Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012838653 Xl3.1-rxlk101j10ex.3.5 - 32 ESTs
                                                                       ....-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                Xl3.1-rxlk101j10ex.3.5                                                                                                                                                                                                                       GAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCGGTTGTTCTCATTCCAATGCTTCTTATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGCGAGTATGAAAAAGTCAAACTGCAACTCGATGGCTTGGAAGAGAGTGTGAGAGAGCGATGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGACCTCAGTGAAGCCGGTATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCTTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAAGCCAGACGGCAAACTGTAGAAGTAGCTCTAAACCAATTTTCTAATCTTCTCAACAGTAAATCTTTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAGCTCTATTTAGCCTCCCTGTTAACGGTGGCTTTGCATGGAAAGCTGGAATATTACACTGATATAATGAGAGCATTATTAATGGAGTTGCTGGACCAATATGTAGCCAAGAACCCCAAGCTTCTCCTTCGAAGGTCAGAAACTGTTGTGGAACGGATGCTTTCAAATTGGATGTCCATATGTTTGTACCAGTATTTGAAGGACACTGTTGGCGAGCCTTTATACAAACTCTTCAAAGCAATCAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTGTGCAGGCTAAAGCCAAATACACACTCAATGATACCGGATTGCTAGGGGATGATGTTGAGTACACACAGTTGACAGTCAATGTAATTGTACAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACTATCACCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTACAGGAACATTCCTTATTCCCTACGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGACCAGGCTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAAGAAGGTTGAAACAATATAATACTCTCATGCACTACAATGTCAGGGATAATGCCACACTCATTCTGTCCAGAATGGGGATTTCTCAGCAGCAAGAGCAAAATCACCAAGACATTCCAGGAGAACGACATGAACTGTTAGAGGATGAAAATAAAGCATGGCACCTTGTCCGTCCAGCTGATGAGGTGGATGAAGGCAAATCAAAGAGAGGAAGTATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTACTTTCTGTGAAGGGTACACTCCAGCAATTTGTAGATAACTTCTTTCAGAGTGTCCTTAATTCTAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTTGATTTCCTTGATGAGCAAGCCGAAAAATATGAAATCAAAGACGAAGACACAGTCCACATATGGAAAACAAACAGTTTATCACTAAGGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCATCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCTAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTTGTAGCACTACATCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACAGGGGAGAAGTAACTGCTTTTTATTTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAAAA
                                                  Xl3.1-CHK-1012721601                                                                                                                                                                                                                             TTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCGGTTGTTCTCATTCCAATGCTTCTTATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGCGAGTATGAAAAAGTCAAACTGCAACTCGATGGCTTGGAAGAGAGTGTGAGAGAGCGATGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGACCTCAGTGAAGCCGGTATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCTTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAAGCCAGACGGCAAACTGTAGAAGTAGCTCTAAACCAATTTTCTAATCTTCTCAACAGTAAATCTTTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAGCTCTATTTAGCCTCCCTGTTAACGGTGGCTTTGCATGGAAAGCTGGAATATTACACTGATATAATGAGAGCATTATTAATGGAGTTGCTGGACCAATATGTAGCCAAGAACCCCAAGCTTCTCCTTCGAAGGTCAGAAACTGTTGTGGAACGGATGCTTTCAAATTGGATGTCCATATGTTTGTACCAGTATTTGAAGGACACTGTTGGCGAGCCTTTATACAAACTCTTCAAAGCAATCAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTGTGCAGGCTAAAGCCAAATACACACTCAATGATACCGGATTGCTAGGGGATGATGTTGAGTACACACAGTTGACAGTCAATGTAATTGTACAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACTATCACCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTACAGGAACATTCCTTATTCCCTGCGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGACCAGGCTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAAGAAGGTTGAAACAATATAATACTCTCATGCACTACAATGTCAGGGATAATGCCACACTCATTCTGTCCAGAATGGGGATTTCTCAxCAxCAAGAGCAAAATCACCAAGACATTCCAGGAGAACGACATGAACTGTTAGAGGATGAAAATAAAGCATGGCACCTTGTCCGTCCAGCTGATGAGGTGGATGAAGGCAAATCAAAGAGAGGAAGTATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTACTTTCTGTGAAGGGTACACTCCAGCAATTTGTAGATAACTTCTTTCAGAGTGTCCTTAATTCTAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTTGATTTCCTTGATGAGCAAGCCGAAAAATATGAAATCAAAGACGAAGACACAGTCCACATATGGAAAACAAACAGTTTATCACTAAGGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCATCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCTAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTTGTAGCACTACATCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACAGGGGAGAAGTAACTGCTTTTTATTTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTT
                                                      consensus depths                                                                                                                                                                                                                            2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     5     5     5     5     5     5     5     5     4     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     3     4     6     6     6     6     5     6     5     6     6     6     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     5     5     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     6     7     5     7     5     7     6     8     6     8     7     8     8     9     8     9     8     9     7     9     9    10     8     9     8     9     9     9     9     9     8     9     9    10     9    10     7    10     9    10     9    10     9    10     9    10     9    10     8    10     8     9     7     9     8     9     8     9     9    10     7    10     8    10     8    10     8    10     8    11     9    12     7    11    12    15    12    15    11    14    12    14    11    14    11    14    11    14    12    15    12    15    11    15    10    15    11    15    10    16    12    16    11    15    11    15    12    16    13    16    13    17    10    17    12    18     9    18     9    18     9    18     9    18     8    18     8    18     8    17     8    16     8    16     8    15     8    14     8    14     9    14     7    13     8    13     8    13     8    12     7    12     7    12     7    12     5    11     5    11     5    11     6    11     6    11     6    11     6    11     6    11     5    11     5    11     5    11     4    10     3     9     3     7     2     4
  5   1   2       e50                            Xl3.1-IMAGE:5155023.5                                                                                                                                                                                                                       GAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCGGTTGTTCTCATTCCAATGCTTCTTATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGCGAGTATGAAAAAGTCAAACTGCAACTCGATGGCTTGGAAGAGAGTGTGAGAGAGCGATGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGACCTCAGTGAAGCCGGTATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCTTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAAGCCAGACGGCAAACTGTAGAAGTAGCTCTAAACCAATTTTCTAATCTTCTCAACAGTAAATCTTTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAGCTCTATTTAGCCTCCCTGTTAACGGTGGCTTTGCATGGAAAGCTGGAATATTACACTGATATAATGAGAGCATTATTAATGGAGTTGCTGGACCAATATGTAGCCAAGAACCCCAAGCTTCTCCTTCGAAGGTCAGAAACTGTTGTGGAACGGATGCTTTCAAATTGGATGTCCATATGTTTGTACCAGTATTTGAAGGACACTGTTGGCGAGCCTTTATACAAACTCTTCAAAGCAATCAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTGTGCAGGCTAAAGCCAAATACACACTCAATGATACCGGATTGCTAGGGGATGATGTTGAGTACACACAGTTGACAGTCAATGTAATTGTACAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACTATCACCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTACAGGAACATTCCTTATTCCCTACGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGACCAGGCTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGA
  5   1   2       e50                             Xl3.1-rxlk101j10ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTAAAAGTGCTGAACTGTGACACTATCACCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTACAGGAACATTCCTTATTCCCTACGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGGAGGTCGAAACAATATAATACACTCATGCACTACAATATCAGGGATAATGCCACACTTATTCTGTCCAGAATGGGGATTTCTCAACAACAAGAGCAAAATCACCAAGACATTCCAGGAGAACGACATGAACTGTTAGAGGATGAAAATAAAGCATGGCACCTTGTCCGTCCAGCTGATGAGGTGGATGAAGGCAAATCAAAGAGAGGAAGTATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTACTTTCTGTGAAGGGTACACTCCAGCAATTTGTAGATAACTTCTTTCAGAGTGTCCTTAATTCTAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTTGATTTCCTTGATGAGCAAGCCGAAAAATATGAAATCAAAGACGAAGACACAGTCCACATATGGAAAACAAACAGTTTATCACTAAGGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCATCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTTGTAGCACTACATCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACAGGGGAGAAGTAACTGCTTTTTATTTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAACAACATGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAATAATTGGACAATGTGGTGGTTACACTTGAATTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------T-----
  5   1   2       e50                            Xl3.1-IMAGE:5155023.5                                                                                                                                                                                                                       GAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCGGTTGTTCTCATTCCAATGCTTCTTATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGCGAGTATGAAAAAGTCAAACTGCAACTCGATGGCTTGGAAGAGAGTGTGAGAGAGCGATGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGACCTCAGTGAAGCCGGTATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCTTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAAGCCAGACGGCAAACTGTAGAAGTAGCTCTAAACCAATTTTCTAATCTTCTCAACAGTAAATCTTTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAGCTCTATTTAGCCTCCCTGTTAACGGTGGCTTTGCATGGAAAGCTGGAATATTACACTGATATAATGAGAGCATTATTAATGGAGTTGCTGGACCAATATGTAGCCAAGAACCCCAAGCTTCTCCTTCGAAGGTCAGAAACTGTTGTGGAACGGATGCTTTCAAATTGGATGTCCATATGTTTGTACCAGTATTTGAAGGACACTGTTGGCGAGCCTTTATACAAACTCTTCAAAGCAATCAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTGTGCAGGCTAAAGCCAAATACACACTCAATGATACCGGATTGCTAGGGGATGATGTTGAGTACACACAGTTGACAGTCAATGTAATTGTACAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACTATCACCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTACAGGAACATTCCTTATTCCCTACGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGACCAGGCTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGA
                                                  Xl3.1-CHK-1012699565                                                                                                                                                                                                                             TTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCGGTTGTTCTCATTCCAATGCTTCTTATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGCGAGTATGAAAAAGTCAAACTGCAACTCGATGGCTTGGAAGAGAGTGTGAGAGAGCGATGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGACCTCAGTGAAGCCGGTATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCTTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAAGCCAGACGGCAAACTGTAGAAGTAGCTCTAAACCAATTTTCTAATCTTCTCAACAGTAAATCTTTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAGCTCTATTTAGCCTCCCTGTTAACGGTGGCTTTGCATGGAAAGCTGGAATATTACACTGATATAATGAGAGCATTATTAATGGAGTTGCTGGACCAATATGTAGCCAAGAACCCCAAGCTTCTCCTTCGAAGGTCAGAAACTGTTGTGGAACGGATGCTTTCAAATTGGATGTCCATATGTTTGTACCAGTATTTGAAGGACACTGTTGGCGAGCCTTTATACAAACTCTTCAAAGCAATCAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTGTGCAGGCTAAAGCCAAATACACACTCAATGATACCGGATTGCTAGGGGATGATGTTGAGTACACACAGTTGACAGTCAATGTAATTGTACAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACTATCACCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTACAGGAACATTCCTTATTCCCTGCGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGACCAGGCTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAA
  5   1   2       bld Neu7      in                         XL020i03.5p GCTAAGGGTTATAATCTCAGTGCTGCAATGACAATTGAAGAGGCTGAAGCATTTGTGGGTGAAGGCATCTGCAAGATAAACACTCTTACATCTACTGACTTGTACTGTGTCCCCCCGGAAGAACAACCTCCACCAAAGAGACGTCAAAAAAGAGACACCGCTAATAACTTACCAGAGTTCATAGTAAAATTTGGGAAGCGTGAATGGGTCCTGGGAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCGGTTGTTCTCATTCCAATGCTTCTTATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGCGAGTATGAAAAAGTCAAACTGCAACTCGATGGCTTGGAAGAGAGTGTGAGAGAGCGATGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGACCTCAGTGAAGCCGGTATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCTTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAAGCCA
  5   1   2       bld DMZ                                  xl304p20.5p                                                                                                                                                                                                                       GAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCGGTTGTTCTCATTCCAATGCTTCTTATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGCGAGTATGAAAAAGTCAAACTGCAACTCGATGGCTTGGAAGAGAGTGTGAGAGAGCGATGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGACCTCAGTGAAGCCGGTATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCTTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAAGCCAGACGGCAAACTGTAGAAGTAGCTCTAAACCAATTTTCTAATCTTCTCAACAGTAAATCTTTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAGCTCTATTTAGCCTCCCTGTTAACGGTGGCTTTGCATGGAAAGCTGGAATATTACACTGATATAATGAGAGCATTATTAATGGAGTTGCTGGACCAATATGTAGCCNAGAACCCCAAGCTTCTCCTTCGAAGGTCAGAAACTGTTGTGGAACGGATGCTTTCAAATTGGATGTCCATATGTTTGTACCAGTATTTGAAGGACACTGTTGGCGAGCCTTTATACAAACTCTTCAAA
  5   1   2       bld Emb4      in                    IMAGE:4959022.5p                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTAATGATTGAGATGGAAGATCAAACCAGTGACCTCAGTGAAGCCGGTATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCTTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAAGCCAGACGGCAAACTGTAGAAGTAGCTCTAAACCAATTTTCTAATCTTCTCAACAGTAAATCTTTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAGCTCTATTTAGCCTCCCTGTTAACGGTGGCTTTGCATGGAAAGCTGGAATATTACACTGATATAATGAGAGCATTATTAATGGAGTTGCTGGACCAATATGTAGCCAAGAACCCCAAGCTTCTCCTTCGAAGGTCAGAAACTGTTGTGGAACGGATGCTTTCAAATTGGATGTCCATATGTTTGTACCAGTATTTGAAGGACACTGTTGGCGAGCCTTTATACNAACTCTTCAAAGCAATCAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTGTGCAGGCTAAAGCCCAATACACACTCAATGATACCGGA
  5   1   2       add Emb1                            IMAGE:5155023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATATTATACTGATATTATGAGAGCATTATTAATGGAGTTGATGGACCAATACGTGGCCAAGAACCCCAAGCTTCTCCTTCGAAGGTCAGAAACTGTTGTGGAACGGATGCTTTCAAATTGGATGTCCATATGTTTGTATCAGTATTTGAAAGACACTGTTGGCGAGCCTTTATACAAACTCTTCAAAGCAATTAAACACCAAGTAGAAAAGGGCCCAGTTGATGCTGTGCAGGGTAAAGCCAAATACACACTCAATGATACCGGATTGCTAGGGGATGATGTTGAGTACACGCAGTTGACAGTCAATGTAATTGTACAAGAGGAAGGTGCCGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTTCCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTATAGGAATATTCCTTATTCCCTGCGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGACCAGGCTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAAGAAGGTTGAAACAATATAATACTCTCATGCACTACAATGTCAGGGATAATGCCACACTCATTCTGTCCAGAATGGGGATTTCTCAGCAGCAAGAGGAAAATCACCAAGACATTCCAGGGGGAAAGACATGCACTGTTAGAGGATGAAAATAAAACATGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGGCAAATCAAAGAGAGGGCGTATGAAAGAAAAGGAAAGAACCAAGGCAATAACCGAAATATATCTAACTAAGCTACTTTTCTGTGAAGGGGTACACTTCCACCAATTTTGTAGAATAAACTTCTTTCAGGAGTGGCCCTTAAN
  5   1   2       bld Neu7      in                         XL040m17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTATATCAGTGTAATGAGAGCATTATTAATGGAGTTGCTGGACCAATATGTAGCCAAGAACCCCAAGCTTCTCCTTCGAAGGTCAGAAACTGTTGTGGAACGGATGCTTTCAAATTGGATGTCCATATGTTTGTACCAGTATTTGAAGGACACTGTTGGCGAGCCTTTATACAAACTCTTCAAAGCAATCAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTGTGCAGGCTAAAGCCAAATACACACTCAATGATACCGGATTGCTAGGGGATGATGTTGAGTACACACAGTTGACAGTCAATGTAATTGTACAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACTATCACCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTACAGGAACATTCCTTATTCCCTAC
  5   1   2      seed He1       in                    IMAGE:4407140.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACTGATATAATGAGAGCATTATTAATGGAGTTGCTGGACCAATATGTAGCCAAGAACCCCAAGCTTCTCCTTCGAAGGTCAGAAACTGTTGTGGAACGGATGCTTTCAAATTGGATGTCCATATGTTTGTACCAGTATTTGAAGGACACTGTTGGCGAGCCTTTATACAAACTCTTCAAAGCAATCAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTGTGCAGGCTAAAGCCAAATACACACTCAATGATACCGGATTGCTAGGGGATGATGTTGAGTACACACAGTTGACAGTCAATGTAATTGTACAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACTATCACCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTACAGGAACATTCCTTATTCCCTACGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGGAGGTCGAAACAA
  5   1   2       bld Egg3      in                    IMAGE:3379379.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAACACTGTTGGCGAGCCTTTATACAAACTCTTCAAAGCAATCAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTGTGCATGCTAAAGCCAAATACACACTCAATGATACCGGATCGCTAGGGGATGATGTTGAGTACACACAGTTGACAGTCAATGTTATTGTACAAGATGCAAGTGCAGAACCAGTACCAGTAAGAGTGCTGAACTGTGACATTATCATCCAAGTGATGGATAAGAATGTTGACTCAGTT
  5   1   2       e50                             Xl3.1-rxlk101j10ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTAAAAGTGCTGAACTGTGACACTATCACCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTACAGGAACATTCCTTATTCCCTACGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGGAGGTCGAAACAATATAATACACTCATGCACTACAATATCAGGGATAATGCCACACTTATTCTGTCCAGAATGGGGATTTCTCAACAACAAGAGCAAAATCACCAAGACATTCCAGGAGAACGACATGAACTGTTAGAGGATGAAAATAAAGCATGGCACCTTGTCCGTCCAGCTGATGAGGTGGATGAAGGCAAATCAAAGAGAGGAAGTATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTACTTTCTGTGAAGGGTACACTCCAGCAATTTGTAGATAACTTCTTTCAGAGTGTCCTTAATTCTAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTTGATTTCCTTGATGAGCAAGCCGAAAAATATGAAATCAAAGACGAAGACACAGTCCACATATGGAAAACAAACAGTTTATCACTAAGGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCATCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTTGTAGCACTACATCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACAGGGGAGAAGTAACTGCTTTTTATTTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAA
                                                  Xl3.1-CHK-1012688760                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTGCTGAACTGTGACACTATCACCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTACAGGAACATTCCTTATTCCCTACGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGGAGGTCGAAACAATATAATACACTCATGCACTACAATATCAGGGATAATGCCACACTTATTCTGTCCAGAATGGGGATTTCTCAACAACAAGAGCAAAATCACCAAGACATTCCAGGAGAACGACATGAACTGTTAGAGGATGAAAATAAAGCATGGCACCTTGTCCGTCCAGCTGATGAGGTGGATGAAGGCAAATCAAAGAGAGGAAGTATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTACTTTCTGTGAAGGGTACACTCCAGCAATTTGTAGATAACTTCTTTCAGAGTGTCCTTAATTCTAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTTGATTTCCTTGATGAGCAAGCCGAAAAATATGAAATCAAAGACGAAGACACAGTCCACATATGGAAAACAAACAGTTTATCACTAAGGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCATCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCTAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTTGTAGCACTACATCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACAGGGGAGAAGTAACTGCTTTTTATTTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAAAAAAAA
  5   1   2       bld Kid                             IMAGE:7008320.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACTATCACCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTACAGGAACATTCCTTATTCCCTACGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGGAGGTCGAAACAATATAATACACTCATGCACTACAATATCAGGGATAATGCCACACTTATTCTGTCCAGAATGGGGATTTCTCAACAACAAGAGCAAAATCACCAAGACATTCCAGGAGAACGACATGAACTGTTAGAGGATGAAAATAAAGCATGGCACCTTGTCCGTCCAGCTGATGAGGTGGATGAAGGCAAATCAAAGAGAGGAAGTATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTACTTTCTGTGAAGGGTACACTCCAGCAATTTGTAGATAACTTCTTTCAGAGTGTCCTTAATTCTAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTTGATTTCCTTGATGAGCAAGCCGAAAAATATGAAATCAAAGACGAAGACACAGTCCACATATGGAAAACAAACAGTTTATCACTAAGGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTTCATCAGTAGTAGATGCTTTCCTGTCAGTC
  5   1   2       add Ga12                                 XL151c23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGAACCGTACCAGTAAAAGTGCTGAACTGTGACACAATTTCCCAAGTAAAGGAGAAGATTGTTGACCAGGTTTATAGGAATATTCCTTATTCCCTGCGGCCTAAGGCTGATAGTTTGGCTCTGGAATGGAGACCAGGCTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAAGAAGGTTGAAACAATATAATACTCTCATGCACTACAATGTCAGGGATAATGCCACACTCATTCTGTCCAGAATGGGGATTTCTCAGCAGCAAGAGGAAAATCACTAAGACATTCCAGGGGAAAGACATGCACTGTTAGAGGATGAAAATAAAACATGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGGCAAATCAAAGAGAGGCAGTATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTACTTTCTGTGAAGGGTACACTCCAGCAATTTGTAGATAACTTCTTTCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTTGATTTTCTTGACGAGCAAGCAGAAAAATATGAAATCAAAGATGAAG
  5   1   2       bld Lu1       in                    IMAGE:4057164.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACGCGTGGGTTCTCAACAACAAGAGCAAAATCACCAAGACATTCCAGGAGAACGACATGAACTGTTAGAGGATGAAAATAAAGCATGGCACCTTGTCCGTCCAGCTGATGAGGTGGATGAAGGCAAATCAAAGAGAGGAAGTATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTACTTTCTGTGAAGGGTACACTCCAGCAATTTGTAGATAACTTCTTTCAGAGTGTCCTTAATTCTAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTTGATTTCCTTGATGAGCAAGCCGAAAAATATGAAATCAAAGACGAAGACACAGTCCACATATGGAAAACAAACAGTTTATCACTAAGGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCATCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACATACTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCTAAAGAGATCTCAGCTTACAAAAAAATAGTGGAAGACTATTACTAAGGAATCCGTCAGATGGTACAANGTAGCGACTCAGAT
  5   1   2      seed Lu1                    IMAGE:4057164-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCTCAACAACAAGAGCAAAATCACCAAGACATTCCAGGAGAACGACATGAACTGTTAGAGGATGAAAATAAAGCATGGCACCTTGTCCGTCCAGCTGATGAGGTGGATGAAGGCAAATCAAAGAGAGGAAGTATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTACTTTCTGTGAAGGGTACACTCCAGCAATTTGTAGATAACTTCTTTCAGAGTGTCCTTAATTCTAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTTGATTTCCTTGATGAGCAAGCCGAAAAATATGAAATCAAAGACGAAGACACAGTCCACATATGGAAAACAAACAGTTTATCACTAAGGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCATCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAACTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCTAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTTGTAGCACTACATCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTAAATGCA
  5   1   2       bld Egg1                               PBX0027D08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCATGGCACCTTGTGCGTCCAGCTGATGAGGTGGATGAAGGCAAATCAAAGAGAGGAAGTATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTACTTTCTGTGAAGGGTACACTCCAGCAATTTGTAGATAACTTCTTTCAGAGTGTCCTTAATTCTAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTTGATTTCCTTGATGAGCAAGCCGAAAAATATGAAATCAAAGACGAAGACACAGTCCACATATGGAAAACAAACAGTTTATCACTAAGGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCATCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCAC
  5   1   2       add Tad2      in                    IMAGE:6876122.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAAAAATATGAAATCAAAGATGAAGATACAGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTACGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACACTAGTAGCACTACACCAGCTATATCAGTATACAAATAAATACTACGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCTGCACAGCGCATGCAGTTAGCATATCGACTACAGCAATTGCCGCAGCACTAGAGAATAAAGTGACCGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTACGTTTTTCCTCATGAGAGTGCTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCCGTGTATCATTGTATATGCACTGTAGAAAAATGTGCTAACGGAGCCTTTTTTAAAAATCTCATATAATTGGCACAATGATTTGTTTCACCATTAACATTTTTTACATTCATTATGCAAACATACAGGCATTTTTTAGTGGATAATTTA
  5   1   2       bld Egg1                               PBX0077E07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACGAGGTGAAATCAAAGACGAAGACACAGTCCACATATGGAAAACAAACAGTTTATCACTAAGGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCATCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAACTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCTAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTTGTAGCACTACATCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTA
  5  -1   2       bld Bla2                            IMAGE:7299475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATCNAAGAGAGNACACAGTCCACATATGGAAACNAACAGTTATCACTAGGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCATCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTTGTAGCACTACATCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACaaaaaaaaataaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCAATCCCTATGACTT
  5   1   2       bld Skin                            IMAGE:8644471.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCCCATATGGAAAACAAACAGTTTATCACTAATGTTTTGGGTGAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCATCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAACTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCTAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTTGTAGCACTACATCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAATATCTCATATATTGCACACGTGTTCAGCATTAACATTTTTACTTTTGTATACAACATACAGCATTTTAGTGTTATTATAGTCAGCATACATGAAAAGCATCATTTACATATAAGACTGGTTAGCACTCCCTTCCTACC
  5   1   2       bld Egg1                               PBX0006E07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAATATACTGAAAAATCCACACTTCATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTACGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACCCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACACTAGTAGCACTACACCAGCTATATCAGTATACAAATAAATACTACGATGAGATAATAAATGCTCTGGAGGAAGATCCTGCTGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACCGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTAAGTTTTTCCTCATGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCCGTGTATCATTGTATATGCACTGTAGAAAACTGTGCTAACGGAGCCTTTTTTAAATATCTCATATAATTGCACAATGATTTGTTCACCATTAACATTTTTACATTCATTATGCAAACATACAGCATTTTTAGTGATATTTATAGTCAAGCAATACAT
  5   1   2       bld Ga15                               XL455a08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGTAGTAGATGCTTCCCTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGTGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTCGTAGCACTACATCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCA
  5   1   2       bld Tad1      in                    IMAGE:6881070.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACAGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTATTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTTGTAGCACTACATCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTTAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGGTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTANGACTTGGTTTAAGCACTCCCCCCCNTCTNAGGTCGTAACTGTAATAATTTGGACTATGTGGGTGGGTTACACTTGGAATTTGGTGACCCGCACTTCCCATTTACCACCAAATTGCCTACTTGGGGGAAAAA
  3   1   2       bld Ga18                             rxlk101j10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTAGNAGNGNATCNCCAAGCAACAAGCTATTGTATGCAAAAGAGATCTCANCTTACAAAAAAATGGTGGAAGACTATTACAAAGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATNCGCATTTAGCAGAAATTTCAAGGGCTCACACAGAGTCATTAAATACCCTTGTAGCACTACNTCAGCTATATCAATATACAAATAAATACTATGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCANNACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTNNCGCAGCNCTAGAGAATAAAGTGACAGATCTTTGACCGGAACNCCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTNNCTTTTTTTAAATGCNCTGGCGGCACGTATCATNNNNACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACTGGGGAGAAGTAACTGCTTTTTATTTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCANTTCCTTTTTTTNCTCTGANCTTTATTTTATATAA
  3   1   2       bld Tad2      in                    IMAGE:6876122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCCAGAGTCTTAAAATCCACTGGTAGCCCTACACCCAGCTTTATCCGTATACAAATAAATATTACGATGAGATAATAAATGCTCTGGAGGAGGATCCTGCTGCACAGCGCATGCAGTTAGCATATCGACTACAGCAATTGCCGCAGCACTAGAGAATAAAGTGACCGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTACGTTTTTCCTCATGAGAGTGCTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCCGTGTATCATTGTATATGCACTGTAGAAAAATGTGCTAACGGAGCCTTTTTTAAAAATCTCATATAATTGCACAATGATTTGTTCACCATTAACATTTTTACATTCATTATGCAAACATACAGCATTTTTAGTGATATTTATAGTCAAGCAATACATAAAACAAAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCCCCCTCCCTTCCCTCAGCTCATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACTGTATTTCCACTAAGTGCCACAGGAGGAGAAGTAACTGATTTTTATTCCAGATTTTAATGTGGTTAATCACAGATGTCAACGGTACCAAAAGAAAAGGTTTCATACATTTAAAGCACAAATGGAGATTTTCTAGCTCTTTAATTTTTTTTTTTTTTACTCTGAAGTTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACAGATTTTCTTTTTGTGAAAAATTGTGACCGAATCCAT
  3   1   2       bld Tad1      in                    IMAGE:6881070.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAAAATGGCTCTGGGAGGAGGGATCCTTGCAAGCACAGGGGCATGCAGTTAGCATTATGGACTACAGCAAATTGCCGGCAGCACTAGGGAATAAAGTGACAGATTTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCTTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTTAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCGTAACTGTAATAATTGGACTATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACTGGGGAGAAGTAACTGCTTTTTATTTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAAAAAAAAAAAAAGACATACATGATTTTGTAAAGAATATAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTGTACGTTAATGATGTATGAATACAGTAAACATGGACATGATTATTACA
  3   1   2       bld Neu7      in                         XL020i03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGATAATAAATGCTCTGGAGNAGGATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTAATTAAAAAATCTCATATAATTGCACAACAACATGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTGATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACAGGGGAGAAGTAACTGCTTTTTATTCTGACCAGATTTGAATGAATATGAATCATGGATATCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAA
  3   1   2       bld Tbd7                                 XL107d01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTAATTAAAAAATCTCATATAATTGCACAACAACATGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTGATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACAGGGGAGAAGTAACTGCTTTTTATTCTGACCAGATTTGAATGAATATGAATCATGGATATCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAA
  5   1   2       bld Egg1                               PBX0063H11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTGCAGCACAGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGATAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACAACATGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCATAACTGTTATAAT
  5   1   2       bld Egg1                               PBX0029H06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGAGGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCTTCCTCAGCTCATAACTGTAATGATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACAGGGGAGAAGTAACTGCTTTTTATTTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTaaaaaaaaaaaa
  5   1   2       bld Egg1                               PBX0030H06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGAGGCGCATGCAGTTAGCATATCGACTACAGCAAATTGCCGCAGCACTAGAGAATAAAGTGACAGATCTTTGACCGGAACACCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCTTCCTCAGCTCATAACTGTAATGATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACAGGGGAGAAGTAACTGCTTTTTATTTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAAAA
  3   1   2       bld Neu7      in                         XL040m17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGAACACCCCCACTAAAAACACGTTTTCAAATTGAAGATGTTTTTCCTCGTGAGAGTGTTATATTTTTTAAAAGTCCTATTACCTTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACAACATGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGAC
  3   1   2       bld Egg3      in                    IMAGE:3379379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAAAAGTCCTATTACCTTTTTTAAATGCACCTGGCGGCACGTATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACTGCACTTCCATTTACCACTAAGTGCTACTGGGGAGAAGTAACTGCTTTTTATTTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTA
  3   1   2       bld He1       in                    IMAGE:4407140.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATCATTGCATACGCAGTGTAGAAAACTGTGCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACAGGGGAGAAGTAACTGCTTTTTATTCTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAA
  3   1   2       bld Emb4      in                    IMAGE:4959022.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTAAGGGAGCCTTTTTTAAAATATCTCATATAATTGCACAACAACATGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCCTCCTCAGCTCATAACTGTAATAATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACCACTAAGTGCTACAGGGGAGAAGTAACTGCTTTTTATTCTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTA
  3   1   2       bld Lu1       in                    IMAGE:4057164.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATATCTCATATAATTGCACAACGTGTTCAGCATTAACAATTTTTACATTTGTTATACAAACATACAGCATTTTTAGTGTTATTTATAGTCAAGCAATACATGGAAAAAGCAATCATTTTAACATATTAGGACTTGGTTAAGCCACTCCCCCTTCCTCAGCTCATAACTGTAATGATTGGACAATGTGGTGGTTACACTTGAATTTGTGACCGCACTTCCATTTACACTAAGTGCTACAGGGGAGAAGTACCTGCTTTTTATTTGACCAGATTTGAATGAATATGAATCATGGATGTCAAAGGTACCAAAAGAAGAAGTTTCATACATTTAAAGCACAAATCGAGATTTTCTAGCTCTTCAATTCCTTTTTTTACTCTGAACTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)