Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8822604.5                      18 END     2           7       11                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8822604.5                      18 PI      77       2557     3197                (no blast hit)
     3   0.0    0Xl3.1-XL110c16.3                            7 PI      90       1611     2256                SUMO-specific protease U1p1 [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:7202498.5                       3 PI      90        194      814                SUMO-specific protease U1p1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012838676 Xl3.1-IMAGE:6640229.5.5 - 26 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6640229.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTAAACAACCACAACTTTATTGAAACGCCGGCGAACAACAACAACACAGGCAATTTCGGACCGATCAATATTATGACACTACTTTGTTGATGTGCGTGTGTCCCCGTTGCCTTCCCGTGTGTGGCGGGAATAATTTGATTCATAGTTTCTCTAGTCGTATTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAGCAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCTAAAGGAGTGTCATCTCAGAAACCAAGAGTACCTAGGTCTGCCCACATGGAAGCACGAAAACTGAGTGGAGCTTTAAATGCTGCTTCGGGAAAACCAAATCATACTCTTGCATCAGCTTATGAAAAATCCTTTCCATTTAAGAACATTTCATGTTCAGCTTCATTGATTGGACCTTGTCGTCGAAGCCCTAAAAAAACACAGAGGCGCTTTGTCAGTACAGTTGAAGAAACAGTACGCGAGGAAGAAAAGGAAATATACAGGCAGCTACTTCAGGTTGTGACGGGAAAAAACCTTTTTATCCACCAAGTCTACATCCATTCTGCCTCCACAGGTGTCTAGATGTTTAAGTTCAGATAACAGTATATCTGGACAACCTGTTGCTTCAAGTTTGAGTTCTCTAGAGCCCAGTAGTTTGGATACAGAATCTTCATGTCGAACATCATTTAGCTATTTGCAGCCATCAGGTCAAATTTCAGAAGCAATTCTAAGCAACTCAACAAATTTCAAAGTAATTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGCATGCTCCTAGCTCACAGCAGTCTCAAGGTTTAGATTCGCCCATTGTATTGGATTCGCCTGTTGTCAAACCTCGAGAACCCGCTAGTCAACCTTTCTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGATCACGAGAAAGAAGGCGTCAAATTGAAGAACAGGAAGCACTTGCCTTACAACTTCAAAAACAGAGGCTTCAAGAATGTTCAGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCCGAAGCAAGAGGAGTCCCCCAAACCTGAAGAGATTGAATTCCCTGAAATTACAGAGGTTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGGAGCCAAGATCAGTCTTTAAGTGAAGGGTACCGACTAACAATTACGCGAAAAGACATTATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATAATAAACTTCTATATGAATCTTCTAATGGAACGAAGCAAACGGAAAGGCTTACCAACAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTGAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTATTGGTACCAATTCATCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTAAGAAAAAAGTCCATCACCTACTTTGATTCAATGGGTGGATTAAACAATGATGCGTGCAGAATATTGCTACAATACCTGAAACAGGAAAGCGTTGACAAAAAAGGAGCATGTTTTGACTCAAATGGTTGGACCCTAACCTGCAAGACGAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCCATCACCTTTACACAGCATCATATGCCCTATTTCAGAAAGAGAATGGTTTGGGAGATCCTTCATCAAAAATTGCTTTGACATTACTATGGAGGGACTTTGGAAGCTTAGCCATTTTACTGGTTGCGGCAAGTTTCTCAGACCAGAACACGGACCAAGAACTATTTGATTTCTCTCTACGCACAGGTTTACAGCTATCAAAAAAATAATGCTTGTACTGTTATGAATTACTACTCTTCTTATTTTTTAACATATTTGCCAAATTTTTTTTAGTATAATTTTTTTTTTCTTTACAATAAAAGAAAAAAGACCTGTAAATCTTCAGAGAAAACTATTTTATTTATATGTCTGACAGGGCTCAGAAGCGAAGAACACTGAGTTCATTTTTATATAAACTATTTGGCATTTGATAATTGTTTGTTTTGTTCAGAGGCAAGCCTTCTGGCTTTATATTATATCCAAGGCTTTCCTTTGAACTAGATGTTGGTGTTTGTGTACCATTTGCAGCACTGTTTGCTCTGTTCATGAGCTGTCATTTTGTACTTTGTAAAACGAAAAAACGAAAAAAACTTTATATTTACAAGAATGTCAACTTTTTTTAGACCTATTATACTCACCTGTGACACCACAAATAGCTTGTTGATTTCTATGTTTTGTACAGGCAATAACTATTATTTCTGGGATTTTGTATGTACTTTGCTTTATTCTTTTACAGATTTATCTTGAAACTGATTTATGCGTACTAAAAGTATAAGCTGGGTTACATTTGCAGACTTTTTTTCCCTGTAATTCAGCAGTTCATCTTCAGGCTACCTCAACTGGTTTCTAAAAATGTAACAAAATAGGGTAATCTCTACAGAGGTGAATGTATTGCGGCCTTTCGAGAGTCCCCCCATAGTAAGTGGATGCACAGTAAGGCAGTTTTTTTGACCAGAAGCTCTATGTTTTGGGCTTTAGTTCTAGATGGCTAATTACTAGTTTGGCAGTCCTGCAAAGGCCTATTTCTGTCAAGTGCCTAATTACAGGGGCGGTTAACATGGAGGCACATTTACTTTTTCTAAAAAAAACACTTGTATCGGGATCTTTACCTTTTTGATAGGATAATTAGTGATGTCACGGAAACCTCACGCAAATCAGCTATGTTATTATTGGTTAAGGGGTGGACGTCTTAATATGTTTGCGTAGCAGAGTAAGTTGTGTAACGTACACTTAAAAATAATTTGTAGAGCACTTGGTAAAAATGTAAAACTGCTTCCAATTCATTGAAACAATTAAATAAAAAGCCAAACCAAACTGATTCTGTATCTTGGAGTCAAGAGTCCCATCACCCAGGAAATTTCTTTAGAAGTATAGCGAGTGTGTCCTATCCCCCTAATCCTAAAATATCTTTAGAAGCAGCATGGCCCGACAAAAGAAAAATGCTTTTTTGGTGGAGCAAATTCATTATAAAGATGAGTACATTGATTCGAAAGATGGTTGTATTTAGTAACTTGGACTAATAGATCAGGGAATGGGAAACCCTCAAAATTTATCTTGGATTTTTCTTATTGTATGGTTTGTCTTTTTTTTTTTTTTCCTATAAATATTTTCTTAGAGTGATGACTGTGGTTGAAACATAAAGATTTTATTTTA
                                                  Xl3.1-CHK-1012721607                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAACCACAACTTTATTGAAACGCCGGCGAACAACAACAACACAGGCAATTTCGGACCGATCAATATTATGACACTACTTTGTTGATGTGCGTGTGTCCCCGTTGCCTTCCCGTGTGTGGCGGGAATAATTTGATTCATAGTTTCTCTAGTCGTATTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAGCAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCTAAAGGAGTGTCATCTCAGAAACCAAGAGTACCTAGGTCTGCCCACATGGAAGCACGAAAACTGAGTGGAGCTTTAAATGCTGCTTCGGGAAAACCAAATCATACTCTTGCATCAGCTTATGAAAAATCCTTTCCATTTAAGAACATTTCATGTTCAGCTTCATTGATTGGACCTTGTCGTCGAAGCCCTAAAAAAACACAGAGGCGCTTTGTCAGTACAGTTGAAGAAACAGTACGCGAGGAAGAAAAGGAAATATACAGGCAGCTACTTCAGGTTGTGACGGGAAAAAxCxTTTTTATCCACCAAGTCTACATCCATTCTGCCTCCACAGGTGTCTAGATGTTTAAGTTCAGATAACAGTATATCTGGACAAACTGTTGCTTCAAGTTTGAGTTCTCTAGAGCCCAGTAGTTTGGATACAGAATCTTCATGTCGAACATCATTTAGCTATTTGCAGCCATCAGGTCAAATTTCAGAAGCAATTCTAAGCAACTCAACAAATTTCAAAGTAATTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGCATGCTCCTAGCTCACAGCAGTCTCAAGGTTTAGATTCGCCCATTGTATTGGATTCGCCTGTTGTCAAACCTCGAGAACCCGCTAGTCAACCTTTCTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGATCACGAGAAAGAAGGCGTCAAATTGAAGAACAGGAAGCACTTGCCTTACAACTTCAAAAACAGAGGCTTCAAGAATGTTCAGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCCGAAGCAAGAGGAGTCCCCCAAACCTGAAGAGATTGAATTCCCTGAAATTACAGAGGTTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGGAGCCAAGATCAGTCTTTAAGTGAAGGGTACCGACTAACAATTACGCGAAAAGACATTATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATAATAAACTTCTATATGAATCTTCTAATGGAACGAAGCAAACGGAAAGGCTTACCAACAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTGAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTATTGGTACCAATTCATCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTAAGAAAAAAGTCCATCACCTACTTTGATTCAATGGGTGGATTAAACAATGATGCGTGCAGAATATTGCTACAATACCTGAAACAGGAAAGCGTTGACAAAAAAGGAGCATGTTTTGACTCAAATGGTTGGACCCTAACCTGCAAGACGAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCCATCACCTTTACACAGCATCATATGCCCTATTTCAGAAAGAGAATGGTTTGGGAGATCCTTCATCAAAAATTGCTTTGACATTACTATGGAGGGACTTTGGAAGCTTAGCCATTTTACTGGTTGCGGCAAGTTTCTCAGACCAGAACACGGACCAAGAACTATTTGATTTCTCTCTACGCACAGGTTTACAGCTATCAAAAAAATAATGCTTGTACTGTTATGAATTACTACTCTTCTTATTTTTTAACATATTTGCCAAATTTTTTTTAGTATAATTTTTTTTTTCTTTACAATAAAAGAAAAAAGACCTGTAAATCTTCAGAGAAAACTATTTTATTTATATGTCTGACAGGGCTCAGAAGCGAAGAACACTGAGTTCATTTTTATATAAACTATTTGGCATTTGATAATTGTTTGTTTTGTTCAGAGGCAAGCCTTCTGGCTTTATATTATATCCAAGGCTTTCCTTTGAACTAGATGTTGGTGTTTGTGTACCATTTGCAGCACTGTTTGCTCTGTTCATGAGCTGTCATTTTGTACTTTGTAAAACGAAAAAACGAAAAAAACTTTATATTTACAAGAATGTCAACTTTTTTTAGACCTATTATACTCACCTGTGACACCACAAATAGCTTGTTGATTTCTATGTTTTGTACAGGCAATAACTATTATTTCTGGGATTTTGTATGTACTTTGCTTTATTCTTTTACAGATTTATCTTGAAACTGATTTATGCGTACTATAAGTATAAGCTGGGTTACATTTGCAGACTTTTTTTCCCTGTAATTCAGCAGTTCATCTTCAGGCTACCTCAACTGGTTTCTAAAAATGTAACAAAATAGGGTAATCTCTACAGAGGTGAATGTATTGCGGxxxxTCGAGAGTCCCCCCATAGTAAGTGGATGCACAGTAAGGCAGTTTTTTTGACCAGAAGCTCTATGTTTTGGGCTTTAGTTCTAGATGGCTAATTACTAGTTTGGCAGTCCTGCAAAGGCCTATTTCTGTCAAGTGCCTAATTACAGGGGCGGTTAACATGGAGGCACATTTACTTTTTCTAAAAAAAACACTTGTATCGGGATCTTTACCTTTTTGATAGGATAATTAGTGATGTCACGGAAACCTCACGCAAATCAGCTATGTTATTATTGGTTAAGGGGTGGACGTCTTAATATGTTTGCGTAGCAGAGTAAGTTGTGTAACGTACACTTAAAAATAATTTGTAGAGCACTTGGTAAAAATGTAAAACTGCTTCCAATTCATTGAAACAATTAAATAAAAAGCCAAACCAAACTGATTCTGTATCTTGGAGTCAAGAGTCCCATCACCCAGGAAATTTCTTTAGAAGTATAGCGAGTGTGTCCTATCCCCCTAATCCTAAAATATCTTTAGAAGCAGCATGGCCCGACAAAAGAAAAATGCTTTTTTGGTGGAGCAAATTCATTATAAAGATGAGTACATTGATTCGAAAGATGGTTGTATTTAGTAACTTGGACTAATAGATCAGGGAATGGGAAACCCTCAAAATTTATCTTGGATTTTTCTTATTGTATGGTTTGTCTTTTTTTTTTTTTTCCTATAAATATTTTCTTAGAGTGATGACTGTGGTTGAAACATAAAGATTTTATTTTATATCTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     3     4     3     5     3     5     4     6     4     6     4     6     4     6     4     6     4     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     6     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     3     5     2     5     2     5     2     5     2     6     3     6     3     6     4     7     4     6     3     6     3     6     3     6     3     6     4     7     4     6     3     5     3     5     3     5     3     5     3     5     3     6     3     6     4     7     5     6     6     7     6     7     6     7     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     1     3     2     3     2     3     2     3     2     3     2     2     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     4     5     4     5     5     5     4     5     4     5     4     5     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     1     1     1     1     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     1     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      ests                            Xl3.1-IMAGE:6640229.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTAAACAACCACAACTTTATTGAAACGCCGGCGAACAACAACAACACAGGCAATTTCGGACCGATCAATATTATGACACTACTTTGTTGATGTGCGTGTGTCCCCGTTGCCTTCCCGTGTGTGGCGGGAATAATTTGATTCATAGTTTCTCTAGTCGTATTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAGCAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCTAAAGGAGTGTCATCTCAGAAACCAAGAGTACCTAGGTCTGCCCACATGGAAGCACGAAAACTGAGTGGAGCTTTAAATGCTGCTTCGGGAAAACCAAATCATACTCTTGCATCAGCTTATGAAAAATCCTTTCCATTTAAGAACATTTCATGTTCAGCTTCATTGATTGGACCTTGTCGTCGAAGCCCTAAAAAAACACAGAGGCGCTTTGTCAGTACAGTTGAAGAAACAGTACGCGAGGAAGAAAAGGAAATATACAGGCAGCTACTTCAGGTTGTGACGGGAAAAAACCTTTTTATCCACCAAGTCTACATCCATTCTGCCTCCACAGGTGTCTAGATGTTTAAGTTCAGATAACAGTATATCTGGACAACCTGTTGCTTCAAGTTTGAGTTCTCTAGAGCCCAGTAGTTTGGATACAGAATCTTCATGTCGAACATCATTTAGCTATTTGCAGCCATCAGGTCAAATTTCAGAAGCAATTCTAAGCAACTCAACAAATTTCAAAGTAATTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGCATGCTCCTAGCTCACAGCAGTCTCAAGGTTTAGATTCGCCCATTGTATTGGATTCGCCTGTTGTCAAACCTCGAGAACCCGCTAGTCAACCTTTCTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGATCACGAGAAAGAAGGCGTCAAATTGAAGAACAGGAAGCACTTGCCTTACAACTTCAAAAACAGAGGCTTCAAGAATGTTCAGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCCGAAGCAAGAGGAGTCCCCCAAACCTGAAGAGATTGAATTCCCTGAAATTACAGAGGTTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGGAGCCAAGATCAGTCTTTAAGTGAAGGGTACCGACTAACAATTACGCGAAAAGACATTATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATAATAAACTTCTATATGAATCTTCTAATGGAACGAAGCAAACGGAAAGGCTTACCAACAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTGAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTATTGGTACCAATTCATCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTAAGAAAAAAGTCCATCACCTACTTTGATTCAATGGGTGGATTAAACAATGATGCGTGCAGAATATTGCTACAATACCTGAAACAGGAAAGCGTTGACAAAAAAGGAGCATGT
  5   1   2      ests                            Xl3.1-IMAGE:4058910.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCCATCACCTTTACACAGCATCATATGCCCTATTTCAGAAAGAGAATGGTTTGGGAGATCCTTCATCAAAAATTGCTTTGACATTACTATGGAGGGACTTTGGAAGCTTAGCCATTTTACTGGTTGCGGCAAGTTTCTCAGACCAGAACACGGACCAAGAACTATTTGATTTCTCTCTACGCACAGGTTTACAGCTATCAAAAAAATAATGCTTGTACTGTTATGAATTACTACTCTTCTTATTTTTTAACATATTTGCCAAATTTTTTTTAGTATAATTTTTTTTTTCTTTACAATAAAAGAAAAAAGACCTGTAAATCTTCAGAGAAAACTATTTTATTTATATGTCTGACAGGGCTCAGAAGCGAAGAACACTGAGTTCATTTTTATATAAACTATTTGGCATTTGATAATTGTTTGTTTTGTTCAGAGGCAAGCCTTCTGGCTTTATATTATATCCAAGGCTTTCCTTTGAACTAGATGTTGGTGTTTGTGTACCATTTGCAGCACTGTTTGCTCTGTTCATGAGCTGTCATTTTGTACTTTGTAAAACGAAAAAACGAAAAAAACTTTATATTTACAAGAATGTCAACTTTTTTTAGACCTATTATACTCACCTGTGACACCACAAATAGCTTGTTGATTTCTATGTTTTGTACAGGCAATAACTATTATTTCTGGGATTTTGTATGTACTTTGCTTTATTCTTTTACAGATTTATCTTGAAACTGATTTATGCGTACTATAAGTATAAGCTGGGTTACATTTGCAGACTTTTTTTCCCTGTAATTCAGCAGTTCATCTTCAGGCTACCTCAACTGGTTTCTAAAAATGTAACAAAATAGGGTAATCTCTACAGAGGTGAATGTATTGCGGTGTTTCGAGAGTCCCCCCATAGTAAGTGGATGCACAGTAAGGCAGTTTTTTTGACCAGAAGCTCTATGTTTTGGGCTTTAGTTCTAGATGGCTAATTACTAGTTTGGCAGTCCTGCAAAGGCCTATTTCTGTCAAGTGCCTAATTACAGGGGCGGTTAACATGGAGGCACATTTACTTTTTCTAAAAAAAACACTTGTATCGGGATCTTTACCTTTTTGATAGGATAATTAGTGATGTCACGGAAACCTCACGCAAATCAGCTATGTTATTATTGGTTAAGGGGTGGACGTCTTAATATGTTTGCGTAGCAGAGTAAGTTGTGTAACGTACACTTAAAAATAATTTGTAGAGCACTTGGTAAAAATGTAAAACTGCTTCCAATTCATTGAAACAATTAAATAAAAAGCCAAACCAAACTGATTCTGTATCTTGGAGTCAAGAGTCCCATCACCCAGGAAATTTCTTTAGAAGTATAGCGAGTGTGTCCTATCCCCCTAATCCTAAAATATCTTTAGAAGCAGCATGGCCCGACAAAAGAAAAATGCTTTTTTGGTGGAGCAAATTCATTATAAAGATGAGTACATTGATTCGAAAGATGGTTGTATTTAGTAACTTGGACTAATAGATCAGGGAATGGGAAACCCTCAAAATTTATCTTGGATTTTTCTTATTGTATGGTTTGTCTTTTTTTTTTTTTTCCTATAAATATTTTCTTAGAGTGATGACTGTGGTTGAAACATAAAGATTTTATTTTATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTAGCGTGAGA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GC----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                               BLH MIN     825     149                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 2e-010     NP_494914.1 protease (102.4 kD) (2F246) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 3e-033     AAI59394.1 Unknown (protein for IMAGE:7630415) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- At ---- 3e-040     NP_567478.1 Ulp1 protease family protein [Arabidopsis thaliana] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - ?? ---- 1e-041     XP_629677.1 hypothetical protein DDBDRAFT_0184304 [Dictyostelium discoideum AX4] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Os ---- 4e-042     NP_001042999.1 Os01g0355900 [Oryza sativa (japonica cultivar-group)] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 5e-053     NP_573362.1 CG12359-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ==== 5e-073     XP_001187178.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - ?? ---- 1e-076     XP_001790172.1 PREDICTED: SUMO1/sentrin/SMT3 specific peptidase 2 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Dr ---- 1e-125     XP_001343517.1 PREDICTED: wu:fj98g07 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 5e-142     NP_055369.1 sentrin/SUMO-specific protease 1 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Mm ---- 6e-143     NP_659100.1 RIKEN cDNA E330036L07 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Cf ---- 3e-144     XP_534823.2 PREDICTED: similar to Sentrin-specific protease 1 (Sentrin/SUMO-specific protease SENP1) [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Gg ---- 9e-168     XP_423848.2 PREDICTED: similar to sentrin/SUMO-specific protease [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Xl ---- 0          NP_001082507.1 SUMO-specific protease U1p1 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:6640229.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAA---------------------------------------------------------------------TGA------------------------------------------------------TAA---------TAG------TAG------------------------------------------------------------------------------ATGTAA---------------ATGATGATG------------------------------------------------------------------------------ATG------------------------------------------------------TGA------------------------------------ATG---------------------------TGA---------------------TAA---------------ATG---ATG---------------------------------------------------------------------------------TGA---------TAAATG---------------------------------------ATG------------------------------------------TGA---------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------ATG------------------ATG------------------------------TGA---------------------------TAG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TAG------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------TAGATG------------------------------------------TGA---------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------TGA---TGA---ATG------------------------------------------------TAA------------------------------------------ATGTAA------------------------------------------------------------------------------------------TGA------------------------TAG---TAGATG---------TAG------------------------------------------------------TAA------------------------------------------------------------------TAA------ATG------------------------------------------------------------ATG------TAG------------------------------------------------------------------------------TGA------TAA---------------------------------------------------------------------------TAG------------------------------------TAG------------------------------------------------------TAA---TGA------TGA---------------------------------------------------------------------------------------ATG------------------------------------------TGATGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2      ests                            Xl3.1-IMAGE:6640229.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTAAACAACCACAACTTTATTGAAACGCCGGCGAACAACAACAACACAGGCAATTTCGGACCGATCAATATTATGACACTACTTTGTTGATGTGCGTGTGTCCCCGTTGCCTTCCCGTGTGTGGCGGGAATAATTTGATTCATAGTTTCTCTAGTCGTATTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAGCAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCTAAAGGAGTGTCATCTCAGAAACCAAGAGTACCTAGGTCTGCCCACATGGAAGCACGAAAACTGAGTGGAGCTTTAAATGCTGCTTCGGGAAAACCAAATCATACTCTTGCATCAGCTTATGAAAAATCCTTTCCATTTAAGAACATTTCATGTTCAGCTTCATTGATTGGACCTTGTCGTCGAAGCCCTAAAAAAACACAGAGGCGCTTTGTCAGTACAGTTGAAGAAACAGTACGCGAGGAAGAAAAGGAAATATACAGGCAGCTACTTCAGGTTGTGACGGGAAAAAACCTTTTTATCCACCAAGTCTACATCCATTCTGCCTCCACAGGTGTCTAGATGTTTAAGTTCAGATAACAGTATATCTGGACAACCTGTTGCTTCAAGTTTGAGTTCTCTAGAGCCCAGTAGTTTGGATACAGAATCTTCATGTCGAACATCATTTAGCTATTTGCAGCCATCAGGTCAAATTTCAGAAGCAATTCTAAGCAACTCAACAAATTTCAAAGTAATTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGCATGCTCCTAGCTCACAGCAGTCTCAAGGTTTAGATTCGCCCATTGTATTGGATTCGCCTGTTGTCAAACCTCGAGAACCCGCTAGTCAACCTTTCTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGATCACGAGAAAGAAGGCGTCAAATTGAAGAACAGGAAGCACTTGCCTTACAACTTCAAAAACAGAGGCTTCAAGAATGTTCAGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCCGAAGCAAGAGGAGTCCCCCAAACCTGAAGAGATTGAATTCCCTGAAATTACAGAGGTTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGGAGCCAAGATCAGTCTTTAAGTGAAGGGTACCGACTAACAATTACGCGAAAAGACATTATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATAATAAACTTCTATATGAATCTTCTAATGGAACGAAGCAAACGGAAAGGCTTACCAACAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTGAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTATTGGTACCAATTCATCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTAAGAAAAAAGTCCATCACCTACTTTGATTCAATGGGTGGATTAAACAATGATGCGTGCAGAATATTGCTACAATACCTGAAACAGGAAAGCGTTGACAAAAAAGGAGCATGT
                                                  Xl3.1-CHK-1012691040                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAACCACAACTTTATTGAAACGCCGGCGAACAACAACAACACAGGCAATTTCGGACCGATCAATATTATGACACTACTTTGTTGATGTGCGTGTGTCCCCGTTGCCTTCCCGTGTGTGGCGGGAATAATTTGATTCATAGTTTCTCTAGTCGTATTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAGCAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCTAAAGGAGTGTCATCTCAGAAACCAAGAGTACCTAGGTCTGCCCACATGGAAGCACGAAAACTGAGTGGAGCTTTAAATGCTGCTTCGGGAAAACCAAATCATACTCTTGCATCAGCTTATGAAAAATCCTTTCCATTTAAGAACATTTCATGTTCAGCTTCATTGATTGGACCTTGTCGTCGAAGCCCTAAAAAAACACAGAGGCGCTTTGTCAGTACAGTTGAAGAAACAGTACGCGAGGAAGAAAAGGAAATATACAGGCAGCTACTTCAGGTTGTGACGGGAAAAAxCxTTTTTATCCACCAAGTCTACATCCATTCTGCCTCCACAGGTGTCTAGATGTTTAAGTTCAGATAACAGTATATCTGGACAAACTGTTGCTTCAAGTTTGAGTTCTCTAGAGCCCAGTAGTTTGGATACAGAATCTTCATGTCGAACATCATTTAGCTATTTGCAGCCATCAGGTCAAATTTCAGAAGCAATTCTAAGCAACTCAACAAATTTCAAAGTAATTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGCATGCTCCTAGCTCACAGCAGTCTCAAGGTTTAGATTCGCCCATTGTATTGGATTCGCCTGTTGTCAAACCTCGAGAACCCGCTAGTCAACCTTTCTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGATCACGAGAAAGAAGGCGTCAAATTGAAGAACAGGAAGCACTTGCCTTACAACTTCAAAAACAGAGGCTTCAAGAATGTTCAGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCCGAAGCAAGAGGAGTCCCCCAAACCTGAAGAGATTGAATTCCCTGAAATTACAGAGGTTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGGAGCCAAGATCAGTCTTTAAGTGAAGGGTACCGACTAACAATTACGCGAAAAGACATTATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATAATAAACTTCTATATGAATCTTCTAATGGAACGAAGCAAACGGAAAGGCTTACCAACAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTGAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTATTGGTACCAATTCATCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTAAGAAAAAAGTCCATCACCTACTTTGATTCAATGGGTGGATTAAACAATGATGCGTGCAGAATATTGCTACAATACCTGAAACAGGAAAGCGTTGACAAAAAAGGAGCATGTTTTGAC
  5   1   2       bld DMZ  5g                              xl259m03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGGCTTCAACAGTGGTCACGTGCCTATCATTCTCTTTACACACACAGCGCTAGGAGGACACCCGCGGAAAAGGAACTCTCCCAGCCAAGGATTTATCCGTTTAAACAACCACAACTTTATTGAAACGCCGGCGAACAACAACAACACAGGCAATTTCGGACCGATCAATATTATGACACTACTTTGTTGATGTGCGTGTGTCCCCGTTGCCTTCCCGTGTGTGGCGGGAATAATTTGATTCATAGTTTCTCTAGTCGTATTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAGCAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCTAAAGGAGTGTCATCTCAGA
  5   1   2       bld Oo1  5g                         IMAGE:6862026.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTAAACAACCACAACTTTATTGAAACGCCGGCGAACAACAACAACACAGGCAATTTCGGACCGATCAATATTATGACACTACTTTGTTGATGTGCGTGTGTCCCCGTTGCCTTCCCGTGTGTGGCGGGAATAATTTGATTCATAGTTTCTCTAGTCGTATTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAGCAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCGAAAGGAGTGTTATCTCAGAAACCAAGAGTACCTAGGTCTGCCCACATGGAAGCACGAAAACTGAGTGGAGCTTTAAATGCTGCTTCGGGGAAACCAAATCATACTCTTGCATCAGCTTATGAAAAATCCTTTCCATTTAAGAACATTTCATGTTCAGCTTCATTGATTGGACCTTGTCGTCGAAGCCCTAAAAAAACACAGAGGCGCTTTGTCAGTACAGTTGAAAGAACAGTACGCGAGGGAAAAAAAGGAAATATACAGGGCAGCTACTTTCAGGTTGTGACGGGAAAAAAACCTTTTTTATCCACCCAAGTCTACATCCCATTCTGCCCTCT
  5   1   2       bld Lu1  5g                         IMAGE:4057456.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATATTATGACACTACTTTGTTGATGTGCGTGTGTCCCCGTTGCCTTCCCGTGTGTGGCGGGAATAATTTGATTCATAGTTTCTCTAGTCGTATTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGCAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTG
  5   1   2       bld Tbd7 5g3  in                         XL084o08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTACTTTGTTGATGTGCGTGTGTCCCCGTTGCCTTCCCGTGTGTGGCGGGAATAATTTGATTCATAGTTTCTCTAGTCGTATTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTACTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAACAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCTAAAGGAGTGTCATCTCAGAAACCAAGAGTACATAGGTCTGCCCACATGGAAGCACGAAAACTGAGTGGAGCTTTAAATGCTGCTTCGGGAAAACCAAATCATACTCTTGCATCAGCTTATGAAAAATCCTTTCCATTTAAGAACATTTCATGTTCAGCTTCA
  5   1   2       bld Ov1  5g                         IMAGE:6318364.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGTTGCCTTCCCGTGTGTGGCGGGAATAATTTGATTCATAGTTTCTCTAGTCGTATTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGCAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAACAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCTAAAGGAGTGTCATCTCAGAAACCCAGAGTACCTAGGTCTGCCCACATGGAAGCACGAAAACTGAGTGGAGCTTTAAATGCTGCTTCGGGAAAACCAATCATACTCCTGCATCAGCTTATGAAAAATCCCTTTTCATTTTAAGAACATTTTCATGTTCAGCTTCCTTTGAATTGGACCCTTGGCCTCCCAAAGCCCCTaaaaaaaaaCCCCAAAGGGGGCTTTTTGGTCAGTTACAGGTTGGAAAGAAACCACGTTCCCCCcggggggaagaaaaaagggggaaatttttttccgggggagggcttttcttttccaggggttttggggcacgggggaaaaaaaacccctttttttttatctccccccccaaggggggttaaaacattcccccaattttttcggggccccccc
  5   1   2       bld Oo1  5g                         IMAGE:6640229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGGATAATTTGATTCATAGTTTCTCTAGTCGTATTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAGCAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCGAAAGGAGTGTTATCTCAGAAACCAAGAGTACCTAGGTCTGCCCACATGGAAGCACGAAAACTGAGTGGAGCTTTAAATGCTGCTTCGGGGAAACCAAATCATACTCTTGCATCAGCTTATGAAAAATCCTTTCCATTTAAGAACATTTCATGTTCAGCTTCATTGATTGGACCTTGTCGTCGAAGCCCTAAAAAAACACAGAGGCGCTTTGTCAGTACAGTTGAAGAAACAGTACGCGAGGAAGAAAAGGAAATATACAGGCAGCTACTTCAGGTTGTGACGGGAAAAACCTTTTTTATCCACCAAGTCTACATCCATTCTGCCTCCACAGGTGTCTAAGATGTTTAAGTTCAGATAACAGTATATCTGGACAACCTGGTGCTTTCAAGTTTGAGTTCTCTAGAGCCCAGTAGTTTGGATACAGAAATCTTCATGTCGAACATCATTTAGCTATTTGCAGCCATCAGGGTCAAATTTTCGAAGCAATTCTAAGCAACTCAACAAATTTCA
  5   1   2       bld Oo1  5g                         IMAGE:6640516.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGGCTCGACTAGCGTGAGAGCAGTTACTTATTTCTGGAGCATACCAGTGATGTAACAGACGTTAATATGGATGATGATGTTAAAGAAATGGTTTGGGAGAGTGAAAATAACTCTACATTTAAAGCACATTATAAAGAGACTGCACACAATTCCTCTTATGCCTTCAACTTTCAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAGCAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCGAAAGGAGTGTTATCTCAGAAACCAAGAGTACCTAGGTCTGCCCACATGGAAGCACGAAAACTGAGTGGAGCTTTAAATGCTGCTTCGGNGAAACCAAATCATACTCTTGCATCAGCTTATGAAAAATCCTTTCCATTTAAGAACATTTCATGTTCAGCTTCATTGATTGGACCTTGTCGTCGAAGCCCTAAAAAAACACAGAGGCGCTTTGTCAGTACAGTTGAAGAAAACAGTACGCGAGGAAGAAAAGGAAATATACAGGCAGCTACTTCAGGTTGTGACGGGAAAAACCTTTTTATCCACCAAGTCTACATCCATTCTGCCTCCACAGGTGTCTAGATGTTTAAGTTCAGATAACAGTATATCTGGACAAACTGTTGCTTCAAGTTTGAGTTCTCTAGAGCCCAGTAGGTTTGGATACAGAAATCTTCATGTCGAACAATCATTTAGCTATTTGCAGCCATCAGGTCAAATTTCAGAAGCAATTCTAAGCAACTCAACAAATTTCAAAGTAATTTCTGACACGCAGGGAGCAGTAACCAGCAGCTTCCTAAAGAAAG
  5   1   2       bld Ga12      in                         XL215l04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCTTCAGCTCGACGTCCTGTCGTGAGGGCTCGACTAGCGTGAGAGTTTCCTGCATTGCAATATAAGCATTTTGAGATATCGGGAATGAATTCTATTCATAAACCAAATTTTGTCTCAGAAAAATATGAGAGAGCTATACCACCAGGAGACAAAATGATACCACAGCAATCCTCTGAATTAACGAAAGGAAAGCAAAATGGGAATGGGTACGCTGTGCTTCCTGCTAAAGGAGTGTCATCTCAGAAACCAAGAGTACCTAGGTCTGCCCACATGGAAGCACGAAAACTGAGTGGAGCTTTAAATGCTGCTTCGGGAAAACCAAATCATACTCTTGCATCAGCTTATGAAAAATCCTTTCCATTTAAGAACATTTCATGTTCAGCTTCATTGATTGGACCTTGTCGTCGAAGCCCTAAAAAAACACAGAGGCGCTTTGTCAGTACAGTTGAAGAAACAGTACGCGAGGAAGAAAAGGAAATATACAGGCAGCTACTTCAGGTTGTGACGGGAAAAACCTTTTTATCCACCAAGTCTACATCCATTCTGCCTCCACAGGTGTCTAGATGTTTAAGTTCAGATAACAGTATATCTGGACAACCTGTTGCTTCAAGTTTGAGTTCTCTAGAGCCC
  5   1   2       bld Ga12                                 XL164h20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCAGGTTGTGACGGGAAAAACCTTTTTATCCACCAAGTCTACATCCATTCTGCCTCCACAGGTGTCTAGATGTTTAAGTTCAGATAACAGTATATCTGGACAACCTGTTGCTTCAAGTTTGAGTTCTCTAGAGCCCAGTAGTTTGGATACAGAATCTTCATGTCGAACATCATTTAGCTATTTGCAGCCATCAGGTCAAATTTCAGAAGCAATTCTAAGCAACTCAACAAATTTCAAAGTAATTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGCATGCTCCTAGCTCACAGCAGTCTCAAGGTTTAGATTCGCCCATTGTATTGGATTCGCCTGTTGTCAAACCTCGAGAACCCGCTAGTCAACCTTTCTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGATCACGAGAAAGAAGGCGTCAAATTGAAGAACAGGAAGCACTTGCCTTACAACTTCAAAAACAGAGGCTTCAAGAATGTTCAGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCCGAAGCAAGAGGAGTCCCCCAAACCTGAAG
  5   1   2       bld Oo1       out                   IMAGE:5078460.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTCTACATCCATTTTGCCCCCACAGGTGTCTAGATGTTTGAGTTCAAATAACAGTATTTCTGGGCAACCTGTTGCTTCAAGTTTGAGTTCTGTAGAGCCCAGTAGTTTGGATACAGAATCTTCATGTCGAACATCATTTAGCTATTTGCAGCCATCAGGTCAAATTTCAGAACCGCTTCTAAGCAACTCAACAAATTACAAAGTCATTTCTGACACACAAGGAGCAAGTAACCAGCAGCCTCCTAAAGAAAAGCTTGCTCCTAGATCACAACAGTCTCGAGGTTCA
  5   1   2       bld Ooc1      in                      xlnoc002g14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGCTTCAAGTTTGAGTTCTCTAGAGCCCAGTAGTTTGGATACAGAATCTTCATGTCGAACATCATTTAGCTATTTGCAGCCATCAGGTCAAATTTCAGAAGCAATTCTAAGCAACTCAACAAATTTCAAAGTAATTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGCATGCTCCTAGCTCACAGCAGTCTCAAGGTTTAGATTCGCCCATTGTATTGGATTCGCCTGTTGTCAAACCTCGAGAACCCGCTAGTCAACCTTTCTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGATCACGAGAAAGAAGGCGTCAAATTGAAGAACAGGAAGCACTTGCCTTACAACTTCAAAAACAGAGGCTTCAAGAATGTTCAGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAG
  5   1   2      seed Oo1                    IMAGE:6637770-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCCCCGGGCATTCCCGGGATGCAACTCAACAAATTTCAAAGTAATTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGCATGCTCCTAGCTCACAGCAGTCTCAAGGTTTAGATTCGCCCATTGTATTGGATTCGCCTGTTGTCAAACCTCGAGAACCCGCTAGTCAACCTTTCTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGATCACGAGAAAGAAGGCGTCAAATTGAAGAACAGGAAGCACTTGCCTTACAACTTCAAAAACAGAGGCTTCAAGAATGTTCAGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCCGAAGCAAGAGGAGTCCCCCAAACCTGAAGAGATTGAATTCCCTGAAATTACAGAGGTTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGGAGCCAAGATCAGTCTTTAAGTGAAGGGTACCGACTAACAATTACGCGAAAAGACATTATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATAATAAACTTCTATATGAATCTTCTAATGGAACGAAGCAAACGGAAAGGCTTACCAACAGTTCATGCTTTCAATACAtttttttttACCAAGTTGAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTATTGGTACC
  5   1   2       bld Oo1                             IMAGE:6637770.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCATGAAAGGGGACAAATTTCAAAGTAATTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGCATGCTCCTAGCTCACAGCAGTCTCAAGGTTTAGATTCGCCCATTGTATTGGATTCGCCTGTTGTCAAACCTCGAGAACCCGCTAGTCAACCTTTCTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGATCACGAGAAAGAAGGCGTCAAATTGAAGAACAGGAAGCACTTGCCTTACAACTTCAAAAACAGAGGCTTCAAGAATGTTCAGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCCGAAGCAAGAGGAGTCCCCCAAACCTGAAGAGATTGAATTCCCTGAAATTACAGAGGTTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGGAGCCAAGATCAGTCTTTAAGTGAAGGGTACCGACTAACAATTACGCGAAAAGACATTATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATAATAAACTTCTATATGAATCTTCTAATGGAACGAAGCAAACGGAAAGGCTTACCAACAGTTCATGCTTTCAATACAtttttttttACCAAGTTGAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTATTGGTACCAATTCATCTTGGAGTACACTGGGTGTTTAGCAGTTGTAGACTTAAGAAAAAAGTCCATCACCTACTTTGATTCAATGGNGTGGATTANACAATGATGCGTGCAGAATATTGCTACAATACCTGGAACAGGAAAAGCGTTGACAAAAAAGGAGCATGTTTTTGACTCAAATGGGTTGGAACCCTAACCTGTCAAGACGAGGCGAGGGAAATCCCACA
  5   1   2       bld Brn1      in                    IMAGE:6950822.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAATTTCTGACACGCAAGGAGCAAGTAACCAGCAGCTTCCTAAAGAAAAGCATGCTCCTAGCTCACAGCAGTCTCAAGGTTTAGATTCGCCCATTGTATTGGATTCGCCTGTTGTCAAACCTCGAGAACCCGCTAGTCAACCTTTCTTCCATGCAGAGCTTTGGATTAAGGAACTCACCAGTTTGTTTGATTCAAGATCACGAGAAAGAAGGCGTCAAATTGAAGAACAGGAAGCACTTGCCTTACAACTTCAAAAACAGAGGCTTCAAGAATGTTCAGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCCGAAGCAAGAGGAGTCCCCCAAACCTGAAGAGATTGAATTCCCTGAAATTACAGAGGTTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGGAGCCAAGATCAGTCTTTAAGTGAAGGGTACCGACTAACAATTACGCGAAAAGACATTATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATAATAAACTTCTATATGAATCTTCTAATGGAACGAAGCAAACGGAAAGGCTTACCAACAGTTCATGCTTTCAATACAtttttttttACCAAGTTGAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTATTGGTACCAATTCATCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTAAGAAAAAAGTCCATCACCTACTTTTGATCAATGGGGTGGATTAAACAATGAAGCGTGCAGAATATTTGCCTCCAATACCTGGAAACAGGAAAGCGGTTGACCAAAAAAAGGAGCATGGTTTTTGGACTCA
  5   1   2       bld Neu7                                 XL041e10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAGGAAGCACTTGCCTTACAACTTCAAAAACAGAGGCTTCAAGAATGTTCAGTGCAAGACTCCATAGATTTGCACCTTCGTGTACCTCTTGAAAAAGAAATACCTGTTACATTAATTCCGAAGCAAGAGGAGTCCCCCAAACCTGAAGAGATTGAATTCCCTGAAATTACAGAGGTTATGGAAAGAGAGATTAAACGTGCTCTATTTGGTGGGAGCCAAGATCAGTCTTTAAGTGAAGGGTACCGACTAACAATTACGCGAAAAGACATTATGACTCTTCATAGTTTAAACTGGCTAAATGATGAGATAATAAACTTCTATATGAATCTTCTAATGGAACGAAGCAAACGGAAAGGCTTACCAACAGTTCATGCTTTCAATACAtttttttttACCAAGTTGAAATCTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTATTGGTACCAATTCATCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTAAGAAAAAAGTCCATCACCTACTTTGATTCAATGGGTGGATTAAACAATGATGCGTGCAGGATATTGCTACAATACCTGAAACAGGAAAGCGTTGACAAAAAAGGAGCATGTTTTGACTCAAA
  3   1   2       bld Ga12      in                         XL215l04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGCAAACGGAAAGGCTTACCAACAGTTCATGCTTTCAATACATTTTTTTTTACCAAGTTGAAATNTGCTGGATATCAAGCAGTGAAAAGATGGACAAAAAAGGTGGACATATTTTCAATGAATATTTTATTGGTACCAATTCATCTTGGAGTACACTGGTGTTTAGCAGTTGTAGACTTAAGAAAAAAGTCCATCACCTACTTTGATTCAATGGGTGGATTAAACAATGATGCGTGCAGAATATTGCTACAATACCTGAAACAGGAAAGCGTTGACAAAAAAGGAGCATGTTTTGACTCAAATGGTTGGACCCTAACCTGCAAGACGAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCCATCACCTTTACACAGCATCATATGCCCTATTTCAGAAAGAGAATGGTTTGGGAGATCCTTCATCAAAAATTGCTTTGACATTACTATGGAGGGACTTTGGAAGCTTAGCCATTTTACTGGTTGCGGCAAGTTTNTCAGACCAGAACACGGACCAAGAATTATTTGATTTCTCTNTACGCACAGGTTTACAGCTATCAAAAAAATAATGCTTGTACTGTTATGAATTACTACTCTTCTTATTTTTTAACCATATTT
  5   1   2      ests                            Xl3.1-IMAGE:4058910.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCCATCACCTTTACACAGCATCATATGCCCTATTTCAGAAAGAGAATGGTTTGGGAGATCCTTCATCAAAAATTGCTTTGACATTACTATGGAGGGACTTTGGAAGCTTAGCCATTTTACTGGTTGCGGCAAGTTTCTCAGACCAGAACACGGACCAAGAACTATTTGATTTCTCTCTACGCACAGGTTTACAGCTATCAAAAAAATAATGCTTGTACTGTTATGAATTACTACTCTTCTTATTTTTTAACATATTTGCCAAATTTTTTTTAGTATAATTTTTTTTTTCTTTACAATAAAAGAAAAAAGACCTGTAAATCTTCAGAGAAAACTATTTTATTTATATGTCTGACAGGGCTCAGAAGCGAAGAACACTGAGTTCATTTTTATATAAACTATTTGGCATTTGATAATTGTTTGTTTTGTTCAGAGGCAAGCCTTCTGGCTTTATATTATATCCAAGGCTTTCCTTTGAACTAGATGTTGGTGTTTGTGTACCATTTGCAGCACTGTTTGCTCTGTTCATGAGCTGTCATTTTGTACTTTGTAAAACGAAAAAACGAAAAAAACTTTATATTTACAAGAATGTCAACTTTTTTTAGACCTATTATACTCACCTGTGACACCACAAATAGCTTGTTGATTTCTATGTTTTGTACAGGCAATAACTATTATTTCTGGGATTTTGTATGTACTTTGCTTTATTCTTTTACAGATTTATCTTGAAACTGATTTATGCGTACTATAAGTATAAGCTGGGTTACATTTGCAGACTTTTTTTCCCTGTAATTCAGCAGTTCATCTTCAGGCTACCTCAACTGGTTTCTAAAAATGTAACAAAATAGGGTAATCTCTACAGAGGTGAATGTATTGCGGTGTTTCGAGAGTCCCCCCATAGTAAGTGGATGCACAGTAAGGCAGTTTTTTTGACCAGAAGCTCTATGTTTTGGGCTTTAGTTCTAGATGGCTAATTACTAGTTTGGCAGTCCTGCAAAGGCCTATTTCTGTCAAGTGCCTAATTACAGGGGCGGTTAACATGGAGGCACATTTACTTTTTCTAAAAAAAACACTTGTATCGGGATCTTTACCTTTTTGATAGGATAATTAGTGATGTCACGGAAACCTCACGCAAATCAGCTATGTTATTATTGGTTAAGGGGTGGACGTCTTAATATGTTTGCGTAGCAGAGTAAGTTGTGTAACGTACACTTAAAAATAATTTGTAGAGCACTTGGTAAAAATGTAAAACTGCTTCCAATTCATTGAAACAATTAAATAAAAAGCCAAACCAAACTGATTCTGTATCTTGGAGTCAAGAGTCCCATCACCCAGGAAATTTCTTTAGAAGTATAGCGAGTGTGTCCTATCCCCCTAATCCTAAAATATCTTTAGAAGCAGCATGGCCCGACAAAAGAAAAATGCTTTTTTGGTGGAGCAAATTCATTATAAAGATGAGTACATTGATTCGAAAGATGGTTGTATTTAGTAACTTGGACTAATAGATCAGGGAATGGGAAACCCTCAAAATTTATCTTGGATTTTTCTTATTGTATGGTTTGTCTTTTTTTTTTTTTTCCTATAAATATTTTCTTAGAGTGATGACTGTGGTTGAAACATAAAGATTTTATTTTATA
                                                  Xl3.1-CHK-1012696122                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCCATCACCTTTACACAGCATCATATGCCCTATTTCAGAAAGAGAATGGTTTGGGAGATCCTTCATCAAAAATTGCTTTGACATTACTATGGAGGGACTTTGGAAGCTTAGCCATTTTACTGGTTGCGGCAAGTTTCTCAGACCAGAACACGGACCAAGAACTATTTGATTTCTCTCTACGCACAGGTTTACAGCTATCAAAAAAATAATGCTTGTACTGTTATGAATTACTACTCTTCTTATTTTTTAACATATTTGCCAAATTTTTTTTAGTATAATTTTTTTTTTCTTTACAATAAAAGAAAAAAGACCTGTAAATCTTCAGAGAAAACTATTTTATTTATATGTCTGACAGGGCTCAGAAGCGAAGAACACTGAGTTCATTTTTATATAAACTATTTGGCATTTGATAATTGTTTGTTTTGTTCAGAGGCAAGCCTTCTGGCTTTATATTATATCCAAGGCTTTCCTTTGAACTAGATGTTGGTGTTTGTGTACCATTTGCAGCACTGTTTGCTCTGTTCATGAGCTGTCATTTTGTACTTTGTAAAACGAAAAAACGAAAAAAACTTTATATTTACAAGAATGTCAACTTTTTTTAGACCTATTATACTCACCTGTGACACCACAAATAGCTTGTTGATTTCTATGTTTTGTACAGGCAATAACTATTATTTCTGGGATTTTGTATGTACTTTGCTTTATTCTTTTACAGATTTATCTTGAAACTGATTTATGCGTACTAAAAGTATAAGCTGGGTTACATTTGCAGACTTTTTTTCCCTGTAATTCAGCAGTTCATCTTCAGGCTACCTCAACTGGTTTCTAAAAATGTAACAAAATAGGGTAATCTCTACAGAGGTGAATGTATTGCGGTGxxTCxxGAGTCCCCCCATAGTAAGTGGATGCACAGTAAGGCAGTTTTTTTGACCAGAAGCTCTATGTTTTGGGCTTTAGTTCTAGATGGCTAATTACTAGTTTGGCAGTCCTGCAAAGGCCTATTTCTGTCAAGTGCCTAATTACAGGGGCGGTTAACATGGAGGCACATTTACTTTTTCTAAAAAAAACACTTGTATCGGGATCTTTACCTTTTTGATAGGATAATTAGTGATGTCACGGAAACCTCACGCAAATCAGCTATGTTATTATTGGTTAAGGGGTGGACGTCTTAATATGTTTGCGTAGCAGAGTAAGTTGTGTAACGTACACTTAAAAATAATTTGTAGAGCACTTGGTAAAAATGTAAAACTGCTTCCAATTCATTGAAACAATTAAATAAAAAGCCAAACCAAACTGATTCTGTATCTTGGAGTCAAGAGTCCCATCACCCAGGAAATTTCTTTAGAAGTATAGCGAGTGTGTCCTATCCCCCTAATCCTAAAATATCTTTAGAAGCAGCATGGCCCGACAAAAGAAAAATGCTTTTTTGGTGGAGCAAATTCATTATAAAGATGAGTACATTGATTCGAAAGATGGTTGTATTTAGTAACTTGGACTAATAGATCAGGGAATGGGAAACCCTCAAAATTTATCTTGGATTTTTCTTATTGTATGGTTTGTCTTTTTTTTTTTTTTCCTATAAATATTTTCTTAGAGTGATGACTGTGGTTGAAACATAAAGATTTTATTTTATATCTTTC
  3   1   2       bld Ooc1      in                      xlnoc002g14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATGGTTGGACCCTAACCTGCAAGACGAGCGAGGAAATCCCACAACAAATGAATGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCCATCACCTTTACACAGCATCATATGCCCTATTTCAGAAAGAGAATGGTTTGGGAGATCCTTCATCAAAAATTGCTTTGACATTACTATGGAGGGACTTTGGAAGCTTAGCCATTTTACTGGTTGCGGCAAGTTTCTCAGACCAGAACACGGACCAAGAACTATTTGATTTCTCTCTACGCACAGGTTTACAGCTATCAAAAAAAATAATGCTTGTACTGTTATGAATTACTACTCTTCTTATTTTTTAACATATTTGCCAAATTTTTTTTAGTATAATTTTTTTTTTCTTTACAATAAAAGAAAAAAGACCTGTAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd4                            IMAGE:4058910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGCAGTGATTGTGGAATGTTTGCCTGCAAGTATGCAGATTATATCACCAAAGATAAGTCCATCACCTTTACACAGCATCATATGCCCTATTTCAGAAAGAGAATGGTTTGGGAGATCCTTCATCAAAAATTGCTTTGACATTACTATGGAGGGACTTTGGAAGCTTAGCCATTTTACTGGTTGCGGCAAGTTTCTCAGACCAGAACACGGACCAAGAACTATTTGATTTCTCTCTACGCACAGGTTTACAGCTATCAAAAAAATAATGCTTGTACTGTTATGAATTACTACTCTTCTTattttttaacatatttgccaaattttttttagtataattttttttttCTTTACAATAAAAGAAAAAAGACCTGTAAATCTTCAGAGAAAACTATTTTATTTATATGTCTGACAGGGCTCAGAAGCGAAGAACACTGAGTTCATTTTTATATAAACTGTTTGGCATTTGATAATTGTTTGTTTTGTTCAGAGGCAAGCCTTCTGGCTTTATATTATATCCAAGGCTTTCCTTTGAACTAGATGNTGGTGT
  5   1   2       bld Neu7                                 XL040p17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGATAAGTCCATCACCTTTACACAGCATCATATGCCCTATTTCAGAAAGAGAATGGTTTGGGAGATCCTTCATCAAAAATTGCTTTGACATTACTATGGAGGGACTTTGGAAGCTTAGCCATTTTACTGGTTGCGGCAAGTTTCTCAGACCAGAACACGGACCAAGAACTATTTGATTTCTCTCTACGCACAGGTTTACAGCTATCAAAAAAATAATGCTTGTACTGTTATGAATTACTACTCTTCTTATTTTTTAACATATTTGCCAAAttttttttagtataattttttttttCTTTACAATAAAANAAAAAAGACCTGTAAATNTTGAGAGAAAACTATTTTATTTATATGTCTGACAGGGCTCANAAGCGAANAACACTGAGTTCATTTTTATATAAACTGTTTGGCATTTGATAATTGTTTGTTTTGTTCANAGGCAAGCCTTCTGGCTTTATATTATATCCAAGGCTTTCCTTTGAACTA
  5   1   2       bld Egg1                               PBX0100C12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTCTCAGACCAGAACACGGACCAAGAACTATTTGATTTCTCTCTACGCACAGGTTTACAGCTATCAAAAAAATAATGCTTGTACTGTTATGAATTACTACTCTTCTTATTTTTTAACATATTTGCCAAAttttttttagtataattttttttttCTTTACAATAAAAGAAAAAAGACCTGTAAATCTTCAGAGAAAACTATTTTATTTATATGTCTGACAGGGCTCAGAAGCGAAGAACACTGAGTTCATTTTTATATAAACTATTTGGCATTTGATAATTGTTTGTTTTGTTCAGAGGCAAGCCTTCTGGCTTTATATTATATCCAAGGCTTTCCTTTGAACTAGATGTTGGTGTTTGTGTACCATTTGCAGCACTGTTTGCTCTGTTCATGAGCTGTCATTTTGTACTTTGTaaaacgaaaaaacgaaaaaaaCTTTATATTTACAAGAATGTCAACTTTTTTTAGACCTATTATACTCACCTGTGACACCACAAATAGCTTGTTGATTTCTATGTTTTGTACAGGCAATAACTATTATTTCTGGGATTTTGTATGTACTTTGCTTTATTCTTTTACAGATTTATCTTGAAACTGATTTATGCGTACTATAAGTA
  5   1   2      seed Egg1                               PBX0100D12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTCTCAGACCAGAACACGGACCAAGAACTATTTGATTTCTCTCTACGCACAGGTTTACAGCTATCAAAAAAATAATGCTTGTACTGTTATGAATTACTACTCTTCTTATTTTTTAACATATTTGCCAAAttttttttagtataattttttttttCTTTACAATAAAAGAAAAAAGACCTGTAAATCTTCAGAGAAAACTATTTTATTTATATGTCTGACAGGGCTCAGAAGCGAAGAACACTGAGTTCATTTTTATATAAACTATTTGGCATTTGATAATTGTTTGTTTTGTTCAGAGGCAAGCCTTCTGGCTTTATATTATATCCAAGGCTTTCCTTTGAACTAGATGTTGGTGTTTGTGTACCATTTGCAGCACTGTTTGCTCTGTTCATGAGCTGTCATTTTGTACTTTGTaaaacgaaaaaacgaaaaaaaCTTTATATTTACAAGAATGTCAACTTTTTTTAGACCTATTATACTCACCTGTGACACCACAAATAGCTTGTTGATTTCTATGTTTTGTACAGGCAATAACTATTATTTCTGGGATTTTGTATGTACTTTGCTTTATTCTTTTACAGATTTATCTTGAAACTGATTTATGCGTACTATAAGTAT
  3   1   2      skin Gas3      out                     xlnga003g07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACCTGTGACACCACAAATAGCTTGTTGATTTCTATGTTTTGTACAGGCAATAACTATTATTTCTGGGATTTTGTATGTACTTTGCTTTATTCTTTTACAGATTTATCTTGAAACTGATTTATGCGTACTAAAAGTATAAGCTGGGTTACATTTGCAGACTTTTTTTCCCTGTAATTCAGCAGTTCATCTTCAGGCTACCTCAACTGGTTTCTAAAAATGTAACAAAATAGGGTAAACTCTACAGAGGTGAATGTATTGCGGTGCCTCTCGA
  3   1   2       bld Brn1      in                    IMAGE:6950822.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCTGTAAATTCAAGCAGTTCCTTTTTCCAGGGCTTACCTCAAACTGGTTTTTTAAAAAATTGTAACAAAATAGGGGTATCTCCAACAGAGGGTGAATTGTATTGCGGTGCCTTTCGAGAGTCCCCCCATAGTAAGTGGATGCACAGTAAGGCAGTTTTTTTGACCAGAAGCTCTATGTTTTGGGCTTTAGTTCTAGATGGCTAATTACTAGTTTGGCAGTCCTGCAAAGGCCTATTTCTGTCAAGTGCCTAATTACAGGGGCGGTTAACATGGAGGCACATTTACTTTTTCTAAAAAAAACACTTGTATCGGGATCTTTACCTTTTTGATAGGATAATTAGTGATGTCACGGAAACCTCACGCAAATCAGCTATGTTATTATTGGTTAAGGGGTGGACGTCTTAATATGTTTGCGTAGCAGAGTAAGTTGTGTAACGTACACTTAAAAATAATTTGTAGAGCACTTGGTAAAAATGTAAAACTGCTTCCAATTCATTGAAACAATTAAATAAAAAGCCAAACCAAACTGATTCTGTATCTTGGAGTCAAGAGTCCCATCACCCAGGAAATTTCTTTAGAAGTATAGCGAGTGTGTCCTATCCCCCTAATCCTAAAATATCTTTAGAAGCAGCATGGCCCGACAAAAGAAAAATGCTTTTTTGGTGGAGCAAATTCATTATAAAGATGAGTACATTGATTCGAAAGATGGTTGTATTTAGTAACTTGGACTAATAGATCAGGGAATGGGAAACCCTCAAAATTTATCTTGGATTTTTCTTATTGTATGGTTTGTCTTTTTTTTTTTTTTCCTATAAATATTTTCTTAGAGTGATGACTGTGGTTGAAACATAAAGATTTTATTTTATATCTTTCAGG
  5   1   2      skin Egg1                               PBX0036C08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTTTTTCCCTGTAATTCAGCAGTTCATCTTCAGGCTACCTCAACTGGTTTCTAAAAATGTAACAAAATAGGGTAATCTCTACAGAGGTGAATGTATTGCGGTGCCTCTCGAGAGTCCCCCATAGTAAGTGGATGCACAGTAAGGCAGTTTTTTGACCAGAAGCTCTATGTTTTGGGCTTTAGTTCTAGATGGCTAATTACTAGTTTGGCAGTCCTGCAAAGGCCTATTTCTGTCAAGTGCCTAATTACAGGGGCAGTTAACATGGAGGCACATTTACGTTTTCTAAAAAACACTTGTATCGGGATCTTTACCTTTTTGATAGGATAATTAGTGATGTCACTGAAACCTCACTCACATCAGCTCTGTTATTATTGGTTAAGGGGTGGACGTCTTAATATGTTTGCGTA
  5   1   2      skin Egg1                               PBX0163E01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACGAGGGCGGTGCCTCTCGAGAGTCCCCCATAGTAAGTGGATGCACAGTAAGGCAGTTTTTTTGACCAGAAGCTCTATGTTTTGGGCTTTAGTTCTAGATGGCTAATTACTAGTTTGGCAGTCCTGCAAAGGCCTATTTCTGTCAAGTGCCTAATTACAGGGGCGGTTAACATGGAGGCACATTTACTTTTTCTaaaaaaaaCACTTGTATCGGGATCTTTACCTTTTTGATAGGATAATTAGTGATGTCACGGAAACCTCACGCAAATCAGCTATGTTATTATTGGTTAAAGGGTGGACGTCTTAATATGTTTGCGTAGCAGAGTAAGTTGTGTAACGTACACTTAAAAATAATTTGTACAGCACTTGGTAAAAATGTAAAACTGCTTCCAATTCATTGAAACAATTAAATAAAAAGCCAAACCAAACTGATTCTGTATCTTGGAGTCAAGAGTCCCATCACCCACGAAATTTCTTTACAAGT
  3   1   2      skin Tbd7 5g3  in                         XL084o08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCNCAAAATTTATCNTGGANTTTTCNTAATGNAAGGNTTGTNTTTTTTTTTTTTTTCCTATAAATATTTTCTTAGAGTGATGACTGTGGTTGAAACATAAAGATTTTATTTTATATCTTTCATGTGTTTATATGGACGTCTATATTTAAATAAACCAGTGAATAACATTCTTGCATTGCAATATGTTTCTTTTGGCATTTTGTTACTGGGTTCACTGGCCCACAAGCTCATGGGTTATTTGTAATAAATATGTATNAATTTGTATATATC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)