Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL456c15ex.3                          7 END     1           3       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-PBX0008H03.5                         23 PI      83       1331     1838                (no blast hit)
     3   0.0    0Xl3.1-xl330e04.5                           10 PI      92         37      684                hypothetical protein LOC414541 [Xenopus laevis]

 This cluster: approximate FL confidence score = 87%

 1012838657 Xl3.1-XL103l18.3.5 - 31 ESTs
                                                                       ...-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL103l18.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGACTTTGTTCCCCCGTGACGTAATGGCGAGAGCGGCTAAACTAGGGAAAACCTGCAAGAATGACATAAGTTGTGAAAGCATGGGAGAAGCTTTGCGTTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCCAGAGGAACCAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGTGGCACGGACTTTTACATGGCACCCGAAGTGTGGGAGGGTCATTACACAGCCAAGGCAGACATATTTGCTTTGGGTGTTATTCTTTGGGCCATGCTGGAGCGGATTACCATCACAGACACTCATACCAAAAAGAGATTGTTGGGGGGCTATGTTCAGCGGGGGGCTCAAGTAGTGCCAGTGGGGGAAGCTTTGCTGGAGAATCCAAAGCTAGAGCTTCTTATTCCTGTTAAGAAAAAGTCCATGAACCGGCGCATGAAACAGCTGCTGCATCAGATGCTTTCTGCAAACCCCCAGGAGCGTCCTGATGCCTTTCAGCTGGAGTTGAAGCTTATCCAGATTGCTTTCAGAGACTACACATGGGAGACGTGACAGGGTCTGCAGAAGAGCTTGTGATTGGAAATATAATTCTGCCTTTTTGTTTCATGATCACAAAACATTCTTAGCAGCCCTGTGAAAAATTATCAAATCAATATGAATGTCATAGGTTGTTTCAGCAACCTGTTGCTTTACCTCTAAATGCCTCTGTTCTCTTTCTCTGCACTAGCAGAACATCAAACATGCACTCACTAAAGGGCTTGGTGTTTGAGATGTTTCACGTCTCTTGTCTTATAGATCCATGCCTCTGTCTTCTAATAATTCAAGCGGTTGGCTACTTTTCTATAGCACTGTTTGCACCTTCAGTGGCAAATATTGGTTGATAAACCACAACCTAAGTTCGCACACGTGGGTTATAATTTCACATTCCAGTGACAATGCTTGGCCTAAATAACGCGTGTGATCAGCTGATGATTCATAAGTTATACATGAGCATAGAATGGGTTTTTGTTTTTATGAATGTATGTATTTATTAGTATGCAGCATAGGTGGCTGTTCTGCAGAGATGATTGCATTTCAATGTTAGATGTCTTGTCAATAGCTGATTAGATTTGTTCACTAAATAAAATAGAGGGGGCCTGCCCAGCATATGTTGTTTAGAATTGTAAATCAGTTGTATAAATAGAACACCTTTGTTTATTGCTAACTTTGCAGTATCAGATACTTGTGTTTAACCGTTCGCGTGCAGCGGGATTTTATCCATCCATGTGTTGCCTGAAAACACGCAAACATGAAACTATAGTTGCAATGACAATGGTGTTTTAGGTGGTTAATGATAATTTCAGTTATACAAGGCATTATTAAAGGGCATGGCATATTCAAATCTGAAAAGTGTTAGGCTTTACCGATCTTCTAGTTGGCAAAAACAATATATCTGCAAGTTCTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGTTGCTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTCTTAACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTATTATATTTTATGAAAAAACAGTTGCAAAAAATGTCAAAACTTGTAATTTATTATGATGTTTCAGCTGTTAATAAACTGTGAATTTTTTTTT
                                                  Xl3.1-CHK-1012722967                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGTTCCCCCGTGACGTAATGGCGAGAGCGxxxAxACTAGGGAAAACCTGCAAGAATGACATAAGTTGTGAAAGCATGGGAGAAGCTTTGCGTTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCCAGAGGAACCAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGTGGCACGGACTTTTACATGGCACCCGAAGTGTGGGAGGGTCATTACACAGCCAAGGCAGACATATTTGCTTTGGGTGTTATTCTTTGGGCCATGCTGGAGCGGATTACCATCACAGACACTCATACCAAAAAGAGATTGTTGGGGGGCTATGTTCAGCGGGGGGCTCAAGTAGTGCCAGTGGGGGAAGCTTTGCTGGAGAATCCAAAGCTAGAGCTTCTTATTCCTGTTAAGAAAAAGTCCATGAACCGGCGCATGAAACAGCTGCTGCATCAGATGCTTTCTGCAAACCCCCAGGAGCGTCCTGATGCCTTTCAGCTGGAGTTGAAGCTTATCCAGATTGCTTTCAGAGACTACACATGGGAGACGTGACAGGGTCTGCAGAAGAGCTTGTGATTGGAAATATAATTCTGCCTTTTTGTTTCATGATCACAAAACATTCTTAGCAGCCCTGTGAAAAATTATCAAATCAATATGAATGTCATAGGTTGTTTCAGCAACCTGTTGCTTTACCTCTAAATGCCTCTGTTCTCTTTCTCTGCACTAGCAGAACATCAAACATGCACTCACTAAAGGGCTTGGTGTTTGAGATGTTTCACGTCTCTTGTCTTATAGATCCATGCCTCTGTCTTCTAATAATTCAAGCGGTTGGCTACTTTTCTATAGCACTGTTTGCACCTTCAGTGGCAAATATTGGTTGATAAACCACAACCTAAGTTCGCACACGTGGGTTATAATTTCACATTCCAGTGACAATGCTTGGCCTAAATAACGCGTGTGATCAGCTGATGATTCATAAGTTATACATGAGCATAGAATGGGTTTTTGTTTTTATGAATGTATGTATTTATTAGTATGCAGCATAGGTGGCTGTTCTGCAGAGATGATTGCATTTCAATGTTAGATGTCTTGTCAATAGCTGATTAGATTTGTTCACTAAATAAAATAGAGGGGGCCTGCCCAGCATATGTTGTTTAGAATTGTAAATCAGTTGTATAAATAGAACACCTTTGTTTATTGCTAACTTTGCAGTATCAGATACTTGTGTTTAACCGTTCGCGTGCAGCGGGATTTTATCCATCCATGTGTTGCCTGAAAACACGCAAACATGAAACTATAGTTGCAATGACAATGGTGTTTTAGGTGGTTAATGATAATTTCAGTTATACAAGGCATTATTAAAGGGCATGGCATATTCAAATCTGAAAAGTGTTAGGCTTTACCGATCTTCTAGTTGGCAAAAACAATATATCTGCAAGTTCTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGTTGCTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTCTTAACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTATTATATTTTATGAAAAAACAGTTGCAAAAAATGTCAAAACTTGTAATTTATTATGATGTTTCAGCTGTTAATAAACTGTGAATTTTTTTTTTATAAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       2     5     2     5     2     5     2     5     3     8     4     8     4     8     4     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     9     9     8     9     7     8     7     8     7     8     7     7     8     8     8     8     8     8     9     9     9     9     7     9     8     9     7     9     7     9     5     7     6     7     6     7     6     7     6     7     5     7     4     7     2     7     2     7     2     7     2     7     2     5     2     5     2     5     2     5     1     3     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     2     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     4     3     5     3     5     3     5     3     5     3     5     3     5     5     5     5     5     5     5     6     6     6     7     6     7     8     9     9    10     8     9    10    10    10    10     9     9     8     8     8     8     7     7     8     8     7     8     7     8     8     8     8     8     8     8     9    10    11    11    11    11    10    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9    10    10    10    10     9     9     9     9     7     9     7     9     7     8     6     8     5     7     5     7     6     6
  5   1   2      ests                            Xl3.1-IMAGE:6643467.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGACTTTGTTCCCCCGTGACGTAATGGCGAGAGCGGCTAAACTAGGGAAAACCTGCAAGAATGACATAAGTTGTGAAAGCATGGGAGAAGCTTTGCGTTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCCAGAGGAACCAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGTGGCACGGACTTTTACATGGCACCCGAAGTGTGGGAGGGTCATTACACAGCCAAGGCAGACATATTTGCTTTGGGTGTTATTCTTTGGGCCATGCTGGAGCGGATTACCATCACAGACACTCATACCA
  5   1   2      ests                                 Xl3.1-XL103l18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAATGTCATAGGTTGTTTCAGCAACCTGTTGCTTTACCTCTAAATGCCTCTGTTCTCTTTCTCTGCACTAGCAGAACATCAAACATGCACTCACTAAAGGGCTTGGTGTTTGAGATGTTTCACGTCTCTTGTCTTATAGATCCATGCCTCTGTCTTCTAATAATTCAAGCGGTTGGCTACTTTTCTATAGCACTGTTTGCACCTTCAGTGGCAAATATTGGTTGATAAACCACAACCTAAGTTCGCACACGTGGGTTATAATTTCACATTCCAGTGACAATGCTTGGCCTAAATAACGCGTGTGATCAGCTGATGATTCATAAGTTATACATGAGCATAGAATGGGTTTTTGTTTTTATGAATGTATGTATTTATTAGTATGCAGCATAGGTGGCTGTTCTGCAGAGATGATTGCATTTCAATGTTAGATGTCTTGTCAATAGCTGATTAGATTTGTTCACTAAATAAAATAGAGGGGGCCTGCCCAGCATATGTTGTTTAGAATTGTAAATCAGTTGTATAAATAGAACACCTTTGTTTATTGCTAACTTTGCAGTATCAGATACTTGTGTTTAACCGTTCGCGTGCAGCGGGATTTTATCCATCCATGTGTTGCCTGAAAACACGCAAACATGAAACTATAGTTGCAATGACAATGGTGTTTTAGGTGGTTAATGATAATTTCAGTTATACAAGGCATTATTAAAGGGCATGGCATATTCAAATCTGAAAAGTGTTAGGCTTTACCGATCTTCTAGTTGGCAAAAACAATATATCTGCAAGTTCTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGTTGCTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTCTTAACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTATTATATTTTATGAAAAAACAGTTGCAAAAAATGTCAAAACTTGTAATTTATTATGATGTTTCAGCTGTTAATAAACTGTGAATTTTTTTTTTATAACCAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAACGCGCGGGACAAAATGGCGGCGGCCACAAGA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  G-G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              T-----------
                                               BLH ATG     110     350                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN      77     164                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR     110      21                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               EST CLI     -13      13                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG     110       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 5e-018     NP_001071698.1 mitogen-activated protein kinase [Ciona intestinalis] -----==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 8e-019     NP_490968.2 Y39G10AR.3 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 3e-020     XP_001182097.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 2e-020     NP_996192.1 CG11870-PC, isoform C [Drosophila melanogaster] --------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- ?? ---= 3e-021     XP_629641.1 autophagy protein 1 [Dictyostelium discoideum AX4] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Xt ---- 1e-112     NP_001121389.1 hypothetical protein LOC100158477 [Xenopus tropicalis] -------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Cf ---- 2e-119     XP_851782.1 PREDICTED: similar to serine/threonine kinase 35 [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 1e-119     XP_001789119.1 PREDICTED: serine/threonine kinase 35 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Dr ==== 2e-155     NP_001032789.1 hypothetical protein LOC569665 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 1e-165     NP_690048.1 casein kinase [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Gg ==== 6e-166     XP_001232838.1 PREDICTED: similar to Pdik1l protein isoform 1 [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Mm ==== 5e-166     NP_666268.1 hypothetical protein MGC36635 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Bt ---- 1e-167     XP_587377.2 PREDICTED: similar to PDLIM1 interacting kinase 1 like [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Xl ==== 0          NP_001084539.1 hypothetical protein LOC414486 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL103l18.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGA------------------TAA---------------------TGA---------TGA---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------ATG------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------ATG------------------------------------------------------------------------------------------TGA---------------------TGA---------TAA------------------TGA---------------------------------------------ATG---------------------------------------TAAATG------------------------------------------------TAA---------------------------------------TAG------------------TAATAA------------------------TAG------------------------------------------------------------------------------------TGA------------TAA------------------TGATGA---------------TGA---TAG------------------TGAATG---------------ATG---------------------------------------ATG------------------------TAG------------------------------------------------TAG------------------TAA------------------------------------------------------------------------------------ATG---------------------------------------ATG---ATG------TAG------------------------------------TAA---------------------TGA------------------------------------------------------------------------------------------TAG---TAG---ATG---TAA------------------------------------------------------TAA------------------TGA---------------------TGA---------------------------------------------------------------------TAA---------------ATG---------TAG---------------------------------------------------------TAA---TAA---------------------------------ATG------------------------TGA---------------------TAG------------------TAA---------------------------------------------------------------ATG------------------------------TAA------------------ATG------------------ATG---------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   2      ests                            Xl3.1-IMAGE:6643467.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGACTTTGTTCCCCCGTGACGTAATGGCGAGAGCGGCTAAACTAGGGAAAACCTGCAAGAATGACATAAGTTGTGAAAGCATGGGAGAAGCTTTGCGTTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCCAGAGGAACCAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGTGGCACGGACTTTTACATGGCACCCGAAGTGTGGGAGGGTCATTACACAGCCAAGGCAGACATATTTGCTTTGGGTGTTATTCTTTGGGCCATGCTGGAGCGGATTACCATCACAGACACTCATACCA
                                                  Xl3.1-CHK-1012693765                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGTTCCCCCGTGACGTAATGGCGAGAGCGxxxAxACTAGGGAAAACCTGCAAGAATGACATAAGTTGTGAAAGCATGGGAGAAGCTTTGCGTTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCCAGAGGAACCAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGTGGCACGGACTTTTACATGGCACCCGAAGTGTGGGAGGGTCATTACACAGCCAAGGCAGACATATTTGCTTTGGGTGTTATTCTTTGGGCCATGCTGGAGCGGATTACCATCACAGACACTC
  5   1   2       bld Neu7 5g3  in                         XL019k07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAACCTGCAAGAATGACATAAGTTGTGAAAGCATGGGAGAAGCTTTGCGTCAACAACGGAAATGTAGCCAAATAACAGCTGCATTGCTAAAAATGCTCCCATGCCCCACGTAATGGTAATCCAAATCCAAGTCTGGCTAATCCAAGTCACCACTCCAGTTGAGCAGGAGAATCAAGAGTTTATCTTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGC
  5   1   2       bld Oo1  5g                         IMAGE:6640283.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGTAAGAGACTTTGTTCCCCCGTGACGTAATGGCGAGAGCGCGCAGACGTCTCGGAAACGCGCGGGACAAAATGGCGGCGGCCACAAGACAGAAAGGGGCTGAGAAGCTAAACTAGGGAAAACCTGCAAGAATGACATAAGTTGTGAAAGCATGGGAGAAGCTTTGCGTTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGACCCAGAGGAACAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGTGGCACGGACTTTTACATGGCACCCAAATTGTGGGAAGGTCATTACACAGCCAGGCAGACATATTTGGCTTTGGGGGGTTATTCTTT
  5   1   2       bld Oo1  5g                         IMAGE:6643515.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGATGCCAGTAAGAGACTTTGTTCCCCCGTGACGTAATGGCGAGAGCGCGCAGACGTCTCGGAAACGCGCGGGACAAAATGGCGGCGGCCACAAGACAGAAAGGGGCTGAGTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCCAGAAGAACCAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGTGGCACGGAACTTTTACATGGCACCCCGAAGTGGGGGAAGGGTCAATTACACAGCCCAAGGCAGACCTATTTTGCTTTTGGGTGT
  5   1   2       bld Oo1  5g                         IMAGE:6641761.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACGCGCGGGACAAAATGGCGGCGGCCACAAGACAGAAAGGGGCTGAGCTAAACTAGGGAAAACCTGCAAGAATGACATAAGTTGTGAAAGCATGGGAGAAGCTTTGCGTTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCCCAGAGGAACAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGGTGCACGGACTTTTACATGCCACCCGAAGTGTGGGGGAGGTTCATTACACAGGCAAAGGCAGACATATTTTGCTTTGGGGGGGTTATTCTTTGGGNCCATGCCTGGGAACGGGATTTACCACTCACCGGACC
  5   1   2       bld Oo1  5g                         IMAGE:6643467.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGTAAGAGACTTTGTTCCCCCGTGACGTAATGGCGAGAGCGCGCAGACGTCTCGGAAACGCGCGGGACAAAATGGCGGCGGCCACAAGACAGAAAGGGGCTGAGTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCCAGAGGAACCAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGTGGCACGGACTTTTACATGGCACCCGAAAGTGTGGGAGGGTCATTACACAGCCAAGGCAGACATATTTTGCTTTGGGTGGTTATTTCTTTGGGCCCATGCTGGNAGCGGATTACCATCACAGACACTCATTACCAAAAAGGAGATGT
  5   1   2       bld Neu7      in                         XL041o11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAACCTGCAAGAATGACATAAGTTGTGAAAGCATGGGAGAAGCTTTGCGTTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATC
  5   1   2       bld Ga12 5g3  in                         XL174f10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAACCTGCAAGNAATGACATAAGTTGTGAAAGCATGGGAGAAGCTTTGCGTTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGANGCGATATGAATGAATATATTCTTACCCGCANGCCAAGTCGCCGCACCAACACCANCTTCATGTTGCAGCT
  5   1   2       bld Emb1 5g                         IMAGE:6631173.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAACGCGCGGGACAAAATGGCGGCGGCCACAAGAGAGAAAGGGGCTGAGTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCCAGAGGAACCAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGTGGCACGGACTTTTACATGGCACCCGAAAAGGTGGGGAGGGGTCATTACACAGCCCAAGCAGACATATTTTGGCTTTGGGGGGTTATTCCTTTGGGGCATGCCTGGNAGCGGGATTACCATCACAGACACTCATACCCAAAAAAAGATTGTTTggggggggctatggttcaccgggggggctccggtagtgggccagtggggggAAA
  5   1   2      seed Ga12 5g                              XL145h21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAGAAAGGGGCTGAGTGAATCTGAAGATGGTCAGCAGCCAGCCCAAGTATGACTTGATCCGGGAGGTGGGCCGTGGCAGCTACGGGGTGGTATATGAAGCACTAGTACGCAGAACTAGCCAACGAGTAGCTGTTAAGAAGATCCGCTGCCAAGCGCCTGAGAATGTAGAATTGGCTTTACGGGAATTTTGGGCTTTAAGCAGCATCCAGAGCCAGCACCCCAATGTAATTCACATGGAAGAGTGCGTTTTACAGAAGGATGGAATGGTTCAACGCATGTTGCATGGTTCCAGCTCAGTTCTCTACTTACCGTTGGTAGAAACATCGTTGAAAGGCGAGATTGCATTTGATCCGCGCAGCATTTACTGTCTGTGGTTTGTGATGGACTTCTGTGATGGAGGCGATATGAATGAATATATTCTTACCCGCAGGCCAAGTCGCCGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCC
  5   1   2       bld Tbd7      in                         XL073o14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCACCAACACCAGCTTCATGTTGCAGCTAAGCAGTGCCCTTGCCTTTTTGCATAAGAACCAGATCATCCACCGTGACCTTAAGCCAGACAACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCCAGAGGAACCAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGTGGCACGGACTTTTACATGGCACCCGAAGTGTGGGAGGGTCATTACACAGCCAAGGCAGACATATTTGCTTTGGGTGTNATTCTTTGGGCCATGCTGGAGCGGATTACCATCACAGACACTCATACCAAAAAG
  5   1   2       bld Ga15      out                      XL456c15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCTTAAGCCANACNACATTCTGGTGTGCAAATCTCGTGATGGAGTGGATGAACCTACTCTCNNAGTGGCTGACTTTGGTCTCANTAAAGTGTGCTCCANCTCTGGCTTGAACCC
  3   1   2       bld Neu7      in                         XL041o11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCTCGTGATGGAGTGGATGAACCTACTCTCAAAGTGGCTGACTTTGGTCTCAGTAAAGTGTGCTCCAGCTCTGGCTTGAACCCAGAGGAACCAGCCAATGTCAACAAAAGTTTCTTGTCTACAGCCTGTGGCACGGACTTTTACATGGCACCCGAAGTGTGGGAGGGTCATTACACAGCCAAGGCAGACATATTTGCTTTGGGTGTTATTCTTTGGGCCATGCTGGAGCGGATTACCATCACAGACACTCATACCAAAAAGAGATTGTTGGGGGGCTATGTTCAGCGGGGGGCTCAAGTAGTGCCAGTGGGGGAAGCTTTGCTGGAGAATCCAAAGCTAGAGCTTCTTATTCCTGTTAAGAAAAAGTCCATGAACCGGCGCATGAAACAGCTGCTGCATCAGATGCTTTCTGCAAACCCCCAGGAGCGTCCTGATGCCTTTCAGCTGGAGTTGAAGCTTATCCAGATTGCTTTCAGAGACTACACATGGGAGACGTGACAGGGTCTGCAGAAGAGCTTGTGATTGGAAATATAATTCTGCCTTTTTGTTTCATGATCACAAAACATTCTTAGCAGCCCTGTGAAAAATTATCAAATCAATATNAATGTCATAGGTGTTTCAGCAACCTG
  5   1   2      ests                                 Xl3.1-XL103l18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAATGTCATAGGTTGTTTCAGCAACCTGTTGCTTTACCTCTAAATGCCTCTGTTCTCTTTCTCTGCACTAGCAGAACATCAAACATGCACTCACTAAAGGGCTTGGTGTTTGAGATGTTTCACGTCTCTTGTCTTATAGATCCATGCCTCTGTCTTCTAATAATTCAAGCGGTTGGCTACTTTTCTATAGCACTGTTTGCACCTTCAGTGGCAAATATTGGTTGATAAACCACAACCTAAGTTCGCACACGTGGGTTATAATTTCACATTCCAGTGACAATGCTTGGCCTAAATAACGCGTGTGATCAGCTGATGATTCATAAGTTATACATGAGCATAGAATGGGTTTTTGTTTTTATGAATGTATGTATTTATTAGTATGCAGCATAGGTGGCTGTTCTGCAGAGATGATTGCATTTCAATGTTAGATGTCTTGTCAATAGCTGATTAGATTTGTTCACTAAATAAAATAGAGGGGGCCTGCCCAGCATATGTTGTTTAGAATTGTAAATCAGTTGTATAAATAGAACACCTTTGTTTATTGCTAACTTTGCAGTATCAGATACTTGTGTTTAACCGTTCGCGTGCAGCGGGATTTTATCCATCCATGTGTTGCCTGAAAACACGCAAACATGAAACTATAGTTGCAATGACAATGGTGTTTTAGGTGGTTAATGATAATTTCAGTTATACAAGGCATTATTAAAGGGCATGGCATATTCAAATCTGAAAAGTGTTAGGCTTTACCGATCTTCTAGTTGGCAAAAACAATATATCTGCAAGTTCTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGTTGCTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTCTTAACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTATTATATTTTATGAAAAAACAGTTGCAAAAAATGTCAAAACTTGTAATTTATTATGATGTTTCAGCTGTTAATAAACTGTGAATTTTTTTTTTATAACCAC
                                                  Xl3.1-CHK-1012690036                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCATAGGTTGTTTCAGCAACCTGTTGCTTTACCTCTAAATGCCTCTGTTCTCTTTCTCTGCACTAGCAGAACATCAAACATGCACTCACTAAAGGGCTTGGTGTTTGAGATGTTTCACGTCTCTTGTCTTATAGATCCATGCCTCTGTCTTCTAATAATTCAAGCGGTTGGCTACTTTTCTATAGCACTGTTTGCACCTTCAGTGGCAAATATTGGTTGATAAACCACAACCTAAGTTCGCACACGTGGGTTATAATTTCACATTCCAGTGACAATGCTTGGCCTAAATAACGCGTGTGATCAGCTGATGATTCATAAGTTATACATGAGCATAGAATGGGTTTTTGTTTTTATGAATGTATGTATTTATTAGTATGCAGCATAGGTGGCTGTTCTGCAGAGATGATTGCATTTCAATGTTAGATGTCTTGTCAATAGCTGATTAGATTTGTTCACTAAATAAAATAGAGGGGGCCTGCCCAGCATATGTTGTTTAGAATTGTAAATCAGTTGTATAAATAGAACACCTTTGTTTATTGCTAACTTTGCAGTATCAGATACTTGTGTTTAACCGTTCGCGTGCAGCGGGATTTTATCCATCCATGTGTTGCCTGAAAACACGCAAACATGAAACTATAGTTGCAATGACAATGGTGTTTTAGGTGGTTAATGATAATTTCAGTTATACAAGGCATTATTAAAGGGCATGGCATATTCAAATCTGAAAAGTGTTAGGCTTTACCGATCTTCTAGTTGGCAAAAACAATATATCTGCAAGTTCTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGTTGCTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTCTTAACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTATTATATTTTATGAAAAAACAGTTGCAAAAAATGTCAAAACTTGTAATTTATTATGATGTTTCAGCTGTTAATAAACTGTGAATTTTTTTTTTAT
  5   1   2       bld Egg1                               PBX0075D01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGAAGAGCTTGTGATTGGAAATATAATTCTGCCTTTTTGTTTCATGATCACAAAACATTCTTAGCAGCCCTGTGAAAAATTATCAAATCAATATGAATGTCATAGGTTGTTTCAGCAACCTGTTGCTTTACCTCTAAATGCCTCTGTTCTCTTTCTCTGCACTAGCAGAACATCAAACATGCACTCACTAAAGGGCTTGGTGTTTGAGATGTTTCACGTCTCTTGTCTTATAGATCCATGCCTCTGTCTTCTAATAATTCAAGCGGTTGGCTACTTTTCTATAGCACTGTTTGCACCTTCAGTGGCAAATATTGGTTGATAAACCACAACCTAAGTTCGCACACGTGGGTTATAATTTCACATTCCAGTGACAATGCTTGGCCTAAATAACGCGTGTGATCAGCTGATGATTCATAAGTTATACATGAGCATAGAATGG
  5   1   1       add Egg1                               PBX0006H02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAATGTCATAGGTTGTTTCAGCAACCTGTTGCTTTACCTCTAAATGCCTCTGTTCTCTTTCTCTGTACTAGCAGAACATCAAACATGCACTCACTATAGGGCTTGGTGATTGAGATGTTTCATGTCTCTTGTCTTATAGATCCATGCCTCTGTCTTCTAATAATTCAAGCGGATGGCTACTTTTCTATAGCACTGTTTGCACCTTTAGTGGCAAATATTGGTTGATAGAACCACAAACTAAGTTCACACACGTGGGTTATAATTTCACATTCCAGTGACTATGCTTGGCCTACATAACGCGTGTGATCAGCTGATGATTCATAAGTTATACATGATCATAGAATGGGTT
  5   1   2       bld Egg1      in                    IMAGE:3301096.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGGTGTTTGAGATGTTTCAGGTCTCTTGTCTTATAGATCCATGCCTCTGTCTTCTAATAATTCAAGCGGTTGGCTACTTTTCTATAGCACTGTTTGCACCTTCAGTGGCAAATATTGGTTGATAAACCACAACCTAAGTTCGCACACGTGGGTTATAATTTCACATTCCAGTGACAATGCTTGGCCTAAATAACGCGTGTGATCAGCTGATGATTCATAAGTTATACATGAGCATAGAATGGGTTTTTGTTTTTATGAATGTATGTATTTATTAGTATGCAGCATAGGTGGCTGTTCTGCAGAGATGATTGCATTTCAATGTTAGATGTCTTGTCAATAGCTGATTAGATTTGTTCACTAAATAAAATAGAGGGGGCCTGCCCAGCATATGTTGTTTAGAATTGTAAATCAGTTGTATAAATAGAACACCTTTGTTTATTGCTAACTTTGCAGTATCAGATACTTGTGT
  5   1   2       bld Neu7      in                         XL044b18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTGGCTACTTTTCTANAGCACTGTTTGCACCTTCAGTGGCAAATATTGGTTGATAAACCACAACCTAAGTTCGCACACGTGGGTTATAATTTCACATTCCAGTGACAATGCTTGGCCTAAATAACGCGTGTGATCAGCTGATGATTCATAAGTTATACATGAGCATAGAATGGGTTTTTGTTTTTATGAATGTATGTATTTATTAGTATGCAGCATAGGTGGCTGTTCTGCAGAGATGATTGCATTTCAATGTTAGATGTCTTGTCAATAGCTGATTAGATTTGTTCACTAAATAAAATAGAGGGGGCCTGCCCAGCATATGTTGTTTAGAATTGTAAATCAGTTGTATAAATAGAACACCTTTGTTTATTGCTAACTTTGCAGTATCAGATACTTGTGTTTAACCGTTCGCGTGCAGCGGGATTTTATCCATCCATGTGTTGCCTGAAAACACGCAAACATGAAACTATAGTTGCAATGACAATGGTGTTTTAGGTGGTTAATGATAATTTCAGTTATACAAGGCATTATTAAAGGGCATGGCATATTCAAATCTGAAAAGTGTTAGGCTTTACCGATCTTTCTAGTTGGCAAAAACAATATATCTGGCAAGTTCTGGGAGATACATTCTT
  5   1   2       bld Tbd7      in                         XL103l18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTTCTATAGCACTGTTTGCACCTTCAGTGGCAAATATTGGTTGATAAACCACAACCTAAGTTCGCACACGTGGGTTATAATTTCACATTCCAGTGACAATGCTTGGCCTAAATAACGCGTGTGATCAGCTGATGATTCATAAGTTATACATGAGCATAGAATGGGTTTTTGTTTTTATGAATGTATGTATTTATTAGTATGCAGCATAGGTGGCTGTTCTGCAGAGATGATTGCATTTCAATGTTAGATGTCTTGTCAATAGCTGATTAGATTTGTTCACTAAATAAAATAGAGGGGGCCTGCCCAGCATATGTTGTTTAGAATTGTAAATCAGTTGTATAAATAGAACACCTTTGTTTATTGCTAACTTTGCAGTATCAGATACTTGTGTTTAACCGTTCGCGTGCAGCGGGATTTTATCCATCCATGTGTTGCCTGAAAACACGCAAACATGAAACTATAGTTGCAATGACAATGGTGTTTTAGGTGGTTAATGATAATTTCAGTTATACAAGGCATTATTAAAGGGCATGGCATATTCAAATCTGAAAAGTGTTAGGCTTTACCGATCTTCTAGTTGGCAAAAACAATATATCTGCAAGTTCTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAA
  5   1   2       bld Egg1                               PBX0132G10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATGATTCATAAGTTATACATGAGCATAGAATGGGTTTTTGTTTTTATGAATGTTTGTATTTATTAGTATGCAGCATATGTTGTTTAGAATTGTAAATCAGTTGTATAAATAGAACACCTTTGTTTATTGCTAACTTTGCAGTATCAGATACTTGTGTTTAACCGTTCGCGTGCAGCGGGATTTTATCCATCCATGTGTTGCCTGAAAACACGCAAACATGAAACTATAGTTGCAATGACAATGGTGTTTTAGGTGGTTAATGATAATTTCAGTTATACAAGGCATCATTAAANGGCATGGCATATTCAAATCTGAAAAGTGTTAGGCTTTACCGATCTTCTAGTTGGCAAAAACAATATATCTGCAAGTTCTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCT
  5   1   2       bld Egg1                               PBX0012B04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTGTTGCCTGAAAACACGCATACATGAAACTATAGTTGCAATGACAATGGTGTACTATGTGGTTAATGATAATCTCAGTTATACAAGGCATTATTATTAAAGGGCATGGCATATTCAAATCTGAAAAGTGTTAGGCTTTACCGATCTTCTAGTTGGCAAAAACAATATATCTGCAAGTTCTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGACGGAGTGCATGCCATAACATTTTGGAAAGCCAATACCACTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGATGCTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTCTTAACAATGGCAGCTTATTCATTATCTATCAACAGAAAGAATGACACATTATATGTTGCTCCTTTCAATATACAGAATCCAACA
  5   1   2       bld Emb3                            IMAGE:3400000.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACACGCAAACATGAAACTATAGTTGCAATGACAATGGTGTTTTAGGTGGTTAATGATAATTTCATTATACAAGGCATTATTATTAAAGGGCATGGCATATTCAAATCTGAAAAGTGTTAGGCTTTACCGATCTTCTAGTTGGCAAAAACAATATATCTGCAAGTTCTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATA
  5   1   2       bld Egg1                               PBX0047D08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCTGAAAAGTGTTAGGCTTTACCGATCTTATAGTTGGCAAAAACAATATATCTGCACGTTCTGGGAGATACATTCTTGCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGTTGCTGCACAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTCTTAACAATGGCAGGTTATTCATTTTTTATCAACACAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGTAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAAGCCTACTGTCAAGCATGACACATGCACATTCATTTATTTCCCCCATTGG
  5   1   2      seed Egg1                            IMAGE:4782985.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTACCGATCTTCTAGTTGGCAAAAACAATATATCTGCAAGTTCTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGTTGCTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTCTTAACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGTAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTC
  3   1   2       bld Tbd7      in                         XL103l18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAAAAACAATATATCTGCAAGTTNTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGTTGCTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTNTTAACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTATTATATTTTATGAAAAAACAGTTGCAAAAAATGTCAAAACTTGTAATTTATTATNATGTTTCAGCTGTTAATAAACTGNAATTTTTTTTTTA
  3   1   2       bld Ga12 5g3  in                         XL174f10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAAAAACAATATATCTGCAAGTTNTGGGAGATACATTNTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGTTGCTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTNTTAACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGTAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTATTATATTTTANAAAAAACAGTGCAAAAAATGTCAAAACTGTATTTATTANANTTTCAGC
  3   1   2       bld Neu7      in                         XL044b18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCTGCAAGTTCTGGGAGATACATTCTTCCAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGTTGCTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTNTTAACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTATTATATTTTATGAAAAAACAGTTGCAAAAAATGTCAAAACTTGTAATTTATTANATGTTTCAGCTGTTAATAAACTGNAATTTTTTT
  3   1   2       bld Tbd7      in                         XL073o14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAGTACCTGAAAATATAGTTGTAGTGCATGCCATAACATTTTGGAAAGCCAATCCCCCTGCTACCTGCAGAAGAACAGAGCTACAATACATAACTGTTGNTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTCTTAACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATATCCCCCATTGGGCAAATAAAATAGCGTATTATATTTTANAAAAAACAGTGCAAAAAATGTCAAAACT
  3   1   2       bld Neu7 5g3  in                         XL019k07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAAGAACAGAGCTACAATANATAACTGTTGCTGCAGAAAAATTGATGTGACAAAGTGTGGAACAAATGATCTNTTAACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACNCAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTNTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTTTTATATTTTATGAAAAAACAGTTGCAAAAAATGTCAAAACTTGTAATTTATTATGATGTTTCAGCTGTTAATAAACTGNGAATTTTTTTTTA
  3   1   2       bld Egg1      in                    IMAGE:3301096.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTATTATATTTTATGAAAAAACAGTTGCAAAAAATGTCAAAACTTGTAATTTATTATGATGTTTCAGCTGTTAATAAACTGTGAATTTTTTTTTTATAAAAA
  3   1   2       bld Ov1                             IMAGE:4055436.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTTTTATATTTTATGAAAAAACAGTTGCAAAAAATGTCAAAACTTGTAATTTATTATGATGTTTCAGCTGTTAATAAACTGTGAATTTTTTTTTTATAACCACAAA
  3   1   2       bld Lu1                             IMAGE:4056871.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGCAGTTTATTCATTTTTTATCAACAGAAAGAATTACACAATATATGTTGCTCCTTTTAATATACAGAATCCAACATGGCCCTCAAGTAGCCCTCCAAGTTATTGTTTGGATGCTCAAGTTTGACTTTTTGCCATGGCTTTATTATTTAAATCTAATTTGCAGTTTGCTATGTAGGAAAAGTTTCTCCAATGTGGAAGAAGTTGAAAAGCAGTGATTGAACCCTCCTCACCAGCATCAAATAGAGCCACTTGCTATCCACCTAACAATTTACATACATAGCAGCTAACACTATCACATTCACTCAGTCCTACTGTCAAGCATCACACATGCACATTCATTTATTTCCCCCATTGGGCAAATAAAATAGCGTATTATATTTTATGAAAAAACAGTTGCAAAAAATGTCAAAACTTGTAATTTATTATGATGTTTCAGCTGTTAATAAACTGTGAATTTTTTTTTTATAACCACA
  5   1   2       bld Gas8                            IMAGE:3517275.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCACATTCATTTATTTCCCCCATTGGGCAAATAATATAGCGTATTATATTTTATgaaaaaacagttgcaaaaaatgtcaaaaCTTGTAATTTATTATGATGTTTCACTGTTAATAAACTGTGAATTTTTTTTTTATaaaaaaaaaaaaaaaaaaG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)