Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl289a08.3                           10 END     4          14       40                (no blast hit)
     2   2.0    0Xl3.1-xlk1d11ex.5                           3 END     2           7       66                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xl289a08.3                           10 PI      84       1616     2412                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012838655 Xl3.1-xl226g24.3.5 - 27 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl226g24.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCCGGAGTATATGTCTGTAAAGCCATTGTGCCGCGCATGGGGACTACAGAGAAAGAAGTGACCCTCATGGTGAGAGGGCCACCCATCATCACTAGTGAAGCCCACTATGAGAGCATACTGGGAGAAAAGGCACGGATGGAGTGTGTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCGTGGGATAAGCAAAGCCTGGAGGAAGGTTCATGGGGCCGTTTCTCAGTGGAGACCCAAGTCACTGAAGTGGGTGTTGTCTCCTATCTGGTCATTGATGGAACAGAGCAGTCCGATTTCCACACTGAGTTCAACTGCAGTGCCATCAATCAGTATGGGGAGGATTCCGTCATTGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACGTTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACCTCCATCCTATGTTGCCGACGACCAAAAAAAGCCGTGAAGGACTCACAGATTCTAGCCGTGGACGTCTCAGGGAGTGAGCCCAGTGTGCGGCACCCCAGCGACTCTGAGGAGGATCTCAAGGAGCCATTGCACACAGACACGGAATCCCAGAGAACATCCCAGACGGAGCACAGTGACCTCCCTGACGAACCCCAGGACCCAACCAACGGTTATTATAAAGTCCGAGCTCATGAAGACACCAGGCCTACAACCATAATGTACCCGGAGTTCTCCTCTCCGCCACGCCCCCTCTACTCCACCACTTCCTCTCTTTCGCCGTTGTGCCCCACCCCTTCTGGGCCCCCTAAAATCTACGATTATGCTCATCGGTATGCCACCACTCCCAGATCTGGAGGTGAGCGCCATCACATGCCACAGGGGTCATCATCTCATTTGCCGCAAGGCCCCACGCATTTCCCACCTGGCCCAAGTCATGTGTCTCAAGGTCCCACTTATTTGCCACAAGGTCCAACTCATTTACCGCAAGGCCCAACTCATTTACCGCAAGGACTTACTCATTTACAGCAAGGACTCACTCACCTACCACCGGGCCCCAGTCAGCACCCAGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCGGACAGGTTCGACTCAATGGACCAAGGCCCCACTCTGTCTCGGCTCTCCTATGCCTCCCTAACCAGCCACAGTGATATTGGCCGGCCTTCACAGCAACGGATGCAGACCCATGTATGACCTCATTGCCCATCAGATGACCTCATACCAGACTGTGATACTATGGATTCTATGGTATAGGAAACTAGAGACTTTGACATGGCAGAGATTGCCAGGCTGGTGGTCAAAGTGGCCCAGATAAGCCATGACCTGCTTCTTCATGAGAACAGGCACCTACCACACATGGTGGCCCCAAAATGTGAGGNACATACAATACCCAATCAACCGGCAGCACAAAATAATGAAAGGGAACTATTTGGATTTTATTTATTGGTGGAATTGGGCCCTAATGGGGGTGGCGTTACCTCCCCGGTGGATATAAAATATAGTATTATTACAACTCCTCTCTAGGATCTTTCTGGAAATTCTGGAATCACTTGCTGCCACCTACTGGCCAAACAGAATGGCATCACTTGTAAGTGGAGGGGGAAACGCTGCCCCTAGTGGAAACAGATGAACTGCAATATAATTTATATTGAACCAGACTTCTATAATAATATAAATGATCAAACGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGCGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTTAATTTGTAAAGAATCTTGAGAATATTTATATTTAATTAAA
                                                  Xl3.1-CHK-1012722965                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTATATGTCTGTAAAGCCATTGTGCCGCGCATGGGGACTACAGAGAAAGAAGTGACCCTCATGGTGAGAGGGCCACCCATCATCACTAGTGAAGCCCACTATGAGAGCATACTTGGAGAAAAGGCACGGATGGAGTGTGTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCGTGGGATAAGCAAAGCCTGGAGGAAGGTTCATGGGGCCGTTTCTCAGTGGAGACACAAGTCACTGAAGTGGGTGTTGTCTCCTATCTGGTCATTGATGGAACAGAGCAGTCCGATTTCTACACTGAGTTCAACTGCAGTGCCATCAATCAGTATGGGGAGGATTCCGTCATTGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACGTTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACCTCCATCCTATGTTGCCGACGACCAAAAAAAGCCGTGAAGGACTCACAGATTCTAGCCGTGGACGTCTCAGGGAGTGAGCCCAGTGTGCGGCACCCCAGCGACTCTGAGGAGGATCTCAAGGAGCCATTGCACACAGACACGGAATCCCAGAGAACATCCCAGACGGAGCACAGTGACCTCCCAGACGAACCCCAGGACCCAACCAACGGTTATTATAAAGTCCGAGCTCATGAAGACACCAGGCCTACAACCATAATGTACCCGGAGTTCTCCTCTCCGCCACGCCCCCTCTACTCCACCACTTCCTCTCTTTCGCCGTTGTGCCCCACCCCTTCTGGGCCCCCTAAAATCTACGATTATGCTCATCGGTATGCCACCACTCCCAGATCTGGAGGTGAGCGCCATCACATGCCACAGGGGTCATCATCTCATTTGCCGCAAGGCCCCACGCATTTCCCACCTGGCCCAAGTCATGTGTCTCAAGGTCCCACTTATTTGCCACAAGGCCCAACTCATTTACCGCAAGGCCCAACTCATTTACCGCAAGGxCxxACTCATTTACAGCAAGGACTCACTCACCTACCACCGGGCCCCAGTCAGCACCCAGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCGGACAGGTTCGACTCAATGGACCAAGGCCCCACTCTGTCTCGGCTCTCCTATGCCTCCCTAACCAGCCACAGTGATATTGGCCGGCCTTCACAGCAACGGATGCAGACCCATGTGTGACCTCATTGCCCATCAGATGACCTCATACCAGACTGTGATACTATGGATTCTATGGTATAGGAAACTAGAGACTTTGACATGGCAGAGATTGCCAGGCTGGTGGTCAAAxxxGCCCAGATAAGxCxxxxxxxxxxxxTxxxxxxGAAxAxxxxCxxxxxxCACATxxTGGCCCCAAAATGTGAGGCACATACAATACCCAATCAACCGGCAGCACAAAATAATGAAAGGGAACTATTTGGATTTTATTTATTGGTGGAATTGGGCCCTAATGGGGGTGGCGTTACCTCCCCGGTGGATATAAAATATAGTATTATTACAACTCCTCTCTAGGATCTTTCTGGAAATTCTGGAATCACTTGCTGCCACCTACTGGCCAAACAGAATGGCATCACTTxxxAxxGGAGGGGxAAxxxxxxCCCxxxxxGxAAxCAGATGAACTGCAATATAATTTATATTGAACCAGACTTCTATAATAATATAAATGATCAAACGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGCGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTTAATTTGTAAAxxAxxxTGAGAATATTTATATTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     4     4     3     4     7     7     8     8     8     8     8     8     8     8     8     8     4     8     7     8     8     8     8     8     8     8     6     8     8     8     8     8     8     8     8     8     7     7     8     8     8     8     7     8     8     8     8     8     7     8     6     7     6     7     6     7     5     7     6     7     6     7     6     7     6     7     7     8     7     8     6     7     5     7     6     7     7     8     7     8     7     8     7     8     7     8     7     8     7     7     6     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     5     5     4     5     4     5     3     5     4     5     3     5     2     4     3     5     3     5     4     5     2     3     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     1     2     2     3     2     3     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     1     3     1     2     1     2     1     2     3     3     1     2     2     3     2     3     3     3     3     3     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     6     3     7     3     7     2     7     3     7     2     8     3     9     4     9     3     9     5     8     6     8     6     8     7     9     7     9     8     9     8     9     8    10     8    10     8    10     8    10     6    10     7    10     9    11     9    11     9    11     9    11    10    11     9    12    11    12    11    12    12    13    12    13    13    14    13    14    13    14    13    14     8    14     7    14     8    14     8    14     8    14     8    14     8    14     7    14     7    14     7    14     7    13     7    13     8    13     8    13     9    13     9    13     9    13     9    13     9    13     9    13     8    13     7    13     7    13    10    13     8    13     7    13     7    13     7    13     7    12     7    12     6    12     3    10     2     5     2     4
  5   1   2      ests                            Xl3.1-IMAGE:7980751.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCCGGAGTATATGTCTGTAAAGCCATTGTGCCGCGCATGGGGACTACAGAGAAAGAAGTGACCCTCATGGTGAGAGGGCCACCCATCATCACTAGTGAAGCCCACTATGAGAGCATACTGGGAGAAAAGGCACGGATGGAGTGTGTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCGTGGGATAAGCAAAGCCTGGAGGAAGGTTCATGGGGCCGTTTCTCAGTGGAGACCCAAGTCACTGAAGTGGGTGTTGTCTCCTATCTGGTCATTGATGGAACAGAGCAGTCCGATTTCCACACTGAGTTCAACTGCAGTGCCATCAATCAGTATGGGGAGGATTCCGTCATTGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACGTTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACCTCCATCCTATGTTGCCGACGACCAAAAAAAGCCGTGAAGGACTCACAGATTCTAGCCGTGGACGTCTCAGGGAGTGAGCCCAGTGTGCGGCACCCCAGCGACTCTGAGGAGGATCTCAAGGAGCCATTGCACACAGACACGGAATCCCAGAGAACATCCCAGACGGAGCACAGTGACCTCCCTGACGAACCCCAGGACCCAACCAACGGTTATTATAAAGTCCGAGCTCATGAAGACACCAGGCCTACAACCATAATGTACCCGGAGTTCTCCTCTCCGCCACGCCCCCTCTACTCCACCACTTCCTCTCTTTCGCCGTTGTGCCCCACCCCTTCTGGGCCCCCTAAAATCTACGATTATGCTCATCGGTATGCCACCACTCCCAGATCTGGAGGTGAGCGCCATCACATGCCACAGGGGTCATCATCTCATTTGCCGCAAGGCCCCACGCATTTCCCACCTGGCCCAAGTCATGTGTCTCAAGGTCCCACTTATTTGCCACAAGGTCCAACTCATTTAC
  5   1   2      ests                                 Xl3.1-xl226g24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAACAGAATNGCGCATCACTTTGTAGTGGAGGGGAAACGCTGCCCCTAGTGGAAACCAGATGAACTGCAATATAATTTATATTGAACCAGACTTCTATAATAATATAAATGATCAAACGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGCGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTTAATTTGTTAAAGAATCTGAGAATATTTATATTTAATTAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGAGAGGTCGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------G-C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------TC----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----T----G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --A-G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------A---A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -G--------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C--C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----C-----C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             C---------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---C---A----
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xt ---- 1e-007     AAH80470.1 Unknown (protein for MGC:89755) [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 4e-008     XP_001176384.1 PREDICTED: similar to DNA-directed RNA polymerase II largest subunit (RPB1) isoform 1 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 2e-008     NP_500523.3 AMAnitin resistant family member (ama-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 8e-009     XP_641735.1 RNA polymerase II largest subunit [Dictyostelium discoideum AX4] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 2e-014     XP_310917.3 AGAP000217-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-014     NP_525058.2 CG4125-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Gg ---- 3e-035     XP_423078.2 PREDICTED: similar to NEPH1 protein, partial [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 7e-036     NP_001071553.1 kin of IRRE like 3 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 1e-042     XP_546407.2 PREDICTED: similar to kin of IRRE like 3 [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-047     NP_060710.3 kin of IRRE like [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - ?? ---- 2e-047     XP_001250136.2 PREDICTED: similar to NEPH1 protein [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-047     NP_570937.2 X kin of IRRE like 1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 1e-073     NP_001092814.1 kin of IRRE like 3 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 0          NP_001079957.1 hypothetical protein LOC379648 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-xl226g24.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------TGA------------------------------------------ATG------ATG---TAG------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------TAG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------TAATAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------TAA---------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2      ests                            Xl3.1-IMAGE:7980751.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCCGGAGTATATGTCTGTAAAGCCATTGTGCCGCGCATGGGGACTACAGAGAAAGAAGTGACCCTCATGGTGAGAGGGCCACCCATCATCACTAGTGAAGCCCACTATGAGAGCATACTGGGAGAAAAGGCACGGATGGAGTGTGTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCGTGGGATAAGCAAAGCCTGGAGGAAGGTTCATGGGGCCGTTTCTCAGTGGAGACCCAAGTCACTGAAGTGGGTGTTGTCTCCTATCTGGTCATTGATGGAACAGAGCAGTCCGATTTCCACACTGAGTTCAACTGCAGTGCCATCAATCAGTATGGGGAGGATTCCGTCATTGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACGTTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACCTCCATCCTATGTTGCCGACGACCAAAAAAAGCCGTGAAGGACTCACAGATTCTAGCCGTGGACGTCTCAGGGAGTGAGCCCAGTGTGCGGCACCCCAGCGACTCTGAGGAGGATCTCAAGGAGCCATTGCACACAGACACGGAATCCCAGAGAACATCCCAGACGGAGCACAGTGACCTCCCTGACGAACCCCAGGACCCAACCAACGGTTATTATAAAGTCCGAGCTCATGAAGACACCAGGCCTACAACCATAATGTACCCGGAGTTCTCCTCTCCGCCACGCCCCCTCTACTCCACCACTTCCTCTCTTTCGCCGTTGTGCCCCACCCCTTCTGGGCCCCCTAAAATCTACGATTATGCTCATCGGTATGCCACCACTCCCAGATCTGGAGGTGAGCGCCATCACATGCCACAGGGGTCATCATCTCATTTGCCGCAAGGCCCCACGCATTTCCCACCTGGCCCAAGTCATGTGTCTCAAGGTCCCACTTATTTGCCACAAGGTCCAACTCATTTAC
                                                  Xl3.1-CHK-1012693439                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTATATGTCTGTAAAGCCATTGTGCCGCGCATGGGGACTACAGAGAAAGAAGTGACCCTCATGGTGAGAGGGCCACCCATCATCACTAGTGAAGCCCACTATGAGAGCATACTTGGAGAAAAGGCACGGATGGAGTGTGTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCGTGGGATAAGCAAAGCCTGGAGGAAGGTTCATGGGGCCGTTTCTCAGTGGAGACACAAGTCACTGAAGTGGGTGTTGTCTCCTATCTGGTCATTGATGGAACAGAGCAGTCCGATTTCTACACTGAGTTCAACTGCAGTGCCATCAATCAGTATGGGGAGGATTCCGTCATTGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACGTTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACCTCCATCCTATGTTGCCGACGACCAAAAAAAGCCGTGAAGGACTCACAGATTCTAGCCGTGGACGTCTCAGGGAGTGAGCCCAGTGTGCGGCACCCCAGCGACTCTGAGGAGGATCTCAAGGAGCCATTGCACACAGACACGGAATCCCAGAGAACATCCCAGACGGAGCACAGTGACCTCCCAGACGAACCCCAGGACCCAACCAACGGTTATTATAAAGTCCGAGCTCATGAAGACACCAGGCCTACAACCATAATGTACCCGGAGTTCTCCTCTCCGCCACGCCCCCTCTACTCCACCACTTCCTCTCTTTCGCCGTTGTGCCCCACCCCTTCTGGGCCCCCTAAAATCTACGATTATGCTCATCGGTATGCCACCACTCCCAGATCTGGAGGTGAGCGCCATCACATGCCACAGGGGTCATCATCTCATTTGCCGCAAGGCCCCACGCATTTCCCACCTGGCCCAAGTCATGTGTCTCAAGGTCCCACTTATTTGCCACAAGGCCCAACTCATTTACCGCAAG
  5   1   2       bld DMZ       in                         xl226g24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACTGAGCCACGCCCTATGACAGTGGACATTGGCGATGACGCCTCTTTCTTTTGTGGCTGGACTGGAAATCCAACGCCTACGCAATTTTGGAGCAAGAAAGGAACGGGAGAGGTTCTCAGCAATGGAAACACACTGTTACTGACAAAAGTAACCCGCGAAGATGCCGGAGTATATGTCTGTAAAGCCATTGTGCCGCGCATGGGGACTACAGAGAAAGAAGTGACCCTCATGGTGAGAGGGCCACCCATCATCACTAGTGAAGCTCACTATGAGAGCATACTGGGAGAAAAGGCACGGATGGAGTGTGTCATTGAGTCCACCCCTACCCCGGACAGAATTGTCTGGGCGTGGGATAAGCAAAGCCTGGAAGTAGGTTCATGGGGCCGTTTCTCAGTGGAGACACAAGTCACTGAAGTGGGGGCTGTCTCCTTCCTGGTCATTGATGGAACGGAGAGGTCGGATTTCCACACTGAGTTCAACTGCAGTGCTATCAATCAGTATGGGGAGGATTCAGTTATCGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACATTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACCTCCATCCTATGTTGCCGACGACCAAAAAAAGCCGTGAAGGAC
  5   1   2       bld Em10      out                   IMAGE:7981870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAACCACTGTTGCTAACAAAAGTTACCCGTGAAGATGCCGGAGTATACGTCTGTAAAGCTATTGTGCCGCGCATGGGGACTACAGAGAAAGAAGTGACCCTCATGGTGAGAGGTCCACCGGTCATCACTAGTGAAGCCCACTATGAGAGCATACTTGGAGGAAAGGCACGGATGGAGTGTGTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCGTGGGATAAGCAAAGCCTGGAGGAAGGTTCATGGGGCCGTTTCTCAGTGGAGACCCAAGTCACTGAAGTGGGTGTTGTCTCCTATCTGGTCATTGATGGAACAGAGCAGTCCGATTTCTACACGGAGTTCAACTGCAGTGCCATCAATCAGTATGGGGAGGATTCCGTCATTGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACGTTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACTTCCATCCTTTGTTGCCGACGGCCAAAAAAAGCAGTGAAGGACTCACAGATTCTAGCCGTGGACGTCTCAGGGAGTGAGCCCAGTGTGCGGCACCCCAGCGACTCTGAGGAAGATCTCTAGGAGCCATTGCACACAGACACGGAATCCCAGAGAACATCCCAGACCGAGCACAGTGACTTCCCTGACGACCCCAGGACCCACTAACGGTTACTACAAGTCCGAGCTCATGAGACACAGGCCTACACCTCACGTACCAGATTCTCCTCTCCCA
  5   1   2       bld Emb4      out                   IMAGE:4970085.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCACGCGTCCGCACTAGTGAAGCCCACTATGAGAGCATACTTGGAGAAAAGGCACGGATGGAGTGTGTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCGTGGGATAAGCAAAGCCTGGAGGAAGGTTCATGGGGCCGTTTCTCAGTGGAGACCCAAGTCACTGAAGTGGGTGTTGTCTCCTATCTGGTCATTGATGGAACAGAGCAGTCCGATTTCTACACGGAGTTCAACTGCAGTGCCATCAATCAGTATGGGGAGGATTCCGTCATTGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACGTTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACTTCCATCCTTTGTTGCCGACGGCCAAAAAAAGCAGTGAAGGACTCACAGATTCTAGCCGTGGACGTCTCAGGGAGTGAGCCCAGTGTGCGGCACCCCAGCGACTCTGAGGAAGATCTCAAGGAGCCATTGCACACAGACACGGAATCCCAGAGAACATCCCAGACCGAGCACAGTGACCTCCCTGACGAACCCCAGGACCCAACTAACGGTTACTACAAAGTCCGAGCTCATGAAGACACCAGGCCTACCACCATCACGTACCCAGAATTCTCCTCTCCACCACGTCCCCTCTACTCAACCACTTCCTCTCTTTCTCCATTGTGCCCCACCCCATCTGGGCCTCCTAAGATTACGAATATGCTCACCGGTACGCCACCACAA
  5   1   2       bld Emb4      in                    IMAGE:4202898.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATAAGCAAAGCCTGGAAGAAGGTTCATGGGGCCGTTTCTCAGTGGAGACACAAGTCACTGAAGTGGGGGCTGTCTCCTTCCTGGTCATTGATGGAACGGAGAGGTCGGATTTCCACACTGAGTTCAACTGCAGTGCTATCAATCAGTATGGGGAGGATTCAGTCATCGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACATTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACCTCCATCCTATGTTGCCGACGACCAAAAAAAGGTCAGTGTAGGATCCATCATCTGGTGGCTCCATATATCAGTGGTTCTACTAGAACTTTGGTTCTACTATTTTGGCTAACTCGCTGGTAGTTTTTGACCTGCTTCTTCACTTTATTCTGTTGAGGCATTTT
  5   1   2       bld DMZ       out                        xl242j11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGGTTCATGGGGCCGTTTCTCAGTGGAGACCCAAGTCACTGAAGTGGGTGTTGTCTCCTATCTGGTCATTGATGGAACAGAGCAGTCCGATTTCTACACGGAGTTCAACTGCAGTGCCATCAATCAGTATGGGGAGGATTCCGTCATTGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACGTTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACTTCTATCCTTTGTTGCCGACGGCCAAAAAAAGCAGTGAAGGACTCACAGATTCTAGCCGTGGACGTCTCAGGGAGTGAGCCCAGTGTGCGGCACCCCAGCGACTCTGAGGAAGATCTCAAGGAGCCATTGCACACAGACACGGAATCCCAGAGAACATCCCAGACTGAGCACAGTGACCTCCCTGACGAACCCCAGGACCCAACTAACGGTTACTACAAAGTCCGAGCTCATGAAGACACCAGGCCTACCACCATCACGTACCCAGAATTCTCCTCTCCACCACGTCCCCTCTACTCAACCACTTCCTCTCTTTCTCCATTGTGCCCCACCCCATCTGGGCCTCCTAAGATTTACGAATATGCTCACCGGTACGCCACCACAACCAGATCTGGAGGTGAGCACCATCTCATGCCACAAGGGTCGTCAACTCAT
  5   1   2       bld DMZ       out                        xl225p22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGGTTCATGGGGCCGTTTCTCAGTGNAGACCCAAGTCACTGAAGTGGGTGTTGTCTCCTATCTGGTCATTGATGGAACAGAGCAGTCCGATTTCTACACNGAGTTCAACTGCAGTGCCATCAATCAGTATGGGGAGGATTCCGTCATTGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACGTTCTTGCTGATNGCCGTTGGCTT
  5   1   2       bld Em10                            IMAGE:7980751.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGTTCTGGGGCCGTTTCTCAGTGGAGACACAAGTCACTGAAGTGGGGGCTGTCTCCTTCCTGGTCATTGATGGAACGGAGAGGTCGGATTTCCACACTGAGTTCAACTGCAGTGCTATCAATCAGTATGGGGAGGATTCAGTCATCGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACATTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACCTCCATCCTATGTTGCCGACGACCAAAAAAAGCCGTGAAGGACACGCAGATTCTAGCCGTAGACATGTCGGGGAGCGAGCCCAGCGAGAGGCACCCCAGTGACTCTGAGGAGGATCTCAAGGAGCCATTGCACACAGACACGGAATCCCAGAGAACATCCCAGACGGAGCACAGCGACATCCCAGACGAACCCCAGGACCCAACCAACGGTTATTATAAAGTCCGAGCTCATGAAGACACCAGGCCTACAACCATAATGTACCCGGAGTTCTCCTCTCCGCCACGCCCCCTCTACTCCACCACTTCCTCTCTTTCGCCGTTGTGCCCCACCCCTTCTGGGCCCCCTAAAATCTACGATTATGCTCATCGGTATGCCACCACTCCCAGATCTGGAGGTGAGCGCCATCACATGCCACAGGGGTCATCATCTCATTTGCCGCAAGGGCCCACGCATTTCCCACCTGGCCCAAGTCATGTGTCTCAAGGTCCACTTATTTGCCACAGGGCCAACTCATTTACGACATGGCCAACTCAT
  5   1   2      seed DMZ       in                         xl326o15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCGTTTCTCAGTGGAGACACAAGTCACTGAAGTGGGGGCTGTCTCCTTCCTGGTCATTGATGGAACGGAGAGGTCGGATTTCCACACTGAGTTCAACTGCAGTGCTATCAATCAGTATGGGGAGGATTCAGTTATCGTGTCTCTGCGGCAGCAAGCTACTCTTCCTCTGACATTCTTGCTGATTGCCGTTGGCTTGGGGACCCTGTGCATCTTTGTACTCGTCATCACCTCCATCCTATGTTGCCGACGACCAAAAAAAGCCGTGAAGGACACGCAGATTCTAGCCGTAGACATGTCGGGGAGCGAGCCCAGCGAGAGGCACCCCAGTGACTCTGAGGAGGATCTCAAGGAGCCATTGCACACAGACACGGAATCCCAGAGAACATCCCAGACGGAGCACAGTGACATCCCAGACGAACCCCAGGACCCAACCAACGGTTATTATAAAGTCCGAGCTCATGAAGACACCAGGCCTACAACCATAATGTACCCGGAGTTCTCCTCTCCGCCACGCCCCCTCTACTCCACCACTTCCTCTCTTTCGCCGTTGTGCCCCACCCCTTCTGGGCCCCCTAAAATCTACGATTATGCTCATCGGTATGCCACCACTCCCAGATCTGGAGGTGAGCGCCATCACATGCCACAGGGGTCATCATCTCATTTGCCGCAAGGCCCCACGCATTTCCCACCTGGCCCAAGTCATGTGTCTCAAGGTCCCACTTATT
  5   1   2       bld Ga18      in                       xlk70h22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTTGGGGNCCCTGTGCATCTTTGTACTCGTCATCACCTCCATCCTATGTTGCCGACGACCAAAAAAAGCCGTGAAGGACACGCAGATTCTAGCCGTAGACATGTCGGGGAGCGAGCCCAGCGNGAGGCACCCCAGTGACTCTGAGGAGGATCTCAAGGAGCCATTGCACACAGACACGGAATCCCAGAGAACATCCCAGACGGAGCACAGTGACATCCCAGACGAACCCCAGGACCCAACCAACGGTTATTATAAAGTCCGAGCTCATGAAGACACCAGGCCTACAACCATAATGTACCCGGAGTTCTCCTCTCCGCCACGCCCCCTCTACTCCACCACTTCCTCTCTTTCGCCGTTGTGCCCCACCCCTTCTGGGCCCCCTAAAATCTACGATTATGCTCATCGGTATGCCACCACTCCCAGATCTGGAGGTGAGCGCCATCACATGCCACAGGGGTCATCATCTCATTTGCCGCAAGNCCACGCATTTCCCACCTGGCCCAAGTCATGTGTCTCAAGGTCCCACTTATTTGCCACAAGNNNNAACTCATTTACCACAAGGCCCAACTCATTTACCGCAAGNNCCAACTCATTTACCGCAAGNNCAACTCATTTACAGCAAGGACTCACTCACCTACCACCGGGCCCCAGTCAGCACCCAGNACCTTACNCCAGGGCTTTCTGNAGCTACNNC
  5   1   2       bld Em10                            IMAGE:7983658.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGACACGGAATCCCAGAGAACATCCCAGACCGAGCACAGTGACCTCCCTGACGAACCCCAGGACCCAACTAACGGTTACTACAAAGTCCGAGCTCATGAAGACACCAGGCCTACCACCATCACGTACCCAGAATTCTCCTCTCCACCACATCCCCTCTACTCAACCACTTCCTCTCTTTCTCCATTGTGCCCCACCCCATCTGGGCCTCCTAAGATTTACGAATATGCTCACCGGTACGCCACCACTCCCAGATCTGGAGGTGAGCACCATCTCATGCCACAAGGGTCGTCAACTCATTTGCCGCAAGGCCCCACACATTTCCCACAAAGTCCAAGTCATGTGTCACAAGGTCCCACTTATTTGCCACAAGGTCCAACTCATTTACCTCAAGGACCATCTCATTTACAGCAAGGACTTACTCATCTACCCCCGGGCCCCAGTCAACACCCAGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGATTCGACTCAATGGACCAAGGCCCCACTCTGGCACGCCTCTCCTATGCCTCCTTAAATAGCCACAGTGATTTTGGACTGCCTTCACAGCAACGGATGCAGACCCATGTGTGACCTCATCACATGACCTCATACCAGACTGTGATACTATGGTATCTAATGCATTGGAACTCTAGAGACTTTGACTGGCGAGAGGCAGCATAATGTTCCAATAAGACATGTCCTGCTCTTCATGAAACAACNCCGACCATTCATATGCCCCAATGAGAGCAATG
  5   1   2       bld Em10                            IMAGE:7978762.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGACCCAACCAACGGTTATTATAAAGTCCGAGCTCATGAAGACACCAGGCCTACAACCATAATGTACCCGGAGTTCTCCTCTCCGCCACGCCCCCTCTACTCCACCACTTCCTCTCTTTCGCCGTTGTGCCCCACCCCTTCTGGGCCCCCTAAAATCTACGATTATGCTCATCGGTATGCCACCACTCCCAGATCTGGAGGTGAGCGCCATCACATGCCACAGGGGTCATCATCTCATTTGCCGCAAGGCCCCACGCATTTCCCACCTGGCCCAAGTCATGTGTCTCAAGGTCCCACTTATTTGCCACAAGGCCCAACTCATTTACCGCAAGGCCCAACTCATTTACCGCAAGGTCCAACTCATTTACAGCAAGGACTCACTCACCTACCACCGGGCCCCAGTCAGCACCCAGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCGGACAGGTTCGACTCAATGGACCAAGGCCCCACTCTGTCTCGGCTCTCCTATGCCTCCCTAACCAGCCACAGTGATATTGGCCGGCCTTCACAGCAACGGATGCAGACCCATGTATGACCTCATTGCCCATCAGATGACCTCATACCAGACTGTGATACTATGGATTCTATGGTATAGGAAACTAGAGACTTTGACATGGCAGAGATTGCCAGGCTGGTGGTCAAAGTGGCCCAGATAAGCCATGACCTGCTTCTTCATGAGAACAGGCACCTACCACACATGGCCCCAA
  5   1   0       add Tbd7      in                         XL088m05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCACGAGGCACAGGGGTCATCATCTCATTTGCCGCAAGGCCCCACGCATTTCCCACCTGGCCCAAGTCATGTGTCTCAAGGTCCCACTTATTTGCCACAAGGCCCAACTCATTTACCACAAGGCCCAACTCATTTACCGCAAGGCCCAACTCATTTACCGCAAGGCCCAACTCATTTACAGCAAGGACTCACTCACCTACCACCGGGCCCCAGTCAGCACCCAGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCGGACAGGTTCGACTCAATGGACCAAGGCCCCACTCTGTCTCGGCTCTCCTATGCCTCCCTAACCAGCCACAGTGATTTGGCCGGCCTTCACAGCAACGGATGCAGACCCATGTGTGACCTCATTGCCCATCAGATGACCTCATACCAGACTGTGATACTATGGATTCTATGGTATAGGAAACTAGAGACTTTGACATGGCAGAGATTGCCAGGCTGGTGGTCAAAAGTGGCCCAGATAAGGCCATGACCTGCTTCTTCATGAAGACAAGCACCTACCACATCATGGCCCCAAAATGTGAGGCACATACAATACCCAATCAACCGGCAGCACAAAATAATGAAAGGGAACTATTTGGATTTTATTTATTGGTGGAATTGGGCCCTAATGGGGGTG
  5   1   0       add Em10                            IMAGE:8318996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCATTTACCGCAAGGCCCAACTCATTTACAGCAAGGACTCACTCACCTACCACCGGGCCCCAGTCAGCACCCAGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCGGACAGGTTCGACTCAATGGACCAAGGCCCCACTCTGTCTCGGCTCTCCTATGCCTCCCTAACCAGCCACAGTGATTTTGGCCGGCCTTCACAGCAACGGATGCAGACCCATGTGTGACCTCATTGCCCATCAGATGACCTCATACCAGACTGTGATACTATGGATTCTATGGTATAGGAAACTAGAGACTTTGACATGGCAGAGATTGCCAGGCTGGTGGTCAAAAGTGGCCCAGATAAGGCCATGACCTGCTTCTTCATGAAGACAAGCACCTACCACATCATGGCCCCAAAATGTGAGGCACATACAATACCCAATCAACCGGCAGCACAAAATAATGAAAGGGAACTATTTGGATTTTATTTATTGGTGGAATTGGGCCCTAATGGGGGTGGCGTTACCTCCCCGGTGGATATAAAATATAGTATTATTACAACTCCTCTCTAGGATCTTTCTGGAAATTCTGGAATCACTTGCTGCCACCTACTGGCCAAACAGAATGGCATCACTTTGTAAGTGGAGGGGAAACGCTGCCCCTAGTGGAAACCAGATGAACTGCAATATAATTTATATTGAACCAGACTTCT
  5   1   2      ests                                 Xl3.1-xl226g24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAACAGAATNGCGCATCACTTTGTAGTGGAGGGGAAACGCTGCCCCTAGTGGAAACCAGATGAACTGCAATATAATTTATATTGAACCAGACTTCTATAATAATATAAATGATCAAACGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGCGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTTAATTTGTTAAAGAATCTGAGAATATTTATATTTAATTAAAAAA
                                                  Xl3.1-CHK-1012692248                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AxxAxxGCATCAxTTxxxAGTGGAGGGGAAACGCTGCCCCTAGTGGAAACCAGATGAACTGCAATATAATTTATATTGAACCAGACTTCTATAATAATATAAATGATCAAACGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGCGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTTAATTTGTxAAxxAATCTGAGAATATTTATATTTAATT
  3   1   2       bld Ga18      in                       xlk70h22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCAAAANNNNCNANNNNANGNCNATGACCTGCTNCTTCATGAAGACAANNNNCTACCACNNNATGGCCCCAAAATNTNAGGNACATNNANNACCCAATCNNCCGGCAGCACAAAATAATGAAAGGGAACTNTTGGATTTTATTTATTGGTGGNATTGGGCCNNAATGGGGGTGGCGTTACCTCCCCNGNGGATATAAAATATAGTATTATTACAACTCCTCTCTAGGATCTTTCTGGAAATTCTGGANTCACTTGCTGCCACCTACTGNCCAAACAGAATGGCATCNCTTTGTAAGTGGAGGGGAAACGCTGCCCCTAGTGGAANCCAGATGANCTGCAATATAATTTATATTAAACCAGACTTCTATAATAATATAAATGATCAAACGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGCGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCANCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTTAATTTGTAAAGAATCTGAGAA
  5   1   2       bld Ga18      in                      xlk122f19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCACATCATGGCCCCAAAATGTGAGGNACATACAATACCCAATCAACCGGCAGCACAAAATAATGAAAGGGAACTATTTGGATTTTATTTATTGGTGGAATTGGGCCCTAATGGGGGTGGCGTTACCTCCCCGGTGGATATAAAATATAGTATTATTACAACTCCTCTCTAGGATCTTTCTGGAAATTCTGGAATCACTTGCTGCCACCTACTGGCCAAACAGAATGGCATCACTTTGTAAGTGGAGGGGAAACGCTGCCCCTAGTGGAAACCAGATGAACTGCAATATAATTTATATTGAACCAGACTTCTATAATAATATAAATGATCAAACGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGNATTACAGGCCCCTGAGCGCTCGNAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGNNAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGNNNCATGCCTNNGNNTNCCCTACANTTTATATTTATTTCNTT
  3   1   2       add Ga18 5g3  out                       xlk2e23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGNAATCNCNNNCTNCCNCCTACNGNCNAANNAGAATNGCNTCACTTTNTAAGTNNNNGNGGNAACGCTGCCCCTANNGNAACCAGATGANCTGNAANATAATTTATATTGAACCAGNCTTCTATAANANTATAAATGATCAANNGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGNCGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATANTTTCNNGGTTCNCTCCAGAGNAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGNCCCTGAGNGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGANCCCTGGGGNCAGCTCNNNNCGCTGGNAAAGTCGGCAGCNNNNNNNGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCNNNNNCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTTAATTTGTAAAGANTCTGAGAANA
  3   1   2       add Ga18      in                      xlk122f19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTNCTGCNNNNNCTGGCCAAACAGAATNGCNTCACTTTGTAAGTGGANGGGAAACGCTGCCCCTAGTGNNNNCNAGATGANCTGCAATATAATTTATATTGNACCNAGACTTCTATAATAATATAAATGATCAANCGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATANTTTCACGGTTCCCTCCAGAGNAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGNGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGANNCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCNNNNNCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTTAATTTGTAAAGANTCTGAGAA
  3   1   2       bld Ga18 5g3  out                       xlk1d11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTNCCNCTACTGGCNAAACAGAATNGCNTCNCTTTGTAANTGNNGGGGNAACGCTGCCCCTAGTGGAAACCAGATGNACTGNANNANANTTTATATTGAANCNAGACTTCTATAATAATATAAATGATCAAACGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATAGTTTCNCGNTTCCCTCCAGAGNAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGNGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGANNCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATnCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTNTTTTTTTTTTTAATNNGTAAAGANTCTG
  3   1   2       bld DMZ       in                         xl226g24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGGCCAAACAGAANGGCATCACTTGTAAGTGGAGGGGAAACGCTGCCCCTAGTGGAAACCAGATGAACTGCAATATAATTTATATTGAACCAGACTTCTATAATAATATAAATGATCAAACGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGCGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGACTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTAATTGAAAGAATC
  3   1   2       bld Ga18      in                      xlk152e06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GNAACGCNNNNCCTAGNNNANCCAGNTGACCTGNAATATNNTNNATATNNNNNNAGACTTCNATNNNNANANNAANGANNNANCGTCNCGATCTGANNAAAATATATNGAAAANGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCTCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGNGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGNNNCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTNTTTTTTTTTTAATTTGTAAAGAATCNNAG
  3   1   2      seed DMZ       in                         xl326o15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAACCAGATGAACTGCAATATAATTTATATTGAACCAGACTTCTATAATAATATAAATGATCAAACGTCGCGATCTGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGCGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGACTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTTAATTGAAAGAAT
  3   1   2       bld Ga12                                 XL148m23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAAAAAATATATGGAAAAGGATTACATGGGACGTAGCATGGACATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCCCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGCGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTAGGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTTGTATAGGGAGAAATCCAGGCTTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGG
  5   1   2       bld Ga18      in                      xlk152e06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GANATTTTATTTTCATTATTTGAGTAAAATCAGGGGCATTTGTTTCAATCTCCGAGATATAGTTTCACGGTTCCCTCCAGAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGAATTACAGGCCCCTGAGCGCTCGNAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGNNNNGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGNNNTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACattatatatctttatatatattttatTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGtttttttttttAATTTGTAAAGAATCTGAGAATATTTATATTTAATTaaaaaaatgtaaaaaCATGTGATTTCTGTGTNAGTCANNCAGNGCNTG
  3   1   2       bld Tbd7      in                         XL088m05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCAGTTGCGCTGTTATTTATTACTTCCCCTTTGCACTTCACAGCCGCAGGAATTACAGGCCCCTGAGCGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTNTATGTANAGCCCTGGGGCAGCTNTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAANATAATTTGTTTTTTTTTTTAATTTGTAAAGAATCTNAGAATATTTATATTTAATTAAAAAAAT
  3   1   2       bld Tbd7                                 XL110k10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTACAGGCCCNTGAGCGCTCGCAAGCACTGGAGTTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGACTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTTAATTTGTAAAGAATCTAAGAATATTTATATT
  3   1   2       bld Emb4      in                    IMAGE:4202898.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTACACTCTGTATTTGTGTTTATTGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTCGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCAGGCTGCAACTGTCACATTATATATCTTTATATATATTTTATTTCTGCATCCTCTCATACTGTCCTATGCCTGGATTTGTAAGGCACAGACAATATAATTTGTTTTTTTTTTAATTTGTAAAGAATCTGAGAATATTTATATTTAATTAAAAAAATGTAAAAAC
  3   1   2       add Emb4                            IMAGE:4201610.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAAATAAATAGTTAATGGCGTGAGTACGTTTATTGCTAATAAAATCCTGTGGAATTCTATGTAGAGCCCTGGGGCAGCTCTCACCGCTGGAAAGTCGGCAGCTTATATGGATTGTTTCAACTTTCCCTTTTATTTTCTTTTTGGTTTCATGCCTGCGGTTTCCCTACAATTTTATATTTTATTTCATTGTTCCGGAGGCTAAAATCCTTTGCTTCCCACCTGCCTCCGTTCCGCACAATAACTGGTCACTTTTCCACGTTTTTATGTTCCTGCCTTAATTGTCTGCGCTCCTGTATTTGTATAGGGAGAAATCCGGGGCTGCAACGTGTCACATTNATATATCTTNTATATATATTTNTATTTCGTGCATCCTCCTCATANGTCCTAATGCCTGGATTGTGTAAGGGCACAGACAAATATAATTGTGTTTTTTTTTTAATTGNTGTAAAGAATCTGAGAATATTTATATTTAATTAAAAAAATGTAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)