Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012838730 Xl3.1-xl304k08.5.5 - 28 ESTs
                                                                       .....-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xl304k08.5.5                                                                                                                                                                                                                                                                                                                                                                              CTCTCATTGCAATGCTTCTTCTCATTTGCCCATAATTACTGTCTCGTCTCTACACCCCCATGTGTTCTGTGAGCGGGGAGCTGCACCCTGGACTTTCTGCACCTGCCTTGCTTGGGATCGGTGGCTAGAGGGGTCGGCGGGGAGGCACAAGGTTGCTGGAAGCAGCAGCGAAGGAGAACATCCTCTGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGCAACTCAATCTCTGTTGCTGCTGAGCTTCATCTGCACCCTGGTGACCCCCCCTGGGCTGGCATGTGGACCTGGCCGAGGCATTGGCAAGAGGAGACACCCCAAAAAACTCACCCCTCTCGCCTATAAGCAGTTCATCCCCAACGTGGCGGAGAAGACCCTGGGGGCCAGCGGCAGATACGAAGGAAAGATTACAAGGAACTCGGATTGCTTTAAAGAATTAACCCCCAATTATAACCCAGATATTATGTTTAAAGACGAGGAGAGCACCGGGGCGGACCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAGGGGTGGGATGAGGACGGGCACCACTTGGAGGAGTCGCTACATTATGAGGGGAGGGCAGTGGACATCACTACGTCGGACCGGGACCGCAGTAAATACGGAATGTTGGGCCGACTGGCGGTGGAGGCCGGGTTCGACTGGGTCTATTACGAGTCCAAAGCTCATATTCACTGTTCGGTCAAAGCAGAGAACTCAGTGGCGGCCAAGTCTGGCGGGTGCTTCCCTGCTGGTGCCAGGGTGATGGTGGAATTTGGTGGCACCAAAGCGGTGAAAGACCTGCGACCAGGGGACCGCGTTCTCTCCTCCGACCCCCAAGGGAATCTGCTCTACAGCGACTTCCTCATGTTCATCGACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTTGTGGCCCAGACCAAGGTCAACGGCACCAGGTCGTTCAAGTCTGTCTTTGCCAGCAACATCCAACCAGGAGATCTCATTTATACAGCAGATCCCAAGACCATGACCTTGAAGGCGGTGAAAGTGGAGAAGGTTGATCTTGAGGAGGACACTGGAGCTTATGCGCCTCTAACTGCCCATGGGACTGTGGTTATAGACCAGGTATTGGCCTCCTG------------TGAGGAACACACCTGGGCACACCTCGCATTTGCCCCACTGAGGTTTGGCATGAGCCTCTCCTCTTATATTTACCCCAGAGACTCCAGTCCTCCATCAGGACTTCAGCCTCACCACCAAGTTGACCTTCAGTCTCACCATCAAGTTGATCTTCAGTCTCACCACCAAGTTGACCTTCAGTCTCACCACCAACTTGAAGGCATCCACTGGTACTCCCAGCTACTGTATCAGATAGGGACTTGGCTTTTGGACAGTAACTCCCTGCACCCACTGGGCATGGCAACGAAATCCAGTTGAAAAATACACATTTTCACTGCATAGACAAAAGACTTTATTTTTTAAGTAGAACTTAAAGTAGACACAAAAGGGAAAGAGCCCAGATTTTTCCTTTCATTGTTCTGTTTATTTTATTTCTCCTCTCCATCCTTTTTTTTAATATTTCGTATTTTCGGTGTTTTTTTTCTATTGTTTTTCGATTCCCTACTGAATATTTATTTGTTTGGCATTTGACTAGATGTTTAAAAAAATGGACATTGCAGAAGCCTTAAATAGTTACTTTGGTAATTTATTATCACTTATTGTGTCTTGGTANCCCCCCCCCCCAAAAAAAAACACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTAACCTCAAAAAAAAGAGTTTATTAGAAT
                                                  Xl3.1-CHK-1012722073                                                                                                                                                                                                                                                                                                                                                                                    AxxCxxTGCTTCTTCTCATTTGCCCATAATTACTGTCTCGTCTCTACACCCCCATGTGTTCTGTGAGCGGGGAGCTGCACCCTGGACTTTCTGCACCTGCCTTGCTTGGGATCGGTGGCTAGAGGGGTCGGCGGGGAGGCACAAGGTTGCTGGAAGCAGCAGCGAAGGAGAACATCCTCTGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGCAACTCAATCTCTGTTGCTGCTGAGCTTCATCTGCACCCTGGTGACCCCCCCTGGGCTGGCATGTGGACCTGGCCGAGGCATTGGCAAGAGGAGACACCCCAAAAAACTCACCCCTCTCGCCTATAAGCAGTTCATCCCCAACGTGGCGGAGAAGACCCTGGGGGCCAGCGGCAGATACGAAGGAAAGATTACAAGGAACTCGGATTGCTTTAAAGAATTAACCCCCAATTATAACCCAGATATTATGTTTAAAGACGAGGAGAGCACCGGGGCGGACCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAGGGGTGGGATGAGGACGGGCACCACTTGGAGGAGTCGCTACATTATGAGGGGAGGGCAGTGGACATCACTACGTCGGACCGGGACCGCAGTAAATACGGAATGTTGGGCCGACTGGCGGTGGAGGCCGGGTTCGACTGGGTCTATTACGAGTCCAAAGCTCATATTCACTGTTCGGTCAAAGCAGAGAACTCAGTGGCGGCCAAGTCTGGCGGGTGCTTCCCTGCTGGTGCCAGGGTGATGGTGGAATTTGGTGGCACCAAAGCGGTGAAAGACCTGCGACCAGGGGACCGCGTTCTCTCCTCCGACCCCCAAGGGAATCTGCTCTACAGCGACTTCCTCATGTTCATCGACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTTGTGGCCCAGACCAAGGTCAACGGCACCAGGTCGTTCAAGTCTGTCTTTGCCAGCAACATCCAACCAGGAGATCTCATTTATACAGCAGATCCCAAGACCATGACCTTGAAGGCGGTGAAAGTGGAGAAGGTTGATCTTGAGGAGGACACTGGAGCTTATGCGCCTCTAACTGCCCATGGGACTGTGGTTATAGACCAGGTATTGGCCTCCTGCTATGCAGTCATTGAGGAACACACCTGGGCACACCTCGCATTTGCCCCACTGAGGTTTGGCATGAGCCTCTCCTCTTATATTTACCCCAGAGACTCCAGTCCTCCATCAGGACTTCAGCCTCACCACCAAGTTGACCTTCAGTCTCACCATCAAGTTGATCTTCAGTCTCACCACCAAGTTGACCTTCAGTCTCACCACCAACTTGAAGGCATCCACTGGTACTCCCAGCTACTGTATCAGATAGGGACTTGGCTTTTGGACAGTAACTCCCTGCACCCACTGGGCATGGCAACGAAATCCAGTTGAAAAATACACATTTTCACTGCATAGACAAAAGACTTTATTTTTTAAGTAGAACTTAAAGTAGACACTAAAGGGAAAGAGCCCAGATTTTTCCTTTCATTGTTCTGTTTATTTTATTTCTCCTCTCCATCCTTTTTTTTAATATTTCGTATTTTCGGTGTTTTTTTTCTATTGTTTTTCGATTCCCTACTGAATATTTATTTGTTTGGCATTTGACTAGATGTTTAAAAAAATGGACATTGCAGAAGCCTTAAATAGTTACTTTGGTAATTTATTATCACTTATTGTGTCTTGGTxAxCCCCCCCCCCAAAAAAAAACACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTAACCTCAAAAAAAAGAGTTTAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                   2     4     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     6     2     6     2     6     2     6     2     6     3     6     2     6     3     6     3     6     3     6     3     6     3     6     4     7     4     7     4     7     4     7     4     7     4     7     7     7     6     7     7     7     7     7     7     7     7     7     7     7     5     9     7     9     7     9     9     9    10    10    10    10    10    10    10    10     9    10     8     9     9    10     9    10     8    10     8    10    10    10     9     9     8     8     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     5     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     3     5     3     4     2     4     0     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     6     4     6     5     6     5     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     8     5     9     5     9     4     9     6     9     6     9     6     9     6     9     6     9     6     9     3     7     3     7     3     7     3     8     3     9     5    12     8    12     9    11     8    10     9    10     9    10     9    11     9    11     9    11     9    11     9    11     9    12     9    12     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11     9    11     8    11     8    11     8    10     3     6
  5   1   2      en>5                                 Xl3.1-xl304k08.5                                                                                                                                                                                                                                                                                                                                                                              CTCTCATTGCAATGCTTCTTCTCATTTGCCCATAATTACTGTCTCGTCTCTACACCCCCATGTGTTCTGTGAGCGGGGAGCTGCACCCTGGACTTTCTGCACCTGCCTTGCTTGGGATCGGTGGCTAGAGGGGTCGGCGGGGAGGCACAAGGTTGCTGGAAGCAGCAGCGAAGGAGAACATCCTCTGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGCAACTCAATCTCTGTTGCTGCTGAGCTTCATCTGCACCCTGGTGACCCCCCCTGGGCTGGCATGTGGACCTGGCCGAGGCATTGGCAAGAGGAGACACCCCAAAAAACTCACCCCTCTCGCCTATAAGCAGTTCATCCCCAACGTGGCGGAGAAGACCCTGGGGGCCAGCGGCAGATACGAAGGAAAGATTACAAGGAACTCGGATTGCTTTAAAGAATTAACCCCCAATTATAACCCAGATATTATGTTTAAAGACGAGGAGAGCACCGGGGCGGACCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAGGGGTGGGATGAGGACGGGCACCACTTGGAGGAGTCGCTACATTATGAGGGGAGGGCAGTGGACATCACTACGTCGGACCGGGACCGCAGTAAATACGGAATGTTGGGCCGACTGGCGGTGGAGGCCGGGTTCGACTGGGTCTATTACGAGTCCAAAGCTCATATTCACTGTTCGGTCAAAGCAGAGAACTCAGTGGCGGCCAAGTCTGGCGGGTGCTTCCCTGCTGGTGCCAGGGTGATGGTGGAATTTGGTGGCACCAAAGCGGTGAAAGACCTGCGACCAGGGGACCGCGTTCTCTCCTCCGACCCCCAAGGGAATCTGCTCTACAGCGACTTCCTCATGTTCATCGACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTTGTGGCCCAGACCAAGGTCAACGGCACCAGGTCGTTCAAGTCTGTCTTTGCCAGCAACATCCAACCAGGAGATCTCATTTATACAGCAGATCCCAAGACCATGACCTTGAAGGCGGTGAAAGTGGAGAAGGTTGATCTTGAGGAGGACACTGGAGCTTATGCGCCTCTAACTGCCCATGGGACTGTGGTTATAGACCAGGTATTGGCCTCCTG------------TGAGGAACACACCTGGGCACACCTCGCATTTGCCCCACTGAGGTTTGGCATGAGCCTCTCCTCTTATATTTACCCCAGAGACTCCAGTCCTCCATCAGGACTTCAGCCTCACCACCAAGTTGACCTTCAGTCTCACCATCAAGTTGATCTTCAGTCTCACCACCAAGTTGACCTTCAGTCTCACCACCAACTTGAAGGCATCCACTGGTACTCCCAGCTACTGTATCAGATAGGGACTTGGCTTTTGGACAGTAACTCCCTGCACCCACTGGGCATGGCAACGAAATCCAGTTGAAAAATACACATTTTCACTGCATAGACAAAAGACTTTATTTTTTAAGTAGAACTTAAAGTAGACACAAAAGGGAAAGAGCCCAGATTTTTCCTTTCATTGTTCTGTTTATTTTATTTCTCCTCTCCATCCTTTTTTTTAATATTTCGTATTTTCGGTGTTTTTTTTCTATTGTTTTTCGATTCCCTACTGAATATTTATTTGTTTGGCATTTGACTAGATGTTTAAAAAAATGGACATTGCAGAAGCCTTAAATAGTTACTTTGGTAATTTATTATCACTTATTGTGTCTTGGTGAGCCCCCCCCC
  5   1   2      en>5                              Xl3.1-xlk155o04ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTAATATTTCGTATTTTTGGTGTTTTTTTTCTTATTGTTTTTCGATTTCCTACTGAATATTTATTTGTTTGGCATTTGACAGATGTTTAAAAAAAAATGGACATTGCAGAAGCCTTAAATAGTTACTTGTAATTTATTAT------------------------CCCCCCCCAAAAAAAAACACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTAACCTCAAAAAAAAGAGTTTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------T---
                                               BLH ATG     220     246                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH MIN     217     190                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH OVR     220     227                                                                                                                                                                                                                                                                                                                                                                              
                                               ORF LNG     220      21                                                                                                                                                                                                                                                                                                                                                                              
                                                                       PROTEIN --- Ce ---- 7e-014     NP_508597.2 WaRThog (hedgehog-like family) family member (wrt-6) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 8e-085     NP_001027635.1 hedgehog homolog 2 [Ciona intestinalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sp ---- 8e-092     NP_001012720.1 hedgehog [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 4e-092     NP_001034065.1 hedgehog CG4637-PB, isoform B [Drosophila melanogaster] ------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Bt ==== 1e-093     NP_001070338.2 Indian hedgehog homolog [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ag ---- 8e-098     XP_321721.4 AGAP001412-PA [Anopheles gambiae str. PEST] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - ?? ---- 4e-113     XP_001788921.1 PREDICTED: similar to Desert hedgehog protein precursor (DHH) (HHG-3) [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 1e-134     AAI66395.1 Unknown (protein for IMAGE:8954861) [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---= 7e-159     XP_001335817.1 PREDICTED: hypothetical protein [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Hs ---- 2e-159     NP_000184.1 sonic hedgehog preproprotein [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Cf ---- 5e-160     XP_850450.1 PREDICTED: similar to sonic hedgehog preproprotein isoform 2 [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 1e-163     NP_033196.1 sonic hedgehog; short digits [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Gg ==== 3e-164     NP_990152.1 sonic hedgehog [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 0          Q92000 Sonic hedgehog protein precursor (X-SHH) (VHH-1) [Xenopus laevis]  ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-xl304k08.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGA------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------TGA---------------------TAG------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------TAA---------------------------TAG---------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TAGTGA------------------------------------------------------------------------TAA---------------------------------TGAATG------------------TAG---------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------TAA------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2      en>5                                 Xl3.1-xl304k08.5                                                                                                                                                                                                                                                                                                                                                                              CTCTCATTGCAATGCTTCTTCTCATTTGCCCATAATTACTGTCTCGTCTCTACACCCCCATGTGTTCTGTGAGCGGGGAGCTGCACCCTGGACTTTCTGCACCTGCCTTGCTTGGGATCGGTGGCTAGAGGGGTCGGCGGGGAGGCACAAGGTTGCTGGAAGCAGCAGCGAAGGAGAACATCCTCTGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGCAACTCAATCTCTGTTGCTGCTGAGCTTCATCTGCACCCTGGTGACCCCCCCTGGGCTGGCATGTGGACCTGGCCGAGGCATTGGCAAGAGGAGACACCCCAAAAAACTCACCCCTCTCGCCTATAAGCAGTTCATCCCCAACGTGGCGGAGAAGACCCTGGGGGCCAGCGGCAGATACGAAGGAAAGATTACAAGGAACTCGGATTGCTTTAAAGAATTAACCCCCAATTATAACCCAGATATTATGTTTAAAGACGAGGAGAGCACCGGGGCGGACCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAGGGGTGGGATGAGGACGGGCACCACTTGGAGGAGTCGCTACATTATGAGGGGAGGGCAGTGGACATCACTACGTCGGACCGGGACCGCAGTAAATACGGAATGTTGGGCCGACTGGCGGTGGAGGCCGGGTTCGACTGGGTCTATTACGAGTCCAAAGCTCATATTCACTGTTCGGTCAAAGCAGAGAACTCAGTGGCGGCCAAGTCTGGCGGGTGCTTCCCTGCTGGTGCCAGGGTGATGGTGGAATTTGGTGGCACCAAAGCGGTGAAAGACCTGCGACCAGGGGACCGCGTTCTCTCCTCCGACCCCCAAGGGAATCTGCTCTACAGCGACTTCCTCATGTTCATCGACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTTGTGGCCCAGACCAAGGTCAACGGCACCAGGTCGTTCAAGTCTGTCTTTGCCAGCAACATCCAACCAGGAGATCTCATTTATACAGCAGATCCCAAGACCATGACCTTGAAGGCGGTGAAAGTGGAGAAGGTTGATCTTGAGGAGGACACTGGAGCTTATGCGCCTCTAACTGCCCATGGGACTGTGGTTATAGACCAGGTATTGGCCTCCTG------------TGAGGAACACACCTGGGCACACCTCGCATTTGCCCCACTGAGGTTTGGCATGAGCCTCTCCTCTTATATTTACCCCAGAGACTCCAGTCCTCCATCAGGACTTCAGCCTCACCACCAAGTTGACCTTCAGTCTCACCATCAAGTTGATCTTCAGTCTCACCACCAAGTTGACCTTCAGTCTCACCACCAACTTGAAGGCATCCACTGGTACTCCCAGCTACTGTATCAGATAGGGACTTGGCTTTTGGACAGTAACTCCCTGCACCCACTGGGCATGGCAACGAAATCCAGTTGAAAAATACACATTTTCACTGCATAGACAAAAGACTTTATTTTTTAAGTAGAACTTAAAGTAGACACAAAAGGGAAAGAGCCCAGATTTTTCCTTTCATTGTTCTGTTTATTTTATTTCTCCTCTCCATCCTTTTTTTTAATATTTCGTATTTTCGGTGTTTTTTTTCTATTGTTTTTCGATTCCCTACTGAATATTTATTTGTTTGGCATTTGACTAGATGTTTAAAAAAATGGACATTGCAGAAGCCTTAAATAGTTACTTTGGTAATTTATTATCACTTATTGTGTCTTGGTGAGCCCCCCCCC
                                                  Xl3.1-CHK-1012691097                                                                                                                                                                                                                                                                                                                                                                                    AxxCxxTGCTTCTTCTCATTTGCCCATAATTACTGTCTCGTCTCTACACCCCCATGTGTTCTGTGAGCGGGGAGCTGCACCCTGGACTTTCTGCACCTGCCTTGCTTGGGATCGGTGGCTAGAGGGGTCGGCGGGGAGGCACAAGGTTGCTGGAAGCAGCAGCGAAGGAGAACATCCTCTGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGCAACTCAATCTCTGTTGCTGCTGAGCTTCATCTGCACCCTGGTGACCCCCCCTGGGCTGGCATGTGGACCTGGCCGAGGCATTGGCAAGAGGAGACACCCCAAAAAACTCACCCCTCTCGCCTATAAGCAGTTCATCCCCAACGTGGCGGAGAAGACCCTGGGGGCCAGCGGCAGATACGAAGGAAAGATTACAAGGAACTCGGATTGCTTTAAAGAATTAACCCCCAATTATAACCCAGATATTATGTTTAAAGACGAGGAGAGCACCGGGGCGGACCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAGGGGTGGGATGAGGACGGGCACCACTTGGAGGAGTCGCTACATTATGAGGGGAGGGCAGTGGACATCACTACGTCGGACCGGGACCGCAGTAAATACGGAATGTTGGGCCGACTGGCGGTGGAGGCCGGGTTCGACTGGGTCTATTACGAGTCCAAAGCTCATATTCACTGTTCGGTCAAAGCAGAGAACTCAGTGGCGGCCAAGTCTGGCGGGTGCTTCCCTGCTGGTGCCAGGGTGATGGTGGAATTTGGTGGCACCAAAGCGGTGAAAGACCTGCGACCAGGGGACCGCGTTCTCTCCTCCGACCCCCAAGGGAATCTGCTCTACAGCGACTTCCTCATGTTCATCGACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTTGTGGCCCAGACCAAGGTCAACGGCACCAGGTCGTTCAAGTCTGTCTTTGCCAGCAACATCCAACCAGGAGATCTCATTTATACAGCAGATCCCAAGACCATGACCTTGAAGGCGGTGAAAGTGGAGAAGGTTGATCTTGAGGAGGACACTGGAGCTTATGCGCCTCTAACTGCCCATGGGACTGTGGTTATAGACCAGGTATTGGCCTCCTGCTATGCAGTCATTGAGGAACACACCTGGGCACACCTCGCATTTGCCCCACTGAGGTTTGGCATGAGCCTCTCCTCTTATATTTACCCCAGAGACTCCAGTCCTCCATCAGGACTTCAGCCTCACCACCAAGTTGACCTTCAGTCTCACCATCAAGTTGATCTTCAGTCTCACCACCAAGTTGACCTTCAGTCTCACCACCAACTTGAAGGCATCCACTGGTACTCCCAGCTACTGTATCAGATAGGGACTTGGCTTTTGGACAGTAACTCCCTGCACCCACTGGGCATGGCAACGAAATCCAGTTGAAAAATACACATTTTCACTGCATAGACAAAAGACTTTATTTTTTAAGTAGAACTTAAAGTAGACACTAAAGGGAAAGAGCCCAGATTTTTCCTTTCATTGTTCTGTTTATTTTATTTCTCCTCTCCATCCTTTTTTTTAATATTTCGTATTTTCGGTGTTTTTTTTCTATTGTTTTTCGATTCCCTACTGAATATTTATTTGTTTGGCATTTGACTAGATGTTTAAAAAAATGGACATTGCAGAAGCCTTAAATAGTTACTTTGGTAATTTATTATCACTTATTGTGTCTTGGTGAGCCCCCCCCCCCAAAA
  5   1   2       bld DMZ  5g3  in                         xl250b20.5p                                                                                                                                                                                                                                                                                                                                        GCTCGTCTCACAGGCGGTTGCAGCACCCTCCTTGCTCTCATTGCAATCTCTGCTTCTTCTCATTTGCCCATAATTACTGTCTCGTCTCTACACCCCCATGTGTTCTGTGAGCGGGGAGCTGCACCCTGGACTTTCTGCACCTGCCTTGCTTGGGATCGGTGGCTAGAGGGGTCGGCGGGGAGGCACAAGGTTGCTGGAAGCAGCAGCGAAGGAGAACATCCTCTGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGCAACTCAATCTCTGTTGCTGCTGAGCTTCATCTGCACCCTGGTGACCCCCCCTGGGCTGGCATGTGGACCTGGCCGAGGCATTGGCAAGAGGAGACACCCCAAAAAACTCACCCCTCTCGCCTATAAGCAGTTCATCCCCAACGTGGCGGAGAAGACCCTGGGGGCCAGCGGCAGATACGAAGGAAAGATTACAAGGAACTCGGATTGCTTTAAAGAATTAACCCCCAATTATAACCCAGATATTATGTTTAAAGACGAGGAGAGCACCGGGGCGGACCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAA
  5   1   2       add Ga18      in                       xlk53f02ex.5p                                                                                                                                                                                                                                                                                                                                                                  AGCACCCTCCTTGCTCTCATTGCAATCTCTGCTTCTTCTCATTTGCCCATAATTACTGTCTCGTCTCTACACCCCCATGTGTTCTGTGAGCGGNNNCNNCACCCTGGACTTTCTGCACCTGCCTTGCTTGGGATCGGTGGCTAGAGGGGTCGGCGAGGAGGCACAAGGTTGCTGNNNNNNCAGCNNAGGAGAACATCCTCTGAGCCTTTGATGTAATTGGCTTCNNTCGGACGAGATGCTGGTTGCGACTCAATCTCTGTTGCTGCTGAGCTTCATCTGCACCCTGGTGACCCCCCCTGNNTGGCATGTGGACCTGGCCGAGGNATTGGCAAGAGGAGACACCCCAAAAAACTCACCCCTCTCGCCTATAAGCAGTTCATCCCCAACGTGGCGGAGAAGACCCTGGGGCCAGNNNNNATACGAAGGAAAGATTACAAGGAACTCGGATTGCTTTAAAGAATTAACCCCCAATTATAACCCAGATATTATGTTTAAAGACGAGGAGAGCACCGGNNCGGACCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGANGNAGGGGTGGGATGAGGACGGGCACCACTTGGNNGAGNCGCTACATTATGAGGGGAGGGCAGNGGACATCACTACGTCGGACCGGGACCGCAGTAA
  5   1   2       add Ga18      in                      xlk125h16ex.5p                                                                                                                                                                                                                                                                                                                                                                    ACCCTCCTTGCTCTCATTGCAATCTCTGCTTCTTCTCATTTGCCCATAATTACTGTCTCGTCTCTACACCCCCATGTGTTCTGTGAGCGGNNNNNNCACCCTGGACTTTCTGCACCTGCCTTGCTTGGGATCGGTGGCTAGAGGGGTCGGCGGGGAGGCACAAGGTTGCTGNNNNNNCAGCNAAGGAGAACATCCTCTGAGCCTTTGATGTAATTGGCTTCNNTCGGACGAGATGCTGGTTGCAACTCAATCTCTGTTGCTGCTGAGCTTCATCTGCACCCTGGTGACCCCCCCTGGCTGGCATGTGGACCTGGCCGAGGNATTGGCAAGAGGAGACACCCCAAAAAACTCACCCCTCTCGCCTATAAGCAGTTCATCCCCAACGTGGCGGAGAAGACCCTGGGGGCCAGCNNNNATACGAAGGAAAGATTACAAGGAACTCGGATTGCTTTAAAGAATTAACCCCCAATTATAACCCAGATATTATGTTTAAAGACGAGGAGAGCACCGGGGCGGNCCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGANGGANGGGTGGGNNGAGGNNGGGCACCACTTGGAGGAGTNNCTACATTATGAGGGGAGGNNAGTGGACATCACTACGTCGGACCGGGACCGCAGTAAATAC
  5   1   2       add Ga18      in                        xlk1l02ex.5p                                                                                                                                                                                                                                                                                                                                                                        TCCTTGCTCTCATTGCAATCTCTGCTTCTTCTCATTTGCCCATAATTACTGTCTCGTCTCTACACCCCCATGTGTTCTGTGAGCGGNNNNNNCACCCTGGACTTTCTGCACCTGCCTTGCTTGGGATCGGTGGCTAGAGGGGTCGGCGAGGAGGCACAAGGTTGCTGNANNNNCAGCGAAGGAGAACATCCTCTGAGCCTTTGATGTAATTGGCTTCGNTCGGACGAGATGCTGGTTGCGACTCAATCTCTGTTGCTGCTGAGCTTCATCTGCACCCTGGTGACCCCCCCTGGNTGGCATGTGGACCTGGCCGAGNNATTGGNAAGAGGAGACACCCCAAAAAACTCACCCCTCTCGCCTATAAGCAGTTCATCCCCAACGTGGCGGAGAAGACCCTGGGGGCCAGCNNNNNTACGAAGGAAAGATTACAAGGAACTCGGATTGCTTTAAAGAATTAACCCCCAATTATAACCCAGATATTATGTTTAAAGACGAGGAGAGNACCGGGGCGGACCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGANGGAGGGGTGGGATGAGGANGGGCACCACTTGGAGGAGTCGCTACATTATGAGGGGNGGNNAGTGGACATCACCACGTCGGACCGGGACCNCAGTAAATACNGNAATGTTGGGCCGACTG
  5   1   2       bld DMZ  5g3  in                         xl319g06.5p                                                                                                                                                                                                                                                                                                                                                                                  GCAATCTCTGCTTCTTCTCATTTGCCCATAATTACTGTCTCGTCTCTACACCCCCATGTGTTCTGTGAGCGGGGAGCTGCACCCTGGACTTTCTGCACCTGCCTTGCTTGGGATCGGTGGCTAGAGGGGTCGGCGGGGAGGCACAAGGTTGCTGGAAGCAGCAGCGAAGGAGAACATCCTCTGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGCAACTCAATCTCTGTTGCTGCTGAGCTTCATCTGCACCCTGGTGACCCCCCCTGGGCTGGCATGTGGACCTGGCCGAGGCATTGGCAAGAGGAGACACCCCAAAAAACTCACCCCTCTCGCCTATAAGCAGTTCATCCCCAACGTGGCGGAGAAGACCCTGGGGGCCAGCGGCAGATACGAAGGAAAGATTACAAGGAACTCGGATTGCTTTAAAGAATTAACCCCCAATTATAACCCAGATATTATGTTTAAAGACGAGGAGAGCACCGGGGCGGACCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAGGGGTGGGATGAGGACGGGCACCACTTGGAGGAGTCGCTACATTATGAGGGGAGGGCAGTGGACATCACTAC
  5   1   2       add DMZ  5x3  out                        xl228b16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGAGCCTTTCATGTCATTGGCTTCGCTCGGACGAGATGTCGGTTGCGACTGGAATTCTGCTGTTGGGCTTCACCTGTTCCCTGCTGATCCCCCCCGGGTTGTCCTGTGGACCTGGCAGAGGAATTGGCAAGAGGAGACACCCCAAGAAACTCACCCCTCTCGTCTACAAACAGTTTATCCCCAACGTGGCGGAGAAGACCCTGGGGGCCAGCGGCAGATACGAAGGAAAGATCGCGAGCAACTCGGATCGCTTTAAAGAATTGACCCCCAATTATAACCCAGATATTGTATTTAAAGACGAGGAGAACACGGGGGCGGACCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCAATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAGGGGTGGGATGAGGACGGGCACCACTTGGAGGAGTCGTTACATTATGAGGGGAGGGCAGTGGACATCACCACGTCGGACCGGGACCGCAGTAAATACGGAATGTTGGCCCGACTGGCGGTGGAGGCCGGGTTCGACTGGGTCTATTACGAGTCCAAAGCTCATATTCACTGTTCGGTCAAAGCAGAGAACTCAGTGGCGGCCAAGTCTGGTGGTTGTTTCCCTGCTGGTGCCGAGGTGATGGTGGAACTTGGTGGCACCAAAGCGGTGAAAGACCTGCGCCCGGGGGACCGCGTCCTCTCCTCTGACGC
  5   1   2      seed DMZ                                  xl304k08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAAAAACTCACCCCTCTCGCCTATAAGCAGTTCATCCCCAACGTGGCGGAGAAGACCCTGGGGGCCAGCGGCAGATACGAAGGAAAGATTACAAGGAACTCGGATTGCTTTAAAGAATTAACCCCCAATTATAACCCAGATATTATGTTTAAAGACGAGGAGAGCACCGGGGCGGACCGGCTCATGACTCAGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAGGGGTGGGATGAGGACGGGCACCACTTGGAGGAGTCGCTGCATTATGAGGGGAGGGCAGTGGACATCACTACGTCGGACCGGGACCGCAGTAAATACGGAATGTTGGGCCGACTGGCGGTGGAGGCCGGGTTCGACTGGGTCTATTACGAGTCCAAAGCTCATATTCACTGTTCGGTCAAAGCAGAGAACTCAGTGGCGGCCAAGTCTGGCGGGTGCTTCCCTGCTGGTGCCAGGGTGATGGTGGAATTTGGTGGCACCAAAGCGGTGAAAGACCTGCGACCAGGGGACCGCGTTCTCTCCTCCGACCCCCAAGGGAATCTGCTCTACAGCGACTTCCTCATGTTCATCGACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTT
  5   1   2       bld Tbd3                   IMAGE:3550315-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCGGGGAGAGGGGAGAAGAGAGCGCCGGGTAATTAAAGGAGATGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAGGGGTGGGATGAGGACGGGCACCACTTGGAGGAGTCGCTACATTATGAGGGGAGGGCAGTGGACATCACTACGTCGGACCGGGACCGCAGTAAATACGGAATGTTGGGCCGACTGGCGGTGGAGGCCGGGTTCGACTGGGTCTATTACGAGTCCAAAGCTCATATTCACTGTTCGGTCAAAGCAGAGAACTCAGTGGCGGCCAAGTCTGGCGGGTGCTTCCCTGCTGGTGCCAGGGTGATGGTGGAATTTGGTGGCACCAAAGCGGTGAAAGACCTGCGACCAGGGGACCGCGTTCTCTCCTCCGACCCCCAAGGGAATCTGCTCTACAGCGACTTCCTCATGTTCATCGACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTTGTGGCCCAGACCAAGGTCAACGGCACCAGGTCGTTCAAGTCTGTCTTTGCCAGCAACATCCAACCAGGAGATCTCATTTATACAGCAGATCCCAAGACCATGACCTTGAAGGCGGTGAAAGTGGAGAAGGTTGATCTTGAGGAGGACACTGGAGCTTATGCGCCTCTAACTGCCCATGGGGACTGTGGTTATAGAC
  5   1   2       bld Tbd3                            IMAGE:3550315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNAGGGNACAANANGCGCCGGGTAATTAAAGGTGTTGTAAAGACAAACTGAACGCACTCGCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAGGGGTGGGATGAGGACGGGCACCACTTGGAGGAGTCGCTACATTATGAGGGGAGGGCAGTGGACATCACTACGTCGGACCGGGACCGCAGTAAATACGGAATGTTGGGCCGACTGGCGGTGGAGGCCGGGTTCGACTGGGTCTATTACGAGTCCAAAGCTCATATTCACTGTTCGGTCAAAGCAGAGAACTCAGTGGCGGCCAAGTCTGGCGGGTGCTTCCCTGCTGGTGCCAGGGTGATGGTGGAATTTGGTGGCACCAAAGCGGTGAAAGACCTGCGACCAGGGGACCGCGTTCTCTCCTCCGACCCCCAAGGGAATCTGCTCTACAGCGACTTCCTCATGTTCATCGACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTTGTGGCCCAGACCAAGGTCAACGGCACCAGGTCGTTCAAGTTTGTCTTTGCCAGCAACATCCAACCAGGAGAT
  5   1   2       bld Emb4                            IMAGE:5514799.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAACTGAACGCACTTTCGATCTCCGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTGACGGAGGGGTGGGATGAGGACGGGCACCACTTGGAGGAGTCGCTACATTATGAGGGGAGGGCAGTGGACATCACTACGTCGGACCGGGACCGCAGTAAATACGGAATGTTGGGCCGACTGGCGGTGGAGGCCGGGTTCGACTGGGTCTATTACGAGTCCAAAGCTCATATTCACTGTTCGGTCAAAGCAGAGAACTCAGTGGCGGCCAAGTCTGGCGGGTGCTTCCCTGCTGGTGCCAGGGTGATGGTGGAATTTGGTGGCACCAAAGCGGTGAAAGACCTGCGACCAGGGGACCGCGTTCTCTCCTCCGACCCCCAAGGGAATCTGCTCTACAGCGACTTCCTCATGTTCATCGACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTTGTGGCCCAGACCAAGGTCAACGGCACCAGGTCGTTCAAGTCTGTCTTTGCCAGCAACATCCAACCAGGAGATCTCATTTATACAGCAGATCCCAAGACCATGACCTTGAAGGCGGTGAAAGTGGAGAAGGTTGATCTTGAGGAGGACACTGGAGCTTATGCGCCTCTAACTGCCCATGGGACTGTGGTTATAGACAGGGATGGTCCTCCTGCTATGCAGTCATTGAGGAACACACCCTGGCCCACCTCGCATTTGCCCCACTGAGGTTTGGCATGAGCTTCTCTTCTAAATTTACCCCGAAACTCCGTC
  5   1   2       bld Tbd7      in                         XL096o20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGATGAGGACGGGCACCACTTGGAGGAGTCGCTGCATTATGAGGGGAGGGCAGTGGACATCACTACGTCGGACCGGGACCGCAGTAAATACGGAATGTTGGGCCGACTGGCGGTGGAGGCCGGGTTCGACTGGGTCTATTACGAGTCCAAAGCTCATATTCACTGTTCGGTCAAAGCAGAGAACTCAGTGGCGGCCAAGTCTGGCGGGTGCTTCCCTGCTGGTGCCAGGGTGATGGTGGAATTTGGTGGCACCAAAGCGGTGAAAGACCTGCGACCAGGGGACCGCGTTCTCTCCTCCGACCCCCAAGGGAATCTGCTCTACAGCGACTTCCTCATGTTCATCGACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTTGTGGCCCAGACCAAGGTCAACGGCACCAGGTCGTTCAAGTCTGTCTTTGCCAGCAACATCCAACCAGGAGATCTCATTTATACAGCAGATCCCAAGACCATGACCTTGAAGGCGGTGAAAGTGGAGAAGGTTGATCTTGAGGAGGACACTGGAGCTTATGCGCCTCTAACTGCCCATGGG
  5   1   2       bld Ga18      in                      xlk155o04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGAAAGANCTGCGACCAGGGGANCGNGTTCTCTCCTCCGACCCCCAAGGAATCTGCTCTACAGCGACTTCCTCATGTTCATCGACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTTGTGGCCCAGACCAAGGTCAACGGCACCAGGTCGTTCAAGTCTGTCTTTGCCAGCAACATCCAACCAGGAGATCTCATTTATACAGCAGATCCCAAGACCATGACCTTGAAGGCGGTGAAAGTGGAGAAGGTTGATCTTGAGGAGGACACTGGAGCTTATGCGCCTCTAACTGCCCATGGGACTGTGGTTATAGACCAGGTATTGGCCTCCTGCTATGCNNTCATTGAGGAACACACCTGGGCACACCTCGCATTTGCCCCACTGAGGTTTGGCATGAGCCTCTCCTCTTATATTTACCCCAGAGACTCCAGTCCTCCATCAGGACTTCAGCCTCACCACCAAGTTGACCTTCAGTCTCACCATCAAGTTGATCTTCAGTCTCACCACCAAGTTGACCTTCAGTCTCACCACCAACTTGAAGGCATCCACTGGTACTCCCAGCTACTGTATCAGATAGGGACTTGGCTTTTGGACAGTAACTCCCTGCACCCACTGGGCATGGNAACGAAATCCAGTTGAAAAATACACATTTTCACTGCATAGACAAAAGANTTTATTTTTTAAGTAGAACTTAAAGTAGANACAAAAGGGAAAGAGCCCAGatttttcctttcattgttctgtttattttatttctcctctccatccttttttttaatatttcgnattttcggngttttttttctattgtttttCGATTCCCTACTGAATATTTATTTGTTTNGCATTTGACTAGATGNTTAAAAAAATGG
  5   1   2       bld Eye1                            IMAGE:6946103.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACCAGGAGCGTGACGTCAAGAAGCTCTTTTACGTCATCGAAACGTCTCAGAGAAAAATTCGGTTGACCGCGGCCCATCTACTTTTTGTGGCCCAGACCAAGGTCAACGGCACCAGGTCGTTCAAGTCTGTCTTTGCCAGCAACATCCAACCAGGAGATCTCATTTATACAGCAGATCCCAAGACCATGACCTTGAAGGCGGTGAAAGTGGAGAAGGTTGATCTTGAGGAGGACACTGGAGCTTATGCGCCTCTAACTGCCCATGGGACTGTGGTTATAGACCAGGTATTGGCCTCCTGCTATGCAGTCATTGAGGAACACACCTGGGCACACCTCGCATTTGCCCCACTGAGGTTTGGCATGAGCCTCTCCTCTTATATTTACCCCAGAGACTCCAGTCCTCCATCAGGCCTTCAGCCTCACCACCAAGTTGACCTTCAGTCTCACCATCAAGTTGATCTTCAGTCTCACCACCAAGTTGACCTTCAGTCTCACCACCAACTTGAAGGCATCCACTGGTACTCCCAGCTACTGTATCAGATAGGGACTTGGCTTTTGGACAGTAACTCCCTGCACCCACTGGGCATGGCAACGAAATCCAGTTGAAAAATACACATTTTCACTGCATCGACAAAAGACTTTATTTTTTAAGTAGAACTTAAAGTAGACACTAAAGGGAAAGAGCCCAGATTTTTCCTTTCATTGTTCtgtttattttatttctcctctccatccttttttttaatatttcgtattttcggggttttttttctattgtttttcgatttcCTACTGAATATTTATTTGTTTGGCATTTGACTAGATGTTTAAAAAAATGGACATTTCC
  3   1   2       add Ga18      in                       xlk53f02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTNCNANNANCATCCANCNAGNAGATCTCATTTANNCAGCAGATCCCANGNCCNTGNCCTNGAAGNCGGTGAAAGTGGAGAAGGTTGATCTTGAGGAGGACACTGGANCTTATGCGCCTCTAACTGCCATGGGACTGTGGTTATAGNCCAGGTATTGNCCTCNNNCTATGCAGTCATTGAGGAACACACCTGGGCACNCCTCNNATTTGCCCCACTGAGGTTTGNCATGAGCCTCTCCTCTTATATTTACCCCAGAGACTCCAGTCCTCCATCNNNCNTCAGCCTCACCACCAAGTTGACCTTCAGTCTCACCATCAAGTTGATCTTCAGTCTCACCACCAAGTTGACCTTCAGTCTCACCACCAACTTGAAGGCATCCACTGGTACTCCCAGCTACTGTATCAGATAGGGACTTGGCTTTTGGACAGTAACTCCCTGCNCCACTGGGCATGGCAACGAAATCCAGTTGAAAAATACACATTTTCACTGCATCGACAAAAGACTTTATTTTTTAAGTAGAACTTAAAGTAGACACTAAAGGGAAAGAGCCCAGATTTTTCCTTTCATTGTTCTGTTTATTTTATTTCTCCTCTCCATCCTTTTTTTTAATATTTCGTATTTTCGGTGTTTTTTTTCTATTGTTTTTCGATTTCCTACTGAATATTTATTTGTTTGGCATTTGACTAGATGTTTAAAAAAATGGACATTTCAGAAGCCTTAAATAGTTACTTTGGTAATTTATTATCACTTATTGTGTCTTGGTGANCCCCCCCCAAAAAAAAACACTCAGCAGANNCTATNNT
  5   1   2       bld Ga18      in                      xlk106o16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGGNCTCCTGCTNTGGNCATTGAGGAACACACCTGGGCACACCTCGCATTTGCCCCACTGAGGTTTGGCATGAGCCTCTCCTCTTATATTTACCCCAGAGACTCCAGTCCTCCATCAGGACTTCAGCCTCACCACCAAGTTGACCTTCAGTCTCACCATCAAGTTGATCTTCAGTCTCACCACCAAGTTGACCTTCAGTCTCACCACCAACTTGAAGGCATCCACTGGTACTCCCAGCTACTGTATCAGATAGGGACTTGGCTTTTGGACAGTAACTCCCTGCACCCACTGGGCATGGNAACGAAATCCAGTTGAAAAATACACATTTTCACTGCATAGACAAAAGACTTTATTTTTTAAGTAGAACTTAAAGTAGACACAAAAGGGAAAGAGCCCAGATTTTTCCTTTCATTGTTCTGtttattttatttctcctctccatccttttttttaatatttcgtattttcggtgttttttttctattgtttttCGATTCCCTACTGAATATTTATTTGTTTGGCATTTGACTAGATGTTTAAAAAAATGGACATTGCAGAAGNCTTAAATAGTTACTTTGGTAATTTATTATCACTTATTGTGTCTTGGTGAGccccccccccccaaaaaaaaNNC
  5   1   2       bld DMZ       in                         xl242c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCTCACCACCAACTTGAAGGCATCCACTGGTACTCCCAGCTACTGTATCAGATAGGGACTTGGCTTTTGGACAGTAACTCCCTGCACCCACTGGGCATGGCAACGAAATCCAGTTGAAAAATACACATTTTCACTGCATAGACAAAAGACTTTATTTTTTAAGTAGAACTTAAAGTAGACACAAAAGGGAAAGAGCCCAGatttttcctttcattgttctgtttattttatttctcctctccatccttttttttaatatttcgtattttcggtgttttttttctattgtttttcgattccctactgaatatttatttGTTTGGCATTTGACTAGATGTTTAAAAAAATGGACATTGCAGAAGCCTTAAATAGTTACTTTGGTAATTTATTATCACTTATTGTGTCTTGGTGAGcccccccccccaaaaaaaaaCACNCAGCANAGNCNATTTTTCTACANGTCACTTANGTTCCAACTTTCACAAAAACNGGTTTAAAAAACAAAACAATTTANGANGTATTTTCTCTcccccacccccacccTCATTTCTCCNCCAGACCANACCTTCCAAGGNGG
  5   1   2      en>5                              Xl3.1-xlk155o04ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTAATATTTCGTATTTTTGGTGTTTTTTTTCTTATTGTTTTTCGATTTCCTACTGAATATTTATTTGTTTGGCATTTGACAGATGTTTAAAAAAAAATGGACATTGCAGAAGCCTTAAATAGTTACTTGTAATTTATTAT------------------------CCCCCCCCAAAAAAAAACACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTAACCTCAAAAAAAAGAGTTTA
                                                  Xl3.1-CHK-1012693662                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------------------------------------------------------------------------------------------------------------------------------------------------------------GANCCCCCCCCCCCAAAAAAAAACACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTAACCTCAAAAAAAAGAGTTTATTAGAA
  3   1   2       bld Ga18      in                      xlk155o04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGNCTTGGNTTNNGANANNANNNCCCNGNNCCCNCTGGNNANGGNANNGAAATCNAGTNNAAAANNNCACNTTTNNNCNGNANAGNCAAAANNCTTTNTTTTTNANNTAGANNTNAANNNAGNCACAAANGGNAANNGNGCCCAGNTTTTNCNTTNCATTGTTCTGTTTATTTTATTNCNCCTCNCNNNCNTTTTTTTnAATATTTCGTATTTTnGGTGTTTTTTTTCTATTNTTTTTCGNTTCCCTNCNGAATATTTNTTNNTTNGGCATTTGNCTAGATGTTTAAAAAAATGGACNTNGCAGAAGCCTNAAATAGTNNCTTNGGTAATTTATTATCNCTTATTGTGTCTNGNNGANCCCCCCCCCCCAAAAAAAAACACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTANCCTCAAAAAAAAGAGTTTATTAGAATATGA
  5   1   2       bld Neu4                            IMAGE:4085490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAATCCAGTTGAAAAATACACATTTTCACTGCATCGACAAAAGACTTTATTTTTTAAGTAGAACTTAAAGTAGACACTAAAGGGAAAGAGCCCAGatttttcctttcattgttctgtttattttatttctcctctccatccttttttttaatatttcgtatttttggtgtttttttttctattgtttttCGATTTCCTACTGAATATTTATTTGTTTGGCATTTGACTAGATGTTTaaaaaaaaTGGACATTGCAGAAGCCTTAAATAGTTACTTTGGTAATTTATTATCACTTATTGTGTCTTGGTGAGCCCCCCCCaaaaaaaaaaCACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTaaaaaaaaaCAATTTATGATGTATTTTCTCTCCTCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTC
  3   1   2       bld Ga18      in                      xlk125h16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TNNTTTnnnnnnCnnnnnnnnTTTTTnAnnnTTnnGTnnTTTnnnnnnTTTTTTTTCNNTNNTTTTNCGNNNNCTACNGAATATTNATTTNTTNGGCATTTGACTAGATNTTNNAAAAAATGGACNTNNNAGAANCCTNAAANAGTNNCTTNNNNAATTTATTATCNCTTATTGNGTCTNGNNNAGCCCCCCCCCCCAAAAAAAAACACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTANCCTCAAAAAAAAGAGNTATTAGAATATGA
  3   1   2       bld Ga18      in                        xlk1l02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TNNTTTNTNNNCCTCNCCNTCCTTTTTTTAATnTTCGnnnTTTCGnTnTTTTTTTCTnTnTTTTTCGnnNCCCTNCNNAATATTTANTGNNGGCATNGACTAGATGTTTAAAAAAATGGACATTGCAGAAGCCTNAAATAGTTACTTNGGTAATTTATTATCACTTATTGTGTCTTGGNGAGCCCCCCCCCAAAAAACACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAAAAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATANTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTANCCTCAAAAAAAAGAGNNANNAGAATATGA
  3   1   2       bld Ga18      in                      xlk106o16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTATTNNCNCTTATNGNGTCTNGNNNANCCCCCCCCCCCAAAAAAAAACACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTANCCTCAAAAAAAAGAGTTTATTAGAATANGA
  3   1   2       bld Ga18                             rxlk125j16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CNCTTATNGNGTCNNGNNGANCCCCCCCCCCCAAAAAAAAACACTCAGCAGAGTNNANTTTNCNNCATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACNGAACTAATACGAATATTATCATTTCTANCCTCAAAAAAAAGAGNNTATTAGAATA
  3   1   2       bld DMZ  5g3  in                         xl250b20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTGNGCCCCCCCCCCCAAAAAAAAACACTCAGCAGAGTNTATTTTTCTNCATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTAACCTCAAAAAAAAGAGTT
  3   1   2       bld DMZ       in                         xl242c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GNGCCCCCCCCCCCAAAAAAAAACACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTAACCTCAAAAAAAAGAGTTATTAGAA
  3   1   2      seed DMZ  5g3  in                         xl319g06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GNGNCCCCCCCCCCAAAAAAAAACACTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTCCAACTTTCACAAAAACAGGTTTAAAAAACAAAACAATTTATGATGTATTTTCTCTCCCCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTAACCTCAAAAAAAAGAGTTA
  3   1   2       bld DMZ                                 rxl221n10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAACTTTCACAAAAACNGGNTTAAAAAAAAAAACAATTTATGATGTATTTTCTCTCCTCCACCCCCACCCTCATTTCTCCTCCAGACCAGACCTTCCAAGGAGGTGTCCACACAGCTACTAAAGTCTCTCCCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTAACCTCAAAAAAAAGAGTTA
  3   1   2       bld Tbd7      in                         XL096o20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ANNNNNANCNTNATTTNTCNTNCANGANCAGACCTTNCAAGNAGGTGTCCACNCAGNTANTAAAGTCTCTCNCCGACCCCCTATTTTTAGTGAAAGTGTTTCCTATTTGTAAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTTATACGCAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAANNTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAAGATAGTTTCACGCGATAACTCTTCTATTTGCCTTTTTTGTTTTTTCGTTATTTTCCTTTTCGTTTTCGCTTTATAAATATTTTTTGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACANACAAACGAACTAATACGCAATATTATCATTTNCTAACCTC
  5  -1   2       bld Ga18                               xlk51k16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ttttttttttGTTGTAGAAAAACAAGGATCGGCCGCATTCATGTCCATCCAGACTGTTACACCAACAAACAAACGAACTAATACGAATATTATCATTTCTAACCTCaaaaaaaaGAGTTTATTAGAATATGATATTTTTTACAAGAAGGAGCAGAATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)