Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-rxlk104i15ex.3                       11 END     1           9        9                (no blast hit)
     2   1.0    0Xl3.1-IMAGE:4964383.5                       6 END     1           9       16                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:4964383.5                       6 PI      93          1      134                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012838670 Xl3.1-XL063p05.3.5 - 11 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL063p05.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTGCAGCTCAGGCATCGCCGTCCAGTGACAGTAGTTCAGAGTTGGTTCAAACATCCTCTAGTGGAACAGTAACACTGCCTGCAGCCATCATGACCTCCTCCGTGCCCACAACAGTGAGTGGTCATATGATGTACCCCAGTCCCCATGCAGTAATGTATGCCCCTACACAAGGACTAACCGATGGGGGCCTCGCTGTGCTCAATGCCTTCTCCTCTGCGCCCCAAATGCAAGTTTCTCACACCCAGGAACAGGGGGGTGTCCAGCAAGTTTTCCTCACTGCTCCCCCTGGCACTGTCCAGATACCTGTGTCTGCAGTACAGCTCCACCAGATGACAGTTATTGGGCAGCAGTCCAGCGGCAGTAACCTGACTGAGCTGCAAGTGGTTAATTTGGACACGTCGAACAGCAACAAGAATGACTAAAGCGCAGGGTGGGTGGCCCCACACTTTATTGACTCAAAACCTATTTATTGTTGCCTTTTTCACACGTTTCTTTAATCCTCTCCGGCTGGTGCCGTGGCACAAGGACTGGTAGTTATCTGGATGGGGTCACGCTGCTTCACCCCCCCCCCCCCCCCAAGCCAAAGAGCTCTAAACCTTCGTGTCTTTCTCCACTTTACAGCAGCAGAAAGGCCAACGCCCTGTTGGAGTGCGCTCTTTGGGATCCGCAGGGGCGGCGCTGGAACCAGGCGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGCTTCTACCTGTTCATGTTGGGCTTGGCCTGCTGTTGGCATTAGACACTGGGTATTCTGTGTTGAAGTTTACCCGGCAAAGCATCACATATGGGCCCCTAGATATACTTGTAGAGCCCCCAACAAGCCATTGCTAGGAAAACAGAAGGAGAAGGGACCCTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCAGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTGCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTGTGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGCAGAAGCGTGTTGGGGGTTAATAGCGTG
                                                  Xl3.1-CHK-1012722516                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTCAGGCATCGCCGTCCAGTGACAGTAGTTCAGAGTTGGTTCAAACATCCTCTAGTGGAACAGTAACACTGCCTGCAGCCATCATGACCTCCTCCGTGCCCACAACAGTGAGTGGTCATATGATGTACCCCAGTCCCCATGCAGTAATGTATGCCCCTACACAAGGACTAACCGATGGGGGCCTCGCTGTGCTCAATGCCTTCTCCTCTGCGCCCCAAATGCAAGTTTCTCACACCCAGGAACAGGGGGGTGTCCAGCAAGTTTTCCTCACTGCTCCCCCTGGCACTGTCCAGATACCTGTGTCTGCAGTACAGCTCCACCAGATGACAGTTATTGGGCAGCAGTCCAGCGGCAGTAACCTGACTGAGCTGCAAGTGGTTAATTTGGACACGTCGAACAGCAACAAGAATGACTAAAGCGCAGGGTGGGTGGCCCCACACTTTATTGACTCAAAACCTATTTATTGTTGCCTTTTTCACACGTTTCTTTAATCCTCTCCGGCTGGTGCCGTGGCACAAGGACTGGTAGTTATCTGGATGGGGTCACGCTGCTTCACCCCCCCCCCCCCCCCAAGCCAAAGAGCTCTAAACCTTCGTGTCTTTCTCCACTTTACAGCAGCAGAAAGGCCAACGCCCTGTTGGAGTGCGCTCTTTGGGATCCGCAGGGGCGGCGCTGGAACCAGGCGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGCTTCTACCTGTTCATGTTGGGCTTGGCCTGCTGTTGGCATTAGACACTGGGTATTCTGTGTTGAAGTTTACCCGGCAAAGCATCACATATGGGCCCCTAGATATACTTGTAGAGCCCCCAACAAGCCATTGCTAGGAAAACAGAAGGAGAAGGGACCCTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCAGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTGCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTGTGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGCAGAAGCGTGTTGGGGGTTAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     2     2     1     1     1     1     1     1     1     1     2     2     2     2     3     3     4     4     6     7     6     7     6     7     7     7     6     7     7     7     6     7     6     7     7     7     7     7     7     7     6     7     6     7     7     8     6     8     7     8     7     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     5     5
  5   1   2      ests                                 Xl3.1-XL034k16.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCTCTCTGCCTTCCTCANCCTCCAACCTAGTGCCCCTCTCCCAGNACCTTCCTTACTCTAACCCCCTGCATCTTCTGCCTGCCCATATCGTATAAGGAATCTTGGGAAATATTTGTTGGAGTCTCCTGGTTCCTATTACTCCGAGGAATCAGGACTCGCTAAAGCCGGCATTCACCGTGACCAACCTTCCAGGCACATCCAACATCCAAACAGTGCCCACCACCTCCACTTCCATGCAAGTCAGCAGCGGGCACTCCTTTCCCATCACCAACTACCTGGCACCAGTGACCAGCGCCAACGGCACCGTGCTGAAAACTGAGGGTGGAGCTATGAGCTCAGGGGGATTAATGCAAATTCCCGCAGGCTTCACTCTTATGTCAGCAGGGGGAGCTGTAGCTCAGCAGGTACCTGTCCAGGCTATTCAGGTCCATTCTGCAGCTCAGGCATCGCCGTCCAGTGACAGTAGTTCAGAGTTGGTTCAAACATCCTCTAGTGGAACAGTAACACTGCCTGCAGCCATCATGACCTCCTCCGTGCCCACAACAGTGAGTGGTCATATGATGTACCCCAGTCCCCATGCAGTAATGTATGCCCCTACACAAGGACTAACCGATGGGGGCCTCGCTGTGCTCAATGCCTTCTCCTCTGCGCCCCAAATGCAAGTTTCTCACACCCAGGAACAGGGGGGTGTCCAGCAAGTTTTCCTCACTGCTCCCCCTGGCACTGTCCAGATACCTGTGTCTGCAGTACAGCTCCACCAGATGACAGTTATTGGGCAGCAGTCCAGCGGCAGTAACCTGACTGAGCTGCAAGTGGTTAATTTGGACACGTCGAACAGCAACAAGAATGACTAAAGCGCAGGGTGGGTGGCCCCACACTTTATTGACTCAAAACCTATTTATTGTTGCCTTTTTCACACGTTTCTTTAATCCTCTCCGGCTGGTGCCGTGGCACAAGGACTGGTAGTTATCTGGATGGGGTCACGCTGCTTCACCCCCCCCCCCCC
  5   1   2      ests                                 Xl3.1-XL063p05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTTACAGCAGCAGAAAGGCCAACGCCCTGTTGGAGTGCGCTCTTTGGGATCCGCAGGGGCGGCGCTGGAACCAGGCGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGCTTCTACCTGTTCATGTTGGGCTTGGCCTGCTGTTGGCATTAGACACTGGGTATTCTGTGTTGAAGTTTACCCGGCAAAGCATCACATATGGGCCCCTAGATATACTTGTAGAGCCCCCAACAAGCCATTGCTAGGAAAACAGAAGGAGAAGGGACCCTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCAGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTGCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTGTGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGCAGAAGCGTGTTGGGGGTTAATAGCGTGCT
                                                                       ...PROTEIN --- Dr ---- 6e-034     NP_001103996.1 serum response factor [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 5e-053     NP_003122.1 serum response factor (c-fos serum response element-binding transcriptionfactor) [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-053     NP_065239.1 serum response factor [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 4e-054     XP_865482.1 PREDICTED: similar to Serum response factor (SRF) isoform 5 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 6e-055     XP_612306.2 PREDICTED: similar to Serum response factor (SRF) [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                    PROTEIN --- Xl ---- 7e-073     NP_001095218.1 serum response factor [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL063p05.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------ATGATG---------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TAA------------------------------------------------------------------------TAA---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------TGA---------------------------------------TAG------------------------------------------------------------------TAGTGA---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                   ]
  5   1   2      ests                                 Xl3.1-XL034k16.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCTCTCTGCCTTCCTCANCCTCCAACCTAGTGCCCCTCTCCCAGNACCTTCCTTACTCTAACCCCCTGCATCTTCTGCCTGCCCATATCGTATAAGGAATCTTGGGAAATATTTGTTGGAGTCTCCTGGTTCCTATTACTCCGAGGAATCAGGACTCGCTAAAGCCGGCATTCACCGTGACCAACCTTCCAGGCACATCCAACATCCAAACAGTGCCCACCACCTCCACTTCCATGCAAGTCAGCAGCGGGCACTCCTTTCCCATCACCAACTACCTGGCACCAGTGACCAGCGCCAACGGCACCGTGCTGAAAACTGAGGGTGGAGCTATGAGCTCAGGGGGATTAATGCAAATTCCCGCAGGCTTCACTCTTATGTCAGCAGGGGGAGCTGTAGCTCAGCAGGTACCTGTCCAGGCTATTCAGGTCCATTCTGCAGCTCAGGCATCGCCGTCCAGTGACAGTAGTTCAGAGTTGGTTCAAACATCCTCTAGTGGAACAGTAACACTGCCTGCAGCCATCATGACCTCCTCCGTGCCCACAACAGTGAGTGGTCATATGATGTACCCCAGTCCCCATGCAGTAATGTATGCCCCTACACAAGGACTAACCGATGGGGGCCTCGCTGTGCTCAATGCCTTCTCCTCTGCGCCCCAAATGCAAGTTTCTCACACCCAGGAACAGGGGGGTGTCCAGCAAGTTTTCCTCACTGCTCCCCCTGGCACTGTCCAGATACCTGTGTCTGCAGTACAGCTCCACCAGATGACAGTTATTGGGCAGCAGTCCAGCGGCAGTAACCTGACTGAGCTGCAAGTGGTTAATTTGGACACGTCGAACAGCAACAAGAATGACTAAAGCGCAGGGTGGGTGGCCCCACACTTTATTGACTCAAAACCTATTTATTGTTGCCTTTTTCACACGTTTCTTTAATCCTCTCCGGCTGGTGCCGTGGCACAAGGACTGGTAGTTATCTGGATGGGGTCACGCTGCTTCACCCCCCCCCCCCC
                                                  Xl3.1-CHK-1012710720                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTGCCTTCCTCANCCTCCAACCTAGTGCCCCTCTCCCAGNACCTTCCTTACTCTAACCCCCTGCATCTTCTGCCTGCCCATATCGTATAAGGAATCTTGGGAAATATTTGTTGGAGTCTCCTGGTTCCTATTACTCCGAGGAATCAGGACTCGCTAAAGCCGGCATTCACCGTGACCAACCTTCCAGGCACATCCAACATCCAAACAGTGCCCACCACCTCCACTTCCATGCAAGTCAGCAGCGGGCACTCCTTTCCCATCACCAACTACCTGGCACCAGTGACCAGCGCCAACGGCACCGTGCTGAAAACTGAGGGTGGAGCTATGAGCTCAGGGGGATTAATGCAAATTCCCGCAGGCTTCACTCTTATGTCAGCAGGGGGAGCTGTAGCTCAGCAGGTACCTGTCCAGGCTATTCAGGTCCATTCTGCAGCTCAGGCATCGCCGTCCAGTGACAGTAGTTCAGAGTTGGTTCAAACATCCTCTAGTGGAACAGTAACACTGCCTGCAGCCATCATGACCTCCTCCGTGCCCACAACAGTGAGTGGTCATATGATGTACCCCAGTCCCCATGCAGTAATGTATGCCCCTACACAAGGACTAACCGATGGGGGCCTCGCTGTGCTCAATGCCTTCTCCTCTGCGCCCCAAATGCAAGTTTCTCACACCCAGGAACAGGGGGGTGTCCAGCAAGTTTTCCTCACTGCTCCCCCTGGCACTGTCCAGATACCTGTGTCTGCAGTACAGCTCCACCAGATGACAGTTATTGGGCAGCAGTCCAGCGGCAGTAACCTGACTGAGCTGCAAGTGGTTAATTTGGACACGTCGAACAGCAACAAGAATGACTAAAGCGCAGGGTGGGTGGCCCCACACTTTATTGACTCAAAACCTATTTATTGTTGCCTTTTTCACACGTTTCTTTAATCCTCTCCGGCTGGTGCCGTGGCACAAGGACTGGTAGTTATCTGGATGGGGTCACGCTGCTTCACCCCCCC
  5   1   2       bld Neu7      in                         XL044m19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCTCTCTGCCTTCCTCANCCTCCAACCTAGTGCCCCTCTCCCAGNACCTTCCTTACTCTAACCCCCTGCATCTTCTGCCTGCCCATATCGTATAAGGAATCTTGGGAAATATTTGTTGGAGTCTCCTGGTTCCTATTACTCCGAGGAATCAGGACTCGCTAAAGCCGGCATTCACCGTGACCAACCTTCCAGGCACATCCAACATCCAAACAGTGCCCACCACCTCCACTTCCATGCAAGTCAGCAGCGGGCACTCCTTTCCCATCACCAACTACCTGGCACCAGTGACCAGCGCCAACGGCACCGTGCTGAAAACTGAGGGTGGAGCTATGAGCTCAGGGGGATTAATGCAAATTCCCGCAGGCTTCACTCTTATGTCAGCAGGGGGAGCTGTAGCTCAGCAGGTACCTGTCCAGGCTATTCAGGTCCATTCTGCAGCTCAGGCATCGCCGTCCAGTGACAGTAGTTCAGAGTTGGTTCAAACATCCTCTAGTGGAACAGTAACACTGCCTGCAGCCATCATGACCTCCTCCGTGCCCACAACAGTGAGGTGGTCATATGATGT
  5   1   2      seed Neu7      in                         XL034k16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTGCAGCTCAGGCATCGCCGTCCAGTGACAGTAGTTCAGAGTTGGTTCAAACATCCTCTAGTGGAACAGTAACACTGCCTGCAGCCATCATGACCTCCTCCGTGCCCACAACAGTGAGTGGTCATATGATGTACCCCAGTCCCCATGCAGTAATGTATGCCCCTACACAAGGACTAACCGATGGGGGCCTCGCTGTGCTCAATGCCTTCTCCTCTGCGCCCCAAATGCAAGTTTCTCACACCCAGGAACAGGGGGGTGTCCAGCAAGTTTTCCTCACTGCTCCCCCTGGCACTGTCCAGATACCTGTGTCTGCAGTACAGCTCCACCAGATGACAGTTATTGGGCAGCAGTCCAGCGGCAGTAACCTGACTGAGCTGCAAGTGGTTAATTTGGACACGTCGAACAGCAACAAGAATGACTAAAGCGCAGGGTGGGTGGCCCCACACTTTATTGACTCAAAACCTATTTATTGTTGCCTTTTTCACACGTTTCTTTAATCCTCTCCGGCTGGTGCCGTGGCACAAGGACTGGTAGTTATCTGGATGGGGTCACGCTGCTTCAcccccccccccccccccc
  5   1   1       add Ga18      in                        xlk6b16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCGCCGTCCAGTGACAGTAGTTCAGAGTTGGTGCAAACATCCTCTAGTGGAANAGTAACACTGCCTGCAGCCATCATGACCTCCTCCGTGCCCACAACAGTGAGTGGTCATATGATGTACCCCAGTCCCCATGCAGTAATGTATGCCCCTACACAAGGACTAACCGATGGGGGCCTCNNTGTGNTCAATGCCTTCTCCTCTGCGCCCCAAATGCAAGTTTCTCACACCCAGGAACAGGGGGGTGTCCAGCAAGTTTTCCTCACTGCTCCCCCTGGCACTGTCCAGATACCTGTGTCTNCAGTACAGCTCCACCAGATGACAGTTATTGGGCAGCAGTCCAGCGGCAGTNACCTGACTGAGCTGCAAGTGGTTAATTTGGACACGTCGAACAGCAACAAGAATGACTAAAGCGCAGGGTGGGTGGNCCCACACTTTATTGACTCAAAACCTATTTATTGTTGCCTTTTTCACACGTTTCTTTAATCCTCTCCGGCTGGTGCCGnnnnnnnnGGACTGGTAGTTATCTGGATGGGGTCACGCTGCTTCAccccccccccc
  5   1   2      ests                                 Xl3.1-XL063p05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTTACAGCAGCAGAAAGGCCAACGCCCTGTTGGAGTGCGCTCTTTGGGATCCGCAGGGGCGGCGCTGGAACCAGGCGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGCTTCTACCTGTTCATGTTGGGCTTGGCCTGCTGTTGGCATTAGACACTGGGTATTCTGTGTTGAAGTTTACCCGGCAAAGCATCACATATGGGCCCCTAGATATACTTGTAGAGCCCCCAACAAGCCATTGCTAGGAAAACAGAAGGAGAAGGGACCCTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCAGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTGCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTGTGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGCAGAAGCGTGTTGGGGGTTAATAGCGTGCT
                                                  Xl3.1-CHK-1012698322                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCAGCAGAAAGGCCAACGCCCTGTTGGAGTGCGCTCTTTGGGATCCGCAGGGGCGGCGCTGGAACCAGGCGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGCTTCTACCTGTTCATGTTGGGCTTGGCCTGCTGTTGGCATTAGACACTGGGTATTCTGTGTTGAAGTTTACCCGGCAAAGCATCACATATGGGCCCCTAGATATACTTGTAGAGCCCCCAACAAGCCATTGCTAGGAAAACAGAAGGAGAAGGGACCCTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCAGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTGCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTGTGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGCAGAAGCGTGTTGGGGGTTAATAG
  5   1   2       bld Emb1                            IMAGE:6635055.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACGCGTGGGGTCCAGCGGCAGTAACCTGACTGAGCTGCAAGTGGTTAATTTGGACACGTCGAACAGCAACAAGAATGACTAAAGCGCAGGGTGGGTGGCCCCACACTTTATTGACTCAAAACCTATTTATTGTTGCCTTTTTCACACGTTTCTTTAATCCTCTCCGGCTGGTGCCGTGGCACAAGGACTGGTAGTTATCTGGATGGGGTCACGCTGCTTCAccccccccccccccccAAGCCAAAGAGCTCTAAACCTTCGTGTCTTTCTCCACTTTACAGCAGCAGAAAGGCCAACGCCCTGTTGGAGTGCGCTCTTTGGGATCCGCAGGGGCGGCGCTGGAACCAGGCGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGCTTCTACCTGTTCATGTTGGGCTTGGCCTGCTGTTGGCATTAGACACTGGGTATTCTGTGTTGAAGTTTACCCGGCAAAGCATCACATATGGGCCCCTAGATATACTTGTAGAGCCCCCAACAAGCCATTGCTAGGAAAACAGAAGGAGACGGGAATGAATCTTTTGTTCAGAATATGGTGGCTGGAACATCTATTTTTCtacaaaaaccaaataactggaaaatctaagttctgctgtgaatgcaaataaaaacaaataaatATTGCGCAGTGCAAATAACACACTCAAACATACTccccgaccccctattccccccccACAATGCAACACACACTTATCCTCCTATAACTCAGTCAATTACCGTCATATAAAACGGTGGTGGCGCTCAAATCACCCCCATTTACCTTACAGTTCATACGCTACCTTCCTCCCAATTCATACCCCCCTACCACATAAGATTAGAACCCGGATGGCGCGACGTTTGCTCT
  3   1   2      seed Tbd7      out                        XL063p05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTTACAGCAGCAGAAAGGCCAACGCCCTGTTGGAGTGCGCTCTTTGGGATCCGCAGGGGCGGCGCTGGAACCAGGCGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGCTTCTACCTGTTCATGTTGGGCTTGGCCTGCTGTTGGCATTAGACACTGGGTATTCTGTGTTGAAGTTTACCCGGCAAAGCATCACATATGGGCCCCTAGATATACTTGTAGAGCCCCCAACAAGCCATTGCTAGGAAAACAGAAGGAGAAGGGACCCTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCAGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTGCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTGTGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGCAGAAGCGTGTTGGGGGTTAATAGCG
  3   1   2       bld Tbd7                                 XL084d17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTTGGAGTGCGCTCTTTGGGATCCGCAGGGGCGGCGCTGGAACCAGGCGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGCTTCTACCTGTTCATGTTGGGCTTGGCCTGCTGTTGGCATTAGACACTGGGTATTCTGTGTTGAAGTTTACCCGGCAAAGCATCACATATGGGCCCCTAGAGATACTTGTAGAGCCCCCAACAAGCCATTGCTAGGAAAACAGAAGGAGAAGGGACCCTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCAGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTGCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTGTGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGCAGAAGCGTGTTGGGGGTTAATAGCGTGCTT
  3   1   2       bld Neu7      in                         XL034k16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTTTGGGATCCGCAGGGGCGGCGCTGGAACCAGGCGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGCTTCTACCTGTTCATGTTGGGCTTGGCCTGCTGTTGGCATTAGACACTGGGTATTCTGTGTTGAAGTTTACCCGGCAAAGCATCACATATGGGCCCCTAGATATACTTGTAGAGCCCCCAACAAGCCATTGCTAGGAAAACAGAAGGAGAAGGGACCCTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCAGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTGCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTATGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGCAGAAGTGTGTTGGGGGTTAATAGCGTG
  3   1   2       bld Neu7      in                         XL044m19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCCGCAGGGGCGGCGCTGGAACCAGGCGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGCTTCTACCTGTTCATGTTGGGCTTGGCCTGCTGTTGGCATTAGACACTGGGTATTCTGTGTTGAAGTTTACCCGGCAAAGCATCACATATGGGCCCCTAGATATACTTGTAGAGCCCCCAACAAGCCATTGCTAGGAAAACAGAAGGAGAAGGGACCCTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCAGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTGCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTATGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGCAGAAGTGTGTTGGGGGTTAATAGCGTGCTT
  3   1   2       bld Neu7                                 XL034c10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCGCAGGGGCGGCGCTGGAACCAGGCGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGCTTCTACCTGTTCATGTTGGGCTTGGCCTGCTGTTGGCATTAGACACTGGGTATTCTGTGTTGAAGTTTACCCGGCAAAGCATCACATATGGGCCCCTAGATATACTTGTAGAGCCCCCAACAAGCCATTGCTAGGAAAACAGAAGGAGAAGGGACACTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCTGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTGCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTGTGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGCAGAAGCGTGTTGGGGGTTAATAGC
  3   1   2       bld Ga18      in                        xlk6b16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGGNNGCGCTGNNNCANNNGAGGAGGANTTNNACTGTGCCTGTGTGATTAGNNTTGGGCTTCTACCTGTTCATGTNGGNCTTGGCCTGCTNNNGGCATNAGACACTGGGTATTCTGTGTTGAAGTTTNCCCGNCNAAGCATCACATATGGNNCCCTAGATATACTTGTAGAGCNNNCAACAAGCCATTGCTAGGAAAACAGAAGGAGAAGGGACCCTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCAGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTNCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTGTGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGNAGAAGCGTGTTGGGGGTTAATANCGTGnnnnnnnnnAGAG
  5   1   2       bld Tbd3      out                   IMAGE:3549883.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCAATCCTGNACTCCGTGGTACTAAAAACCCCCCAACAGCCATTGCTAGGATTTCAGAAGAGAAGGGACCCTAAAATTCCCTAAGAGAAGACTATATTTTTCTAATAGTTGAGTCTCAGTATTTATGTATTGAGGGTTTGTGATGCCTCAGTTTTTACGGCGAGGAGATTTTACTGTCTGTATAGCCAATACATCCCTCTGATGGGAATGTATACACTCATGCACAATATTGTATTGCTTTGCAGGGGTCTTAGTGAGGAGCACTACAGGATTTCAGTGCCCATCCAATCACAAGTACTGTAATTAGGGTACAAATGGCTGGCCACGTTCCATCACGGAGGACAGGAGCCATCTTTGTGTCATTTCTGCTGCAACCCTGTGTGTGCAAGTTGTGTGAGTCTGTGGGAAGACAATGGCACGTGACTGGGGGTGGGTTGGCAATGGGCAGAACTTATCAGACTCAGGGTGTTGGCGCAGAAGCGTGTTGGGGGTTAATAGCGTGCTTTTGGTTGAAGAGAAatatatatatatTTTCCAGTTTGATTTGTACAGTCTGTGCTGTGTTTGGTTTGCTGGTGTGCGAGTTTTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)