATATAAAGATTTTAAATTAT
                                                  Xl3.1-CHK-1012688103                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCACCAAGGTTCCAGATGAACTTTTGTCCTTTAAGGACCTAGTGTCTTGTGCTTATCAGGTTGCCCGTGGCATGGAGTACCTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTGGCAGAAGATAATGTCATGAAGATTGCAGATTTTGGCTTGGCACGAGGGGTTCACGATATTGACTATTACAAGAAAACTAGTAATGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGACAGAGTTTACACCCACCAAAGTGACATTTGGTCATTTGGAGTGTTGACATGGGAGATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATTCCAGTAGAAGAACTATTTAAACTCTTACGGGAAGGACATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTACATGTTGATGAGGGAGTGCTGGCATGCAGTTCCATCTCAGAGACCAACATTTAAACAGCTGGTTGAACAACTGGATAGGATCCTCACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCCTCCTGTGAAGATTCTTCAAGCACATGCTCTTCATCCGATGACTCTGTTTTTGCCCACGATCCAGTGCCATCCTCTCCCTGTGTCTTTAATTACCACAATGTTCACACTCACCTTGGGACTTGAAAACAAAGGAGACGGTTTGCCTGTATTGGGAGATCTGGACAATGTAAAACAGAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATAAAAAAAAAAAGCCATATGxGxxxTxxxxAxCTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGAAAAxxCxAAGCCAGTTTCAAATCGCTGGTACAGCGGATGCATAGCACTGAAAGCCxAAxxCCACCCCGGTCCGxxxxxxATGTCGCCTTGCTCCAGATTCCAAxGxxxxAGAGATxxxxxCCCxAxxxxxxGxCAAAAGTAGCACTGTGATCCCACTTGCCCTCCAAGGGCACATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATATTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTAAAAAAAAGTTACTTTTAATATAAAGATTTTAAATTATATCAAA
  5   1   2       bld Em10      in                    IMAGE:7980348.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGGGAAGTCCAGTGCTCCACTGATTCGCATAACTCGTCTCTCCTCAAGCTGTGCCCCCATGCTGCCTGGTGTCATGGAGGTTGAGTTACCACTGGACGCTAAATGGGAGTTCCCTAGAGACAGGCTTGTTCTGGGAAAGCCGCTTGGAGAGGGCTGCTTTGGCCAAGTGGTAAGAGCAGAGGGATATGGAATTGAGAAAGACCGGCCTGAGAAACCAGTTACCGTTGCAGTTAAGATGCTCAAAGATAATGGCACTGACAAGGACTTATCAGATCTGATCTCTGAAATGGAGTTGATGAAGGTCATTGGAAAACACAAAAATATAATAAACTTGCTCGGCGTCAGCACTCAAGAGGGGCCATTATTTGTTATAGTTGAATATGCTTCTAAGGGGAATCTGCGTGAGTTTCTACGTGCCAGGCGCCCTCCCACACCGGAAGATGCCTTTGATATCACCAAGGTTCCAGATGAACTTTTGTCCTTTAAGGACCTAGTGTCTTGTGCTTATCAGGTTGCCCGTGGCATGGAGTACCTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTGGCAGAAGATAATGTCATGAAGATTGCAGATTTTGGCTTGGCACGAGGGGTTCACGATATTGACTATTACAAGAAAACTAGTAATGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGACAGAGTTTACACCCACCAAAGTGACATTTTGGTC
  5   1   2       bld Ga12      in                         XL191a02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGATATCACCAAGGTTCCAGATGAACTTTTGTCCTTTAAGGACCTAGTGTCTTGTGCTTATCAGGTTGCCCGTGGCATGGAGTACCTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTGGCAGAAGATAATGTCATGAAGATTGCAGATTTTGGCTTGGCACGAGGGGTTCACGATATTGACTATTACAAGAAAACTAGTAATGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGACAGAGTTTACACCCACCAAAGTGACATTTGGTCATTTGGAGTGTTGACATGGGAGATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATTCCAGTANAAGAACTATTTAAACTCTTACGGGAAGGACATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTACATGTTGATGAGGGAGTGCTGGCATGCAGTTCCATCTCAGAGACCAACA
  5   1   2       bld Tbd7      in                         XL104o07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAACTTTTGTCCTTTAAGGACCTAGTGTCTTGTGCTTATCAGGTTGCCCGTGGCATGGAGTACCTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTGGCAGAAGATAATGTCATGAAGATTGCAGATTTTGGCTTGGCACGAGGGGTTCACGATATTGACTATTACAAGAAAACTAGTAATGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGACAGAGTTTACACCCACCAAAGTGACATTTGGTCATTTGGAGTGTTGACATGGGAGATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATTCCAGTAGAAGAACTATTTAAACTCTTACGGGAAGGACATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTACATGTTGATGAGGGAGTGCTGGCATGCAGTTCCATCTCAGAGACCAACATTTAAACAGCTGGTTGAACAACTGGATAGGATCCTCACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCCTCCTGTGAAGATTCTTCAAGCACATGCTCTTCATCCGATGACTCTGTTTTTGCCCACGATCCAGTGCCATCCTCTCCCTGTGTC
  5   1   2       bld Neu1      in                        Neu1-8F11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTTGTCCTTTAAGGACCTAGTGTCTTGTGCTTATCAGGTTGCCCGTGGCATGGAGTACCTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTGGCAGAAGATAATGTCATGAAGATTGCAGATTTTGGCTTGGACGAGGGGTTCACGATATTGACTATTACAAGAAAACTAGTAATGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGACAGAGTTTACACCCACCAAAGTGACATTTGGTCATTTGGAGTGTTGACATGGGAGATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATTCCAGTAGAAGAACTATTTAAACTCTTACGGGAGGACATC
  5   1   2       bld Ga15      in                       XL472f23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCGGGCAGCCAGAAATGTTCTTGTGGCAGAAGATAATGTCATGAAGATTGCAGATTTTGGCTTGGCACGAGGGGTTCACGATATTGACTATTACNAGAAAACTAGTAATGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGACAGAGTTTACACCCACCAAAGTGACATTTGGTCATTTGGAGTGTTGACATGGGAGATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATTCCAGTAGAAGAACTATTTAAACTCTTACGGGAAGGACATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTACATGTTGATGAGGGAGTGCTGGCATGCAGTTCCATCTCAGAGACCAACATTTAAACAGCTGGTTGAACAACTGGATAGGATCCTCACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCCTCCTGTGAAGATTCTTCAAGCACATGCTCTTCATCCGATGACTCTGTTTTTGCCCACGATCCAGTGCCATCCTCTCCCTGTGTCTTTAATTACCACAATGTTCACACTCACCTTGGGACTTGAAAACAAAGGAGACGGTTTGCCTGTATTGGGAGATCTGGACAATGTAAAACAGAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL472f23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCAGAAATGTTCTTGNGGCAGAAGATAATGTCATGAAGATTGCAGATTTTGGANTTGGCACGAGGGGNTCGCGATATTGANTATTACAAGAAAACTAGTAATGGTCGACTGCCTGTTAAANGGATGGCTCCAGAAGCTTTATTTGACAGAGTTTACACCCACCAAAGTGACATTTGGTCATTTGGAGTGTTGACATGGGAGATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATTCCAGTAGAAGAACTATTTAAACTCTTACGGGAAGGACATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTACATGTTGATGAGGGAGTGCTGGCATGCAGTTCCATCTCAGAGACCAACATTTAAACAGCTGGTTGAACAACTGGATAGGATCCTCACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCCTCCTGTGAAGATTCTTCAAGCACATGCTCTTCATCCGATGACTCTGTTTTTGCCCACGATCCGAGTGCCNATCCTCTCCCNGTG
  5   1   2      seed Emb1                   IMAGE:6637112-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAGGGGTTCACGATATTGACTATTACAAGAAAACTAGTAATGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGACAGAGTTTACACCCACCAAAGTGACATTTGGTCATTTGGAGTGTTGACATGGGAGATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATTCCAGTAGAAGAACTATTTAAACTCTTACGGGAAGGACATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTACATGTTGATGAGGGAGTGCTGGCATGCAGTTCCATCTCAGAGACCAACATTTAAACAGCTGGTTGAACAACTGGATAGGATCCTCACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCCTCCTGTGAAGATTCTTCAAGCACATGCTCTTCATCCGATGACTCTGTTTTTGCCCACGATCCAGTGCCATCCTCTCCCTGTGTCTTTAATTACCACAATGTTCACACTCACCTTGGGACTTGAAAACAAAGGAGACGGTTTGCCTGTATTGGGAGATCTGGACAATGTAAAACAGAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATaaaaaaaaaGCCATATGCGGTATTATGAACTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGA
  3  -1   0       chi Tbd5                            IMAGE:3581092.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTGTTTGACAATATGAATTGAGCTACAACAATGGAGTCGTGCATCTGAATAATTTATAATAATAACTTATTTTTTAATAAGCTTTACACTGACTTTGTCTTGTTTCTGTAGTTGGTCATTTGGAGTGTTGACATGGGAGATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATTCCAGTAGAAGAACTATTTAAACTCTTACGGGAAGGACATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTAAGTGGCTAATATATATATATATTTTTTTTTTATGTTTTTTTCCAGGCCATAACAACAAATATATTTAGAAGCATGCTGACTGTTTGTACAGTATTCAGTATGTTTTGCTGAATTTATTGATTCCCTTTTTTTCCCTCTTGTAGGTACATGTTGATGAGGGAGTGCTGGCATGCAGTTCCATCTCAGAGACCAACATTTAAACAGCTGGTTGAACAACTGGATAGGATCCTCACAGCTGTTTCTGAAGAGGTAAGAATATATGAAGTACCTTGTTATAAGAAACCTACCAATTAGAAGAAAAAAAAACATATTAAAAATGTTATG
  5   1   2       bld Emb1                            IMAGE:6637112.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGGGGTTCACGATATTGACTATTACAAGAAAACTAGTAATGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGACAGAGTTTACACCCACCAAAGTGACATTTGGTCATTTGGAGTGTTGACATGGGAGATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATTCCAGTAGAAGAACTATTTAAACTCTTACGGGAAGGACATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTACATGTTGATGAGGGAGTGCTGGCATGCAGTTCCATCTCAGAGACCAACATTTAAACAGCTGGTTGAACAACTGGATAGGATCCTCACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCCTCCTGTGAAGATTCTTCAAGCACATGCTCTTCATCCGATGACTCTGTTTTTGCCCACGATCCAGTGCCATCCTCTCCCTGTGTCTTTAATTACCACAATGTTCACACTCACCTTGGGACTTGAAAACAAAGGAGACGGTTTGCCTGTATTGGGAGATCTGGACAATGTAAAACAGAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTTACTTaaaaaaaaGGCATATGCGGGTATTATGGAACTATGGGGGAATCACCGGGCCGGTTTTTCCGCTGGTCCTGGCAGAATAGAAAAATCCCTAGGCCAGCTTTCAAATCGCTGGTACCAGCGGAAGGCGTCCCACTGCAAAAGCAAAGccccccccGGTGCCGTGAACAAATGTCCCCTTGCCCTCAAATTTCAAGGGCCTACAGATCCCACCCCCAAAAAAATGGACAAAAGTTACCACGTGGGACCCCACTTGCCCTCCAAGGGGAACATGAACCTTCTTATTAACGGGAACTAAATTCTCCCCACTATGGGGAA
  3   1   2       bld Ga18                              rxlk71l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTAAACAGCTGGTNNAACANCTGNATANGATCCTCACAGCTNTTTCTGAAGAGTATCTGGACNNNNCTATNCCATTTGAACAGTATTCTCCCTCCTGTGAAGATNCTTCAANGNACANNCTCTTCATCCGATGACTCTGTTTTTGCCCNCGATCCAGTGNCNNCCTCTCCCTGTGTCTTTAATTACCACAATGTTCACACTCACCTTGGGACTTGAAAACAAAGGAGACGGTTTGCCTGTATTGGGAGATCTGGACAATGTAAAACAGAGTGTTNTTTCCTTTCCTAATAGGAAACGTATTTATATAAAAAAAAAGCCATATGCGGTATTATGAACTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGAAAAATCCTAAGCCAGTTTCAAATCGCTGGTACAGCGGATGCATAGCACTGAAANCCAAAGCCACCCCGGTCCGTGACGAGATGTNNCCTTGCTCCAGATTCCAAGGTCTAGAGATCGCAGCCCCAAGAGATGGACAAAAGTAGCACTGTGATCCCACNNNNCNCCAAGGGCACATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATATTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATNNTAAAAAAA
  5   1   2       bld Tbd2      in                    IMAGE:3199400.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGCCTCTCCCTGTGTCTTTAATTACCACAATGTTCACACTCACCTTGGGACTTGAAAACAAAGGAGACGGTTTGCCTGTATTGGGAGATCTGGACAATGTAAAACAGAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATaaaaaaaaaaGCCATATGCGGTATTATGAACTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGAAAAATCCTAAGCCAGTTTCAAATCGCTGGTACAGCGGATGCATAGCACTGAAAGCCAAAGCCACCCCGGTCCGTGACAAGATGTCGCCTTGCTCCAGATTCCAAGGTCTAGAGATCGCAGCCCCAAGAGATGGACAAAAGTAGCACTGTGATCCCACTTGCCCTCCAAGGGCACATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAG
  3   1   2       bld Em10      in                    IMAGE:7980348.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGAAAACAAAGGAGACGGTTTGCCTGTATTGGGAGATCTGGACAATGTAAAACAGAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATAAAAAAAAAAGCCATATGCGGTATTATGAACTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGAAAAATCCTAAGCCAGTTTCAAATCGCTGGTACAGCGGATGCATAGCACTGAAAGCCAAAGCCACCCCGGTCCGTGACAAGATGTCGCCTTGCTCCAGATTCCAAGGTCTAGAGATCGCAGCCCCAAGAGATGGACAAAAGTAGCACTGTGATCCCACTTGCCCTCCAAGGGCACATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTAAAAAAAAGTTACTTTTAAATATACCCCGAATC
  3   1   2       bld Ga18      in                      xlk150k01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TNCGCTGGACAATGTAAAACAGAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATAAAAAAAAAGCCATATGCGGTATTATGAACTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGAAAAATCCTAAGCCAGTTTCAAATCGCTGGTACAGCGGATNCATAGCACTGAAANCCAAAGCCACCCCGGTCCGTGACAAGATGNNNNCTTGCTCCAGATTCCAAGGTCTAGAGATCGCAGCCCCAAGAGATGGACAAAAGTAGCACTGTGATCCCACNNNNCTCCAAGGGCACATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATANTGTAAAAAAAA
  3   1   2       bld Ga18      in                      xlk138l22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACAATGTAAAACAGAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATAAAAAAAAAGCCATATGCGGTATTATGAACTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGAAAAATCCTAAGCCAGTTTCAAATCGCTGGTACAGCGGATNCATAGCACTGAAANNCAAAGCCACCCCGGTCCGTGACGAGATGNNNCCTTGCTCCAGATTCCAAGGTCTAGAGATCGCAGCCCCAAGAGATGGACAAAAGTAGCACTGTGATCCCACTNNNCNCCAAGGGCACATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATATTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTAAAAAAAAGT
  5   1   2       add Ga18      in                      xlk138l22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GANAATGTAAAACAGAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATaaaaaaaaaGCCATATGCGGTATTATGAACTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGAAAAATCCTAAGCCAGTTTCAAATCGCTGGTACAGNNNNNNTAGNACTGAAAGCCAAAGCCACCCCGGTCCGTGACGAGATGTCGCCTTGCTCCAGATTCCAAGGTCTAGAGATCGCAGCCCCAAGAGATGGACAAAAGTAGCACTGTGATCCCACTTGCCCTCCANGNNNNATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATAtttttttttttCAAATGCATCGAATTTGGNTTATTTTACCAGACACATAATTTATCTCCtttttatttttatttGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTANNNAAAGTTTTCATATTTCATTTGATTTATTTNTATATTGTaaaaaaaagntacttttanataagnttttnanttntntcaaaaaaaaaa
  5   1   2       add Ga18      in                      xlk150k01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTAAAACAGAGTGNTATTTCCTTTCCTAATAGGAAACGTATTTATATaaaaaaaaaGCCATATGCGGTATTATGAACTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGAAAAATCCTAAGCCAGTTTCAAATCGCTGGTACNGnnnnnnnnAGNACTGAAAGCCAAAGCCACCCCGGTCCGTGACAAGATGTCGCCTTGCTCCAGATTCCAAGGTCTAGAGATCGCAGCCCCAAGAGATGGACAAAAGTAGCACTGTGATCCCACTTGCCCTCCAANNNNNATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGNTAGGCTGAAGAGAATAAatatatatatatttttttttCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCtttttatttttatttGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAANTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAANGTTGTTCTTTTGCAAATTACCAAAAGTTTCATATTTCATTTGATTTATTTTNTATATTGTaaaaaaaaGTTACTTTTNATA
  3   1   2       bld DMZ       in                         xl333o05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAAAAAAAAAGCCATATGCGGTATTATGAACTATGGGGAATCACTGTGCTGTTTTTCTGCTGTTCTGGCAGAATAGAAAAATCCTAAGCCAGTTTCAAATCGCTGGTACAGCGGATGCATAGCACTGAAAGCCAAAGCCACCCCGGTCCGTGACGAGATGTCGCCTTGCTCCAGATTCCAAGGTCTAGAGATCGCAGCCCCAAGAGATGGACAAAAGTAGCACTGTGATCCCACTTGCCCTCCAAGGGCACATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATATTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATNTAGTGAAAAAAAAGNACT
  3   1   2       bld Tbd7      in                         XL071i21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAAAAATCCTAAGCCAGTTTCAAATCGCTGGTACAGCGGATGCATAGCACTGAAAGCCAAAGCCACCCCGGTCCGTGACGAGATGTCGCCTTGCTCCAGATTCCAAGGTNTANAGATNGCAGCCCCAANANATGGACAAAAGTAGCACTGTGATCCCACTTGCCCTCCAAGGGCACATGAACTTTTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTNTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATATTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTNATTATTTTATAATGTAAAAAAAAGTACT
  5  -1   2       bld Tbd7                                 XL084h02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCAGATTCCAAGGTCTANAGATCGCAGCCCCAAGAGATGGACAAAAGTAGCNCTGTGATCCCNCTTGCCCTCCAAGGGCACATGAACTTNTTAGTAACGGAGATAAATTCNCAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGNACTTTTTATATCAAGCACNCAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAatatatatatatatttttttttttCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCtttttatttttatttGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTaaaaaaaaGTTACTTTTAATATAAAGATTTTAAATTATATCAAAAC
  3   1   2       bld Tbd2      in                    IMAGE:3199400.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAAGTAGCACTGTGATCCCACTTGCCCTCCAAGGGCACATGAACTTCTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTCTCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTAAAAAAAAAGTTACTTTTAATATAAAGATTTTAAAT
  3   1   2       bld Tbd7                                 XL067c03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATCCCACTTGCCCTCCAAGGGCACATGAACTTNTTAGTAACGGAGATAAATTCACAGTTTAGGGTACAACAACATTTGTACCCTGTTNTCAAAGTGCCTANAAATCTGTAGATATTTTCANAAAATAAATTTTATTTATGNACTTTTTATATCAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATATTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTNATTTATTTTATATATTGTAAAAAAAAGNACTTTTAATATAAAGATTTTA
  3   1   2       add Tbd7      in                         XL104o07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TNCCNCTTGCCCTCCAAGGGCACATNAACTTTTTAGTAACGGAGATAAATTCNCAGTTTAGGGNACAACAACATTTGNACCCTGTTNTCAAAGNGCCTANAAATCTGTANATATTTTCAGAAAATAAATTTTATTTATGGACNTTTTANATCAAGCNCNCAATAGGTCAGTTACCAGGTTAGGCTNAANAGAATAAATATATATATTTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCNTTTGCNAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTAAAAAAGTNGCTACTTTTAATATAANGATTT
  3   1   2       add Ga12                                 XL190a02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAGGGCACATGAACTTTTTNGTAACGGAGATAAATTNNCAGTTTAGGGTNCAACAACATTTGTNCCCTGTTTTNAAAGNGCCTAGAAATTTGTAGATATTTTCAGAAAATAAATTTTATTTANGTACTTTTTATATCAAGCNCNCAATAGGTCAGTTNCCAGGTTAGGNTGAAGNGAATAAATATATATATATATTTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTAAAAAAAAGTTACTTTTAATATAAAGATTT
  3   1   2       bld Emb4 5g3  in                    IMAGE:4957007.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAAAGTGCCTAGAAATCTGTAGATATTTTCAGAAAATAAATTTTATTTATGTACTTTTTATAACAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATATATATATATATATTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTAAAAAAAAGTTACTTTTAATATAAAGATTTTAAATTATATCAAACATTG
  3   1   2       bld Neu1      in                        Neu1-8F11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATAATTTATTTATGTACTTTTAAACAAGCACACAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATATTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTAAAAAAAAGTTACTTTTAATATAAAGATTTTAAATTAT
  3   1   2       add Eye1 5g3  in                    IMAGE:4743489.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAATAGGTCAGTTACCAGGTTAGGCTGAAGAGAATAAATATATATATATTTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTGTGTATAAATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTTGATTTATTTTATATATTGTAAAAAAAAGTTACTTTTAATATAAAGATTTTAAATTATATCAAAAAAAAAAAAAAA
  3   1   2       bld Ga12      in                         XL191a02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AANATATANATATATTTTTTTTTTTTCAAATGCATCGAATTTGGCTTATTTTACCAGACACATAATTTATCTCCTTTTTATTTTTATTTGTGTATATATAAAGGTACTTTGAACCTGGACAAACTTTTTAAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATATATTTAATACAGAGAAATGTTGTTCTTTTGCAAATTACCAAAAGTTTTCATATTTCATTNGATTTATTTTATATATTGTAAAAAAAAGTTACTTTTAATATAAAGATTT
  3   1   0       add Ga18      out                     xlk140l09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GANAANACNANANACATAATTTNTCTCCTTTGTGTTTATAGATATNTGTACCTTGAACCTGGACAAACATTTTAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATCTATTTAATACAGAGAAATGTTGCTCTTTTGCAAANNNNNNNAAGT
  3  -1   2       add Ga15      out                      XL445j05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTATCTCCTTTGNGTTTATAGATATATGTACCTTGAACCTGGACAAACATTTTAAAATGAATTGGCCATAAATGCTTTTATACATTATAGATCTATTTAATACAGAGAAATGTTGCTCTTTTGCAAATTACCAAAAGTTTCATATTTCACTTGATTTATTTTATATATTGTAAAAAAAAAAAAAGTTNCTTTTAATATAAANATTTTANGTTATNTGAAAAAAAAAAAAAnGGGGGGGCCnnGGGGCCCCCCnnCCCCCAAAAA
  3  -1   2       add Ga15                               XL487p13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTTTGNGTTTGTGNATATATGTACCNTGAACCTGGACAAACATTTGAAAATGAGTTGGCCATAAATGCTTTTATACATTATAGATCTATTTAATACAGAGAAATGTTGCTCTTTTGCAAATTACCAAAAGTTTCATATTTCACTTGATTTATTTTATATATTGTAAAAAAAAAAAAAAANGGGNGGCCNNGGCCAAATNGGCCNGNCNNCNAATTCAAANCGAGGGGANCCNGCAAAAANAACAAG

In case of problems mail me! (