Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.6000000000000001    0Xl3.1-XL208f08.5                           14 END     5          21       35                (no blast hit)
     2   2.0    0Xl3.1-XL499n07ex.3                         12 END     1           4        8                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012838746 Xl3.1-IMAGE:4930716-IMAGp.5.5 - 23 ESTs
                                                                       .....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                         Xl3.1-IMAGE:4930716-IMAGp.5.5                TCAGCGCTGAACAGACTAAAGAGACATGAAGAATTGTCCGGGATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATACAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACGGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGATCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGAGGCGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCAGGAATGGTCGAAAGTCAAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGAACCGGCTCTTAAATGATAAAGGAAAGGGTAAAGTCCCAGAGGTGCAGCATTCTTCTCTGAGGTTTGAGGATATTGGGGGAAATGAAGATACCCTAAAGGAGGTGTGCAAAATGATGATTCACATGCGTCACCCTGAAGTTTACCAGCACCTAGGTGTGGTGCCTCCGCGGGGGTTTCTTCTGCACGGGCCGCCAGGATGTGGCAAAACCTTACTGGCTCAGGCAATTGCTGGGGAGCTGGACATGCCGATTCTCAAGGTGGCAGCCACTGAAATGGTCTCGGGTGTTTCTGGGGAGTCGGAACAGAAGCTCAGGGAGCTCTTCGACCAAGCGGTGTCCAGTGCTCCCTGCATCCTGTTTATAGATGAGATTGATTCCATAACCCCAAAAAGAGAAGTGGCCTCTAAGGATATGGAGAGGAGGATTGTGGCCCAGCTACTTACCTGCATGGACGATTTAAACAGCCTTGCCGTGACTACTCAAGTCCTCGTCATCGGAGCCACAAACCGGCCCGATTCACTGGACCCCGCTCTGAGACGTGCTGGAAGGTTTGACCGGGAAATCTGCCTGGGGATTCCTGATGAAGGTGCCAGAAAAAGGATTCTACAGACGTTGTGCCGTAAGCTGAAACTCCCAGAACCCTTTGACTTCTGCCGTCTGGCTCACCTGACTCCGGGATATGTGGGGGCAGACTTGATGGCACTGTGCCGGGAAGCCGCAATGTGCGCAGTGAACAGAGTCCTTATCCAGATAAAGGACCAACAAGCTACTACAGAAGCAGCTGTGGAAGAGACAGACCCTCAGCCAGGAGCCGTAGCATTGCAAGCAGAGAAGCAGACAACTGCACCTGCCCAGAATGAGCTGCACCGGTTACTTGCGTTGCTGCAAGAACAGACTCCATTACCGGAGGCGGAGCTGCTGAGCCTGTGCATCGAGATGGATGATTTCCTTGGTGCCTTGCCCATGGTACAGCCCTCTGCTAAGAGAGAAGGATTTGCCACCGTCCCTGATGTTACCTGGGCCGATATTGGAGCGCTCGAGGAAATCCGGGAAGAGCTTACCATGGCAATTCTGGCGCCAGTGAGAAATCCAGAACAGTTTAAAGCCCTTGGCCTGATGGCACCAGCTGGAGTCTTACTGGCAGGACCCCCTGGCTGTGGCAAAACTTTACTGGCAAAGGCTGTTGCAAACGAATCTGGACTCAATTTTATTTCGGTGAAAGGGCCAGAGCTGTTGAACATGTACGTTGGAGAGAGTGAACGCGCAGTCCGACAAGTCTTCCAGAGGGCTACAAACTCTTCTCCTTGTGTGATATTTTTTGATGAGATCGATGCTCTCTGCCCACGTAGATCTGGACATGATTCAGGTGCCAGCGTGCGGGTAGTGAACCAGCTGCTGACAGAGATGGACGGACTTGAAAGCCGCCGGCAGGTATTCATAATGGCAGCAACAAACCGGCCAGATATCATTGACCCAGCCATCCTGCGACCCGGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCCTGCCGACCGGTTTGCCATATTAAAGACTATCACTAAGGATGGAACCCGCCCGCCCTTGGAAGCCGATGTCAACCTGGAAACGATTGCTAGTGACGTGCGCTGCGACTGCTTCACGGGTGCTGATCTCTCGGCCCTTGTACGGGAAGCTTCAATAAGTGCCCTGAGGCAAGAGATGTTAGTGCAGGAGCCGCACACAAACCCAGGGCAGATCAAGGTGAGCCAAAGGAATTTTGAAGAAGCTTTTAATAAAGTGAAACCCTCAGTGTCCAAGAAGGATCAGCTGATGTACGAGCTCCTGCGCCAGTCACTCAGCCGATAGCCGACACATGAGTGAAAGGAGGAGATGTTTATGTAGCAGAGGACTTTGAAGGGTCAGGGTTTGATACCAGCGGCCTTGTACAGTTAACCCAATCCGTTCCAGTGCCAAGCATCGTGCAGGGTTAATGAACAACCAATGTGAGCAGAGCGATTCCAGCAGCAGGCCGCAACTAAACCGCTCTGTACAGTCTGCTCTTATAGACCGTGTAACGGACAGAAACTATTTTAATTAATGCAACAAGTATATATGGATAAATGCGGTCAGATGAACCTGCCCTGGAGAGCTCACAATCAAAGGGGACT
                                                  Xl3.1-CHK-1012721626                      CTGAACAGACTAAAGAGACATGAAGAATTGTCCGGGATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATACAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACGGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGATCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGAGGCGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCAGGAATGGTCGAAAGTCAAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGAACCGGCTCTTAAATGATAAAGGAAAGGGTAAAGTCCCAGAGGTGCAGCATTCTTCTCTGAGGTTTGAGGATATTGGGGGAAATGAAGATACCCTAAAGGAGGTGTGCAAAATGATGATTCACATGCGTCACCCTGAAGTTTACCAGCACCTAGGTGTGGTGCCTCCGCGGGGGTTTCTTCTGCACGGGCCGCCAGGATGTGGCAAAACCTTACTGGCTCAGGCAATTGCTGGGGAGCTGGACATGCCGATTCTCAAGGTGGCAGCCACTGAAATGGTCTCGGGTGTTTCTGGGGAGTCGGAACAGAAGCTCAGGGAGCTCTTCGACCAAGCGGTGTCCAGTGCTCCCTGCATCCTGTTTATAGATGAGATTGATTCCATAACCCCAAAAAGAGAAGTGGCCTCTAAGGATATGGAGAGGAGGATTGTGGCCCAGCTACTTACCTGCATGGACGATTTAAACAGCCTTGCCGTGACTACTCAAGTCCTCGTCATCGGAGCCACAAACCGGCCCGATTCACTGGACCCCGCTCTGAGACGTGCTGGAAGGTTTGACCGGGAAATCTGCCTGGGGATTCCTGATGAAGGTGCCAGAAAAAGGATTCTACAGACGTTGTGCCGTAAGCTGAAACTCCCAGAACCCTTTGACTTCTGCCGTCTGGCTCACCTGACTCCGGGATATGTGGGGGCAGACTTGATGGCACTGTGCCGGGAAGCCGCAATGTGCGCAGTGAACAGAGTCCTTATCCAGATAAAGGACCAACAAGCTACTACAGAAGCAGCTGTGGAAGAGACAGACCCTCAGCCAGGAGCCGTAGCATTGCAAGCAGAGAAGCAGACAACTGCACCTGCCCAGAATGAGCTGCACCGGTTACTTGCGTTGCTGCAAGAACAGACTCCATTACCGGAGGCGGAGCTGCTGAGCCTGTGCATCGAGATGGATGATTTCCTTGGTGCCTTGCCCATGGTACAGCCCTCTGCTAAGAGAGAAGGATTTGCCACCGTCCCTGATGTTACCTGGGCCGATATTGGAGCGCTCGAGGAAATCCGGGAAGAGCTTACCATGGCAATTCTGGCGCCAGTGAGAAATCCAGAACAGTTTAAAGCCCTTGGCCTGATGGCACCAGCTGGAGTCTTACTGGCAGGACCCCCTGGCTGTGGCAAAACTTTACTGGCAAAGGCTGTTGCAAACGAATCTGGACTCAATTTTATTTCGGTGAAAGGGCCAGAGCTGTTGAACATGTACGTTGGAGAGAGTGAACGCGCAGTCCGACAAGTCTTCCAGAGGGCTACAAACTCTTCTCCTTGTGTGATATTTTTTGATGAGATCGATGCTCTCTGCCCACGTAGATCTGGACATGATTCAGGTGCCAGCGTGCGGGTAGTGAACCAGCTGCTGACAGAGATGGACGGACTTGAAAGCCGCCGGCAGGTATTCATAATGGCAGCAACAAACCGGCCAGATATCATTGACCCAGCCATCCTGCGACCCGGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCCTGCCGACCGGTTTGCCATATTAAAGACTATCACTAAGGATGGAACCCGCCCGCCCTTGGAAGCCGATGTCAACCTGGAAACGATTGCTAGTGACGTGCGCTGCGACTGCTTCACGGGTGCTGATCTCTCGGCCCTTGTACGGGAAGCTTCAATAAGTGCCCTGAGGCAAGAGATGTTAGTGCAGGAGCCGCACACAAACCCAGGGCAGATCAAGGTGAGCCAAAGGAATTTTGAAGAAGCTTTTAATAAAGTGAAACCCTCAGTGTCCAAGAAGGATCAGCTGATGTACGAGCTCCTGCGCCAGTCACTCAGCCGATAGCCGACACATGAGTGAAAGGAGGAGATGTTTATGTAGCAGAGGACTTTGAAGGGTCAGGGTTTGATACCAGCGGCCTTGTACAGTTAACCCAATCCGTTCCAGTGCCAAGCATCGTGCAGGGTTAATGAACAACCAATGTGAGCAGAGCGATTCCAGCAGCAGGCCGCAACTAAACCGCTCTGTACAGTCTGCTCTTATAGACCGTGTAACGGACAGAAACTATTTTAATTAATGCAACAAGTATATATGGATAAATGCGGTCAGATGAACCTGCCCTGGAGAGCTCACAATCAAAGGGGACTTTAGTT
                                                      consensus depths                     3     3     3     3     3     3     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     6     8     7     8     6     7     4     6     5     6     5     6     6     7     6     7     5     7     5     6     6     7     6     7     5     6     5     6     5     6     5     6     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     4     5     5     6     5     6     5     6     4     5     4     5     4     5     5     6     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     4     4     3     4     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     3     3     3     3     2     3     2     2
  5   1   2      ests                      Xl3.1-IMAGE:4930716-IMAGp.5                         AACAGACTAAAGAGACATGAAGAATTGTCCGGGATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATACAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACGGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGATCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGAGGCGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCAGGAATGGTCGAAAGTCAAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGAACCGGCTCTTAAATGATAAAGGAAAGGGTAAAGTCCCAGAGGTGCAGCATTCTTCTCTGAGGTTTGAGGATATTGGGGGAAATGAAGATACCCTAAAGGAGGTGTGCAAAATGATGATTCACATGCGTCACCCTGAAGTTTACCAGCACCTAGGTGTGGTGCCTCCGCGGGGGTTTCTTCTGCACGGGCCGCCAGGATGTGGCAAAACCTTACTGGCTCAGGCAATTGCTGGGGAGCTGGACATGCCGATTCTCAAGGTGGCAGCCACTGAAATGGTCTCGGGTGTTTCTGGGGAGTCGGAACAGAAGCTCAGGGAGCTCTTCGACCAAGCGGTGTCCAGTGCTCCCTGCATCCTGTTTATAGATGAGATTGATTCCATAACCCCAAAAAGAGAAGTGGCCTCTAAGGATATGGAGAGGAGGATTGTGGCCCAGCTACTTACCTGCATGGACGATTTAAACAGCCTTGCCGTGACTACTCAAGTCCTCGTCATCGGAGCCACAAACCGGCCCGATTCACTGGACCCCGCTCTGAGACGTGCTGGAAGGTTTGACCGGGAAATCTGCCTGGGGATTCCTGATGAAGGTGCCAGAAAAAGGATTCTACAGACGTTGTGCCGTAAGCTGAAACTCCCAGAACCCTTTGACTTCTGCCGTCTGGCTCACCTGACTCCGGGATATGTGGGGGCAGACTTGATGGCACTGTGCCGGGAAGCCGCAATGTGCGCAGTGAACAGAGTCCTTATCCAGATAAAGGACCAACAAGCTACTACAGAAGCAGCTGTGGAAGAGACAGACCCTCAGCCAGGAGCCGTAGCATTGCAAGCAGAGAAGCAGACAACTGCACCTGCCCAGAATGAGCTGCACCGGTTACTTGCGTTGCTGCAAGAACAGACTCCATTACCGGAGGCGGAGCTGCTGAGCCTGTGCATCGAGATGGATGATTTCCTTGGTGCCTTGCCCATGGTACAGCCCTCTGCTAAGAGAGAAGGATTTGCCACCGTCCCTGATGTTACCTGGGCCGATATTGGAGCGCTCGAGGAAATCCGGGAAGAGCTTACCATGGCAATTCTGGCGCCAGTGAGAAATCCAGAACAGTTTAAAGCCCTTGGCCTGATGGCACCAGCTGGAGTCTTACTGGCAGGACCCCCTGGCTGTGGCAAAACTTTACTGGCAAAGGCTGTTGCAAACGAATCTGGACTCAATTTTATTTCGGTGAAAGGGCCAGAGCTGTTGAACATGTACGTTGGAGAGAGTGAACGCGCAGTCCGACAAGTCTTCCAGAGGGCTACAAACTCTTCTCCTTGTGTGATATTTTTTGATGAGATCGATGCTCTCTGCCCACGTAGATCTGGACATGATTCAGGTGCCAGCGTGCGGGTAGTGAACCAGCTGCTGACAGAGATGGACGGACTTGAAAGCCGCCGGCAGGTATTCATAATGGCAGCAACAAACCGGCCAGATATCATTGACCCAGCCATCCTGCGACCCGGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCCTGCCGA
  5   1   2      ests                            Xl3.1-IMAGE:7201837.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGACCCGGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCCTGCCGACCGGTTTGCCATATTAAAGACTATCACTAAGGATGGAACCCGCCCGCCCTTGGAAGCCGATGTCAACCTGGAAACGATTGCTAGTGACGTGCGCTGCGACTGCTTCACGGGTGCTGATCTCTCGGCCCTTGTACGGGAAGCTTCAATAAGTGCCCTGAGGCAAGAGATGTTAGTGCAGGAGCCGCACACAAACCCAGGGCAGATCAAGGTGAGCCAAAGGAATTTTGAAGAAGCTTTTAATAAAGTGAAACCCTCAGTGTCCAAGAAGGATCAGCTGATGTACGAGCTCCTGCGCCAGTCACTCAGCCGATAGCCGACACATGAGTGAAAGGAGGAGATGTTTATGTAGCAGAGGACTTTGAAGGGTCAGGGTTTGATACCAGCGGCCTTGTACAGTTAACCCAATCCGTTCCAGTGCCAAGCATCGTGCAGGGTTAATGAACAACCAATGTGAGCAGAGCGATTCCAGCAGCAGGCCGCAACTAAACCGCTCTGTACAGTCTGCTCTTATAGACCGTGTAACGGACAGAAACTATTTTAATTAATGCAACAAGTATATATGGATAAATGCGGTCAGATGAACCTGCCCTGGAGAGCTCACAATCAAAGGGGACTTTAG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------C--
                                               BLH ATG      16     477                
                                               BLH MIN      16     339                
                                               BLH OVR      16     207                
                                               EST CLI     -30       6                
                                               ORF LNG      16      69                
  5   1   2      ests                      Xl3.1-IMAGE:4930716-IMAGp.5                         AACAGACTAAAGAGACATGAAGAATTGTCCGGGATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATACAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACGGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGATCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGAGGCGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCAGGAATGGTCGAAAGTCAAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGAACCGGCTCTTAAATGATAAAGGAAAGGGTAAAGTCCCAGAGGTGCAGCATTCTTCTCTGAGGTTTGAGGATATTGGGGGAAATGAAGATACCCTAAAGGAGGTGTGCAAAATGATGATTCACATGCGTCACCCTGAAGTTTACCAGCACCTAGGTGTGGTGCCTCCGCGGGGGTTTCTTCTGCACGGGCCGCCAGGATGTGGCAAAACCTTACTGGCTCAGGCAATTGCTGGGGAGCTGGACATGCCGATTCTCAAGGTGGCAGCCACTGAAATGGTCTCGGGTGTTTCTGGGGAGTCGGAACAGAAGCTCAGGGAGCTCTTCGACCAAGCGGTGTCCAGTGCTCCCTGCATCCTGTTTATAGATGAGATTGATTCCATAACCCCAAAAAGAGAAGTGGCCTCTAAGGATATGGAGAGGAGGATTGTGGCCCAGCTACTTACCTGCATGGACGATTTAAACAGCCTTGCCGTGACTACTCAAGTCCTCGTCATCGGAGCCACAAACCGGCCCGATTCACTGGACCCCGCTCTGAGACGTGCTGGAAGGTTTGACCGGGAAATCTGCCTGGGGATTCCTGATGAAGGTGCCAGAAAAAGGATTCTACAGACGTTGTGCCGTAAGCTGAAACTCCCAGAACCCTTTGACTTCTGCCGTCTGGCTCACCTGACTCCGGGATATGTGGGGGCAGACTTGATGGCACTGTGCCGGGAAGCCGCAATGTGCGCAGTGAACAGAGTCCTTATCCAGATAAAGGACCAACAAGCTACTACAGAAGCAGCTGTGGAAGAGACAGACCCTCAGCCAGGAGCCGTAGCATTGCAAGCAGAGAAGCAGACAACTGCACCTGCCCAGAATGAGCTGCACCGGTTACTTGCGTTGCTGCAAGAACAGACTCCATTACCGGAGGCGGAGCTGCTGAGCCTGTGCATCGAGATGGATGATTTCCTTGGTGCCTTGCCCATGGTACAGCCCTCTGCTAAGAGAGAAGGATTTGCCACCGTCCCTGATGTTACCTGGGCCGATATTGGAGCGCTCGAGGAAATCCGGGAAGAGCTTACCATGGCAATTCTGGCGCCAGTGAGAAATCCAGAACAGTTTAAAGCCCTTGGCCTGATGGCACCAGCTGGAGTCTTACTGGCAGGACCCCCTGGCTGTGGCAAAACTTTACTGGCAAAGGCTGTTGCAAACGAATCTGGACTCAATTTTATTTCGGTGAAAGGGCCAGAGCTGTTGAACATGTACGTTGGAGAGAGTGAACGCGCAGTCCGACAAGTCTTCCAGAGGGCTACAAACTCTTCTCCTTGTGTGATATTTTTTGATGAGATCGATGCTCTCTGCCCACGTAGATCTGGACATGATTCAGGTGCCAGCGTGCGGGTAGTGAACCAGCTGCTGACAGAGATGGACGGACTTGAAAGCCGCCGGCAGGTATTCATAATGGCAGCAACAAACCGGCCAGATATCATTGACCCAGCCATCCTGCGACCCGGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCCTGCCGA
                                                  Xl3.1-CHK-1012690342                               CTAAAGAGACATGAAGAATTGTCCGGGATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATACAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACGGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGATCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGAGGCGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCAGGAATGGTCGAAAGTCAAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGAACCGGCTCTTAAATGATAAAGGAAAGGGTAAAGTCCCAGAGGTGCAGCATTCTTCTCTGAGGTTTGAGGATATTGGGGGAAATGAAGATACCCTAAAGGAGGTGTGCAAAATGATGATTCACATGCGTCACCCTGAAGTTTACCAGCACCTAGGTGTGGTGCCTCCGCGGGGGTTTCTTCTGCACGGGCCGCCAGGATGTGGCAAAACCTTACTGGCTCAGGCAATTGCTGGGGAGCTGGACATGCCGATTCTCAAGGTGGCAGCCACTGAAATGGTCTCGGGTGTTTCTGGGGAGTCGGAACAGAAGCTCAGGGAGCTCTTCGACCAAGCGGTGTCCAGTGCTCCCTGCATCCTGTTTATAGATGAGATTGATTCCATAACCCCAAAAAGAGAAGTGGCCTCTAAGGATATGGAGAGGAGGATTGTGGCCCAGCTACTTACCTGCATGGACGATTTAAACAGCCTTGCCGTGACTACTCAAGTCCTCGTCATCGGAGCCACAAACCGGCCCGATTCACTGGACCCCGCTCTGAGACGTGCTGGAAGGTTTGACCGGGAAATCTGCCTGGGGATTCCTGATGAAGGTGCCAGAAAAAGGATTCTACAGACGTTGTGCCGTAAGCTGAAACTCCCAGAACCCTTTGACTTCTGCCGTCTGGCTCACCTGACTCCGGGATATGTGGGGGCAGACTTGATGGCACTGTGCCGGGAAGCCGCAATGTGCGCAGTGAACAGAGTCCTTATCCAGATAAAGGACCAACAAGCTACTACAGAAGCAGCTGTGGAAGAGACAGACCCTCAGCCAGGAGCCGTAGCATTGCAAGCAGAGAAGCAGACAACTGCACCTGCCCAGAATGAGCTGCACCGGTTACTTGCGTTGCTGCAAGAACAGACTCCATTACCGGAGGCGGAGCTGCTGAGCCTGTGCATCGAGATGGATGATTTCCTTGGTGCCTTGCCCATGGTACAGCCCTCTGCTAAGAGAGAAGGATTTGCCACCGTCCCTGATGTTACCTGGGCCGATATTGGAGCGCTCGAGGAAATCCGGGAAGAGCTTACCATGGCAATTCTGGCGCCAGTGAGAAATCCAGAACAGTTTAAAGCCCTTGGCCTGATGGCACCAGCTGGAGTCTTACTGGCAGGACCCCCTGGCTGTGGCAAAACTTTACTGGCAAAGGCTGTTGCAAACGAATCTGGACTCAATTTTATTTCGGTGAAAGGGCCAGAGCTGTTGAACATGTACGTTGGAGAGAGTGAACGCGCAGTCCGACAAGTCTTCCAGAGGGCTACAAACTCTTCTCCTTGTGTGATATTTTTTGATGAGATCGATGCTCTCTGCCCACGTAGATCTGGACATGATTCAGGTGCCAGCGTGCGGGTAGTGAACCAGCTGCTGACAGAGATGGACGGACTTGAAAGCCGCCGGCAGGTATTCATAATGGCAGCAACAAACCGGCCAGATATCATTGACCCAGCCATCCTGCGACCCGGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCC
  5   1   2       bld Neu7 5g3  in                         XL022h19.5p ACGAGGGTGGGTCTTTCAGCGCTGAACAGACTAAAGAGACATGAAGAATTGTCCGGGATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATTCAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACGGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGACCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGA
  5   1   2       bld Emb4 5g                         IMAGE:4930716.5p    GGACGCGTGGGTTCAGCGCTGAACAGACTAAAGAGACATGAAGAATTGTCCGGGATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATACAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACGGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGACCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGGCATGGGAGCAAGCATCCTCATTGATCTGTGCGAGGATGGAGCANANGCGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCCTCTGGAGAGTGAGAAGAAAGAGAAAGACCCCAAAGACCAGGNAACGGTCGAAAGTCAAAAAAGCAAAGCTTAATGATGTTCGATGGCCGAAAATTGGAGAAACCGGCCTCTTTAAATGGATTAAAGGAAAAGGGGTTAAAAGTCCCCAAAAGGTGGCAGGCATTCCTTTTCCCTTTGGAGGGTTTTGAAGGAATAATTTgggggggggAAAATGGAAGAATAACCCCCTTAAC
  5   1   2      seed Emb4 5g                IMAGE:4930716-IMAGp.IMAGp               TTCAGCGCTGAACAGACTAAAGAGACATGAAGAATTGTCCGGGATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATACAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACGGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGACCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGAGGCGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCAGGAACGGTCGAAAGTCAAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGAACCGGCTCTTAAATGATAA
  5   1   2       bld Ov1                             IMAGE:8331763.5p                                           GAAGAATTGTCCGGGATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATACAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGATGATGGAAATCTAGAAATTTCATCTGACTCTACTGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGATCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGAGGCGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCAGGAATGGTCGAAAGTCAAAAGCAAA
  5   1   2       bld Ga18      out                      xlk81p21ex.5p                                                 AAGAATTGTCCGGGATCTCCGGAATAGACGGNNNNTNAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACNTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATTCAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGNCACACCTGGCAAAAAGGGCANNAGAGGAGACGATGGAAATCTANAAATTTCATCTGACTCTACTGATAGTNTGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGNAACCTNNNCTCCGTATTGGAGACTCCTGTCAAAAATGATCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCANGGCACTAAGACACCAGAAGCTGGCTGGNTTATTGACANACTCCCAGTAAGGCAATGGAGCAAAGNATCCTCATTGATCTGTGCGAGGNTGGAGCAGANNNGTCGNNACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGANAAAGANCCCAAAGAC
  5   1   2       bld Ov1                             IMAGE:5048146.5p                                                          ATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATACAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACGGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGATCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAG
  5   1   2       bld Ga12      in                         XL175i20.5p                                                                                                                                                                                                                GCCGAATTNGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACTGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGATCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGAGGCGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCAGGAATGGTCGAAAGTCAAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGAACCGGCTCTTAAATGATAA
  5   1   2       bld Ga15      in                       XL479c13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTGACTCCGTATTGGAGACTCCTGTCAAAAATGATCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGAGGTGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCAGGAATGGTCGAAAGTCAAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGAACCGGCTCTTAAATGATAAAGGAAAGGGTAAAGTCCCAGAGGTGCAGCATTCTTCTCTGAGGTTTGAGGATATTGGGGGAAATGAAGATACCCTAAAGGAGGTGTGCAAAATGATGATTCACATGCGTCACCCTGAAGTTTACCAGCACCTAGGTGTGGTGCCTCCNCGGGGGTTTCTTCTGCACGGGCCGCCAGGATGTGGCAAAACCTTACTGGCTCAGGCAATTGCTGGGGAGCTGGACATGCCGATTCTCAAGGTGGCAGCCACTGAAATGGTCTCGGGTGTTTCTGGGGAGTCGGAACAGAAGCTCAGGGAGCTCTTCGACCAAGCGGTGTCCAGTGCTCCCTGCATCCTGTTTATAGATGAGATTGATTCCATAACCCCAAAAAGAGAAGTGGCCTCTAAGGATATGGAGAGGAGGATTGTGGCCCACGCTACTTACC
  5   1   2       bld DMZ                                  xl291p24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCAGGAACGGTCGAAAGTCAAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGAACCGGCTCTTAAATGATAAAGGAAAGGGTAAAGTCCCAGAGGTGCAGCATTCTTCTCTGAGGTTTGAGGATATTGGGGGAAATGAAGATACCCTAAAGGAGGTGTGCAAAATGATGATTCACATGCGTCACCCTGAAGTTTACCAGCACCTAGGTGTGGTGCCTCCGCGGGGGTTTCTTCTGCACGGGCCGCCAGGATGTGGCAAAACCTTACTGGCTCAGGCAATTGCTGGGGAGCTGGACATGCCGATTCTCAAGGTGGCAGCCACTGAAATGGTCTCGGGTGTTTCTGGGGAGTCGGAACAGAAGCTCAGGGAGCTCTTCGACCAAGCGGTGTCCAGTGCTCCCTGCATCCTGTTTATAGATGAGATTGATTCCATAACCCCAAAAAGAGAAGTGGCCTCTAANGATATGGAGAGGAGGATTGTGGCCCAGCTACTTACCTGCATGGACGATTTAAACAGCCTTGCCGTGACTACTCAAGTCCTCGTCATCGGAGCCACAAACCGGCCCGATTCACTGGACCCCGCTCTGAGACGTGCTGGAAGGTTTGACCGGGAAATCTGCCTGGGGATTCCTGATGA
  5   1   2       bld Em10                            IMAGE:8321528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACCAGGAATGGTCGAAAGTCAAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGAACCGGCTCTTAAATGATAAAGGAAAGGGTAAAGTCCCAGAGGTGCAGCATTCTTCTCTGAGATTCGAGGATATTGGGGGAAATGAAGATACCCTAAAGGAGGTGTGCAAAATGATGATTCACATGCGTCACCCTGAAGTTTACCAGCACCTTGGTGTGGTGCCTCCGCGGGGGTTTCTTCTGCACGGGCCGCCAGGATGTGGCAAAACCTTACTGGCTCAGGCAATTGCTGGGGAGCTGGACATGCCGATTCTCAAGGTGGCAGCCACTGAAATGGTCTCGGGTGTTTCTGGGGAGTCGGAACAGAAGCTCAGGGAGCTCTTCGACCAAGCGGTGTCCAGTGCTCCCTGCATCCTGTTTATAGATGAGATTGATTCCATAACCCCAAAAAGAGAAGTGGCCTCTAAGGATATGGAGAGGAGGATTGTGGCCCAGCTACTTACCTGCATGGACGATTTAAACAGCCTTGCCGTGACTACTCAAGTCCTCGTCATCGGAGCCACAAACCGGCCCGATTCACTGGACCCCGCTCTGAGACGTGCTGGAAGGTTTGACCGGGAAATCTGCCTGGGGATTCCTGATGAAGGTGCCAGAAAAAGGATTCTACAGACGTTGTGCCGTAAGCTGAAACTCCCAGAACCCTTTGACTTCTGCCGTC
  5   1   2       bld Emb9                            IMAGE:7975857.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATATTGGGGGAAATGAAGATACCCTAAAGGAGGTGTGCAAAATGATGATTCACATGCGTCACCCTGAAGTTTACCAGCACCTAGGTGTGGTGCCTCCGCGGGGGTTTCTTCTGCACGGGCCGCCAGGATGTGGCAAAACCTTACTGGCTCAGGCAATTGCTGGGGAGCTGGACATGCCGATTCTCAAGGTGGCAGCCACTGAAATGGTCTCGGGTGTTTCTGGGGAGTCGGAACAGAAGCTCAGGGAGCTCTTCGACCAAGCGGTGTCCAGTGCTCCCTGCATCCTGTTTATAGATGAGATTGATTCCATAACCCCAAAAAGAGAAGTGGCCTCTAAGGATATGGAGAGGAGGATTGTGGCCCAGCTACTTACCTGCATGGACGATTTAAACAGCCTTGCCGTGACTACTCAAGTCCTCGTCATCGGAGCCACAAACCGGCCCGATTCACTGGACCCCGCTCTGAGACGTGCTGGAAGGTTTGACCGGGAAATCTGCCTGGGGATTCCTGATGAAGGTGCCAGAAAAAGGATTCTACAGACGTTGTGCCGTAAGCTGAAACTCCCAGAACCCTTTGACTTCTGCCGTCTGGCTCACCTGACTCCGGGATATGTGGGGGCAGACTTGATGGCACTGTGCCGGGAAACCGCAATGTGCGCAGTGAACAGAGTCTTTATTA
  5   1   2       bld Em10                            IMAGE:8321328.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCATAACCCCAAAAAGAGAAGTGGCCTCTAAGGATATGGAGAGGAGGATTGTGGCCCAGCTACTTACCTGCATGGACGATTTAAACAGCCTTGCCGTGACTACTCAAGTCCTCGTCATCGGAGCCACAAACCGGCCCGATTCACTGGACCCCGCTCTGAGACGTGCTGGAAGGTTTGACCGGGAAATCTGCCTGGGGATTCCTGATGAAGGTGCCAGAAAAAGGATTCTACAGACGTTGTGCCGTAAGCTGAAACTCCCAGAACCCTTTGACTTCTGCCGTCTGGCTCACCTGACTCCGGGATATGTGGGGGCAGACTTGATGGCACTGTGCCGGGAAGCCGCAATGTGCGCAGTGAACAGAGTCCTTATCCAGATAAAGGACCAACAAGCTACTACAGAAGCAGCTGTGGAAGAGACAGACCCTCAGCCAGGAGCCGTAGCATTGCAAGCAGAGAAGCAGACAACTGCACCTGCCCAGAATGAGCTGCACCGGTTACTTGCGTTGCTGCAAGAACAGACTCCATTACCGGAGGCGGAGCTGCTGAGCCTGTGCATCGAGATGGATGATTTCCTTGGTGCCTTGCCCCATGGTACAGCCCTCTGCTAAGAGAGAAGGATTTGCCACCGTCCCTGATGTTACCTGGGCTCGATATTGGAGCGCTCGAGGAAATCCGGGAAAGAGCTTAC
  5   1   2       bld Sp1       out                   IMAGE:4968531.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGATCGGAGCCACAAACCGGCCCGATTCACTGGACCCCGCTCTGAGACGTGCTGGAAGGTTTGACCGGGAAATCTGCCTGGGGATTCCTGATGAAGGTGCCAGAAAAAGGATCCTACAGACGTTGTGCCGTAAGCTGAAACTCCCAGAACCCTTTGACTTCTGCCGTCTGGCTCACCTGACTCCGGGATATGTGGGGGCAGACTTGATGGCACTGTGCCGGGAAGCCGCAATGTGCGCAGTGAACAGAGTCCTTATCCAGATAAAGGACCAACAAGCTACTACAGAAGCAGCTGTGGAAGAGACAGACCCTCAGCCAGGAGCCGTAGCATTGCAAGCAGAGAAGCAGACAACTGCACCTGCCCAGAATGAGCTGCACCGGTTACTTGCGTTGCTGCAAGAACAGACTCCATTACCGGAGGCGGAGCTGCTGAGCCTGTGCATCGAGATGGATGATTTCCTTGGTGCCTTGCCCATGGTACAGCCCTCTGCTAAGAGAGAAGGATTTGCCACCGTCCCTGATGTTA
  5   1   2       bld Tbd7      out                        XL067l02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGAGCCGTAGCATTGCAAGCAGAGAAGCAGACAACTGCACCTGCCCAGAATGAGCTGCACCGGTTACTTGCGTTGCTGCAAGAACAGACTCCATTACCGGAGGCGGAGCTGCTGAGCCTGTGCATCGAGATGGATGATTTCCTTGGTGCCTTGCCCATGGTACAGCCCTCTGCTAAGAGAGAAGGATTTGCCACCGTCCCTGATGTTACCTGGGCCGATATTGGAGCGCTCGAGGAAATCCGGGAAGAGCTTACCATGGCAATTCTGGCAATGCTAGAGCAACTTCACTTGATTGCCGAAGTAACGCTAGCGAATTTACGCCTGGCGAAGTCTTGCGATGGATGTGAAGCCGTCTCTGGCAAATTTTCGCCAGTTAGGGAATTTGCCCCTATGCGCCAGTGAGAAAT
  5   1   2       bld Ooc3                            IMAGE:3437745.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGCCGTAGCATTGCAAGCAGAGAAGCAGACAACTGCACCTGCCCAGAATGAGCTGCACCGGTTACTTGCGTTGCTGCAAGAACAGACTCCATTACCGGAGGCGGAGCTGCTGAGCCTGTGCATCGAGATGGATGATTTCCTTGGTGCCTTGCCCATGGTACAGCCCTCTGCTAAGAGAGAAGGATTTGCCACCGTCCCTGATGTTACCTGGGCCGATATTGGAGCGCTCGAGGAAATCCGGGAAGAGCTTACCATGGCAATTCTGGCGCCAGTGAGAAATCCAGAACAGTTTAAAGCCCTTGGCCTGATGGCACCAGCTGGAGTCTTACTGGCAGGACCCCCTGGCTGTGGCAAAACTTTACTGGCAAAGGCTGTTGCAAACGAATCTGGACTCAATTTTATTTCGGTGAAAGGGCCAGAGCTGTTGAACATGTACGTTGGAGAGAGTGAACGCGCAGTCCGACAACTCTTCCAGAGGGCTACAAACTCTTCT
  5   1   2       bld Ov1       out                   IMAGE:5073067.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGCCCACGCGTCCGCTGAGCCTGTGCATCGAGATGGATGATTTCCTTGGTGCCTTGCCCATGGTACAGCCCTCTGCTAAGAGAGAAGGATTTGCCACCGTCCCTGATGTTACCTGGGCCGATATTGGAGCGCTCGAGGAAATCCGGGAAGAGCTTACCATGGCAATTCTGGCGCCAGTGAGAAATCCAGAACAGTTTAAAGCCCTTGGCCTGATGGCACCAGCTGGAGTCTTACTGGCAGGACCCCCTGGCTGTGGCAAAACTTTACTGGCAAAGGCTGTTGCAAACGAATCTGGACTCAATTTTATTTCGGTGAAAGGGCCAGAGCTGTTGAACATGTACGTTGGAGAGAGTGAACGCGCAGTCCGACAAGTCTTCCAGAGGGCTACAAACTCTTCTCCTTGTGTGATATTTTTTGATGAGATCGATGCTCTCTGCCCACGTATATTTGGACATGATTCAGGTGCCAGCGTGCGGGTAGTGAACCAGCTGCTGACTGAGATGGACGGACTTGAAAGCCGCCGGCAGGTATTCATAATGGCAGCAACAAACCGGCCAGATATCATTGACCCAGCCATCCTGCGACCCGGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCCTGCCGACCG
  5   1   2       bld Sp1                             IMAGE:4962779.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAGTTCTCTGCTAAGAGAGAAGGATTTGCCACCGTCCCTGATGTTACCTGGGCCGATATTGGAGCGCTCGAGGAAATCCGGGAACAGCTTACCATGGCAATTCTGGCCCCAGTGACAAATCCACAACCTTTTAAAGCCCTTGGCCTGATGGCACCACCTGGACTCTTACTGGCAGGACCCCCCTGGTGTGGCAAAACTTTACTGCCAAAGGCTCGCGCCAACCAATCCTCCACTCCATTT
  5   1   2       bld Em10      out                   IMAGE:7981896.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAATCCGGGAAGAGCTTACCATGGCAATTCTGGCGCCAGTGAGAAATCCAGAACAGTTTAAAGCCCTTGGCCTGATGGCACCAGCTGGAGTCTTACTGGCAGGACCCCCTGGCTGTGGCAAAACTTTACTGGCAAAGGCTGTTGCAAACGAATCTGGACTCAATTTTATTTCGGTGAAAGGGCCAGAGCTGTTGAACATGTACGTTGGAGAGAGTGAACGCGCAGTCCGACAAGTCTTCCAGAGGGCTACAAACTCTTCTCCTTGTGTGATATTTTTTGATGAGATCGATGCTCTCTGCCCACGTAGATCTGGACATGATTCAGGTGCCAGCGTGCGGGTAGTGAACCAGCTGCTGACAGAGATGGACGGACTTGAAAGCCGCCGGCAGGTATTCATAATGGCAGCAACAAACCGGCCAGATATCATTGACCCAGCCATCCTGCGACCCGGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCCTGCCGACCGGTTTGCCATATTAAAGACTATCACTAAGGATGGAACCCGCCCGCCCTTGGAAGCCGATGTCAACCTGGAAACGATTGCTAGTGACGTGCGCTGCGACTGCTTCACGGGTGCTGATCTCTCGGCCCTTGTACGGGAAGCTTCAATAAAGTGCCTGAGGCAAGAGATGTTAGTGCAGGAGCCGCACACAAACCCAGGGCAGATCAGGTGAGCCAANGAATTTTGAAGAGCTTTTATAAGTGAAACCTCAGTGTCA
  5   1   2      ests                            Xl3.1-IMAGE:7201837.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGACCCGGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCCTGCCGACCGGTTTGCCATATTAAAGACTATCACTAAGGATGGAACCCGCCCGCCCTTGGAAGCCGATGTCAACCTGGAAACGATTGCTAGTGACGTGCGCTGCGACTGCTTCACGGGTGCTGATCTCTCGGCCCTTGTACGGGAAGCTTCAATAAGTGCCCTGAGGCAAGAGATGTTAGTGCAGGAGCCGCACACAAACCCAGGGCAGATCAAGGTGAGCCAAAGGAATTTTGAAGAAGCTTTTAATAAAGTGAAACCCTCAGTGTCCAAGAAGGATCAGCTGATGTACGAGCTCCTGCGCCAGTCACTCAGCCGATAGCCGACACATGAGTGAAAGGAGGAGATGTTTATGTAGCAGAGGACTTTGAAGGGTCAGGGTTTGATACCAGCGGCCTTGTACAGTTAACCCAATCCGTTCCAGTGCCAAGCATCGTGCAGGGTTAATGAACAACCAATGTGAGCAGAGCGATTCCAGCAGCAGGCCGCAACTAAACCGCTCTGTACAGTCTGCTCTTATAGACCGTGTAACGGACAGAAACTATTTTAATTAATGCAACAAGTATATATGGATAAATGCGGTCAGATGAACCTGCCCTGGAGAGCTCACAATCAAAGGGGACTTTAG
                                                  Xl3.1-CHK-1012705892                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCCTGCCGACCGGTTTGCCATATTAAAGACTATCACTAAGGATGGAACCCGCCCGCCCTTGGAAGCCGATGTCAACCTGGAAACGATTGCTAGTGACGTGCGCTGCGACTGCTTCACGGGTGCTGATCTCTCGGCCCTTGTACGGGAAGCTTCAATAAGTGCCCTGAGGCAAGAGATGTTAGTGCAGGAGCCGCACACAAACCCAGGGCAGATCAAGGTGAGCCAAAGGAATTTTGAAGAAGCTTTTAATAAAGTGAAACCCTCAGTGTCCAAGAAGGATCAGCTGATGTACGAGCTCCTGCGCCAGTCACTCAGCCGATAGCCGACACATGAGTGAAAGGAGGAGATGTTTATGTAGCAGAGGACTTTGAAGGGTCAGGGTTTGATACCAGCGGCCTTGTACAGTTAACCCAATCCGTTCCAGTGCCAAGCATCGTGCAGGGTTAATGAACAACCAATGTGAGCAGAGCGATTCCAGCAGCAGGCCGCAACTAAACCGCTCTGTACAGTCTGCTCTTATAGACCGTGTAACGGACAGAAACTATTTTAATTAATGCAACAAGTATATATGGATAAATGCGGTCAGATGAACCTGCCCTGGAGAGCTCACAATCAAAGGGGA
  5  -1   2       bld Te2N      out                   IMAGE:7201837.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCCTTGGGGGGAttttttttGATGAAGATCGATGCTTTTTGCCCCACGTAGATTCGGACCAGATTCAGGTGCCCAGCGGGCCGGGAGGGAACCAGCGGCTGACTGAGATGGACGGACTTGAAAGCCNCCGGGCAAGTATTCATAATGGCAGCAACAAACCGGCCAGATATCATGCACCCAGCCATCATGCGACCCGGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCCTGCCGACCGGTTTGCCATATTAAAGACTATCACTAAGGATGGAACCCGCCCGCCATTGGAAGCCGATGTCAACCTGGAAACGATCGCTAGTGACGTGCGCTGCGACTGCTTCACGGGTGCTGATCTCTCGGCCCTTGTACGGGAAGCTTCAATAAGTGCCCTGAGGCAAGAGATGTTAGTGCAGGAGCCGCACACAAACCCAGGGCAGATCAAGGTGAGCCAAAGGAATTTTGAAGAAGCTTTTAATAAAGTGAAACCCTCAGTGTCCAAGAAGGATCAGCTGATGTACGAGCTCCTGCGCCAGTCACTCAGCCGATAGCCGACACATGAGTGAAAGGAGGAGATGTTTATGTAGCAGAGGACTTTGAAGGGTCAGGGTTTGATACCAGCGGCCTTGTACAGTTAACCCAATCCGTTCCAGTGCCAAGCATCGTGCAGGGTTAATGAACAACCAATGTGAGCAGAGCGATTCCAGCAGCAGGCCGCAACTAAACCGCTCTGTACAGTCTGCTCTTATAGACCGTGTAACGGACAGAAACTATTTTAATTAATGCAACAAGTATATATGGATAAATGCGGTCAGATGAACCTGCCCTGGAGAGCTCACAATCAAAGGGGACTTTAGTTAT
  3   1   2      seed Neu7 5g3  in                         XL022h19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATATCATTGACCCAGCCATCNTGCGACCCGGACGCCTCGATAAAACACTGTACGTGGGGCTTCCTCCCCCTGCCGACCGGTTTGCAATATTAAAGACTATCACTAAGGATGGAACCCGCCCGCCCTTGGAAGCCGATGTCAACCTGGAAACGATTGCTAGTGACGTGCGCTGCGACTGCTTCACGGGTGCTGATCTCTCGGCCCTTGTACGGGAAGCTTCAATAAGTGCCCTGAGGCAAGAGATGTTAGTGCAGGAGCCGCACACAAACCCAGGGCAGATCAAGGTGAGCCAAAGGAATTTTGAAGAAGCTTTTAATAAAGTGAAACCCTCAGTGTCCAAGAAGGATCAGCTGATGTACGAGCTCCTGCGCCAGTCACTCAGCCGATAGCCGACACATGAGTGAAAGGAGGAGATGTTTATGTAGCAGAGGACTTTGAAGGGTCAGGGTTTGATACCAGCGGCCTTGTACAGTTAACCCAATCCGTTCCAGTGCCAAGCATCGTGCAGGGTTAATGAACAACCAATGTGAGCAGAGCGATTCCAGCAGCAGGCCGCAACTAAACCGCTCTGTACAGTCTGCTCTTATAGACCGTGTAACGGACAGAAACTATTTTAATTAATGCAACAAGTATATATGGATAAATGCGGTCAGATGAACCTGNCCCTGGAGAGCTCACANCAAAGGGGA
  3   1   2       bld Ga12      in                         XL175i20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACGCCTCGATAAAACCCTGTACGTGGGGCTTCCTCCCCCTGCCGACCGGTTTGCCATATTAAAGACTATCACTAAGGATGGAACCCGCCCGCCCTTGGAAGCCGATGTCAACCTGGAAACGATTGCTAGTGACGTGCGCTGCGACTGCTTCACGGGTGCTGATCTCTCGGCCCTTGTACGGGAAGCTTCAATAAGTGCCCTGAGGCAAGAGATGTTAGTGCAGGAGCCGCACACAAACCCAGGGCAGATCAAGGTGAGCCAAAGGAATTTTGAAGAAGCTTTTAATAAAGTGAAACCCTCAGTGTCCAAGAAGGATCAGCTGATGTACGAGCTCCTGCGCCAGTCACTCAGCCGATAGCCGACACATGAGTGAAAGGAGGAGATGTTTATGTAGCAGAGGACTTTGAAGGGTCAGGGTTTGATACCAGCGGCCTTGTACAGTTAACCCAATCCGTTCCAGTGCCAAGCATCGTGCAGGGTTAA
  3   1   2       bld Ga15      in                       XL479c13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTACGGGAAGCTTCAATAAGTGCCNTGAGGCAAGAGATGTTAGTGCAGGAGCCGCACACAAGCCCAGGGCAGATCAAGGTGAGCCAAAGGAATTTTGAAGAGGCTTTTAATAAAGTGAAACCCTCAGTGTCCAAGAAGGATCAGNTGATGTACGAGCTCCTGCGCCAGTCACTCAGCCGATAGCCGACACATGAGTGAAAGGAGGAGATGTTTATGTAGCAGAGGACTTTGAAGGGTCAGGGTTTGATACCAGCGGCCTTGTACAGTTAACCCAATCCGTTCCAGTGCCAAGCATCGTGCAGGGTTAATGAACAACCAATGTGAGCAGAGCGATTCCAGCAGCAGGCCGCAACTAAACCGCTCTGTACAGTCTGCTCTTATAGACCGTGTAACGGACAGAAACTATTTTAATTAATGCAACAAGTATATATGGATAAATGCGGT
  3   1   2       bld Tbd7                                 XL082k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACAGAAACTATTTTAATTAATGCAACAAGTATATATGGATAAATGCGGTCANATGAACCTGCCCTGGANAGCTCACAATCAAAGGGGACTTTAGTTATAAACAAAAANGTCATTCTCCTCTTGTTTGATTGTGGTCCGNATCTTTAATTGGGACAATTCCAGTAAGTTGGCAGGACAAAGCTTAGGTGCAGGGACCCCTGGAGGAGTGTCCTGCCAACTGAGTANAATGGGGTGCCATGATTTNTGATGGTGACCCTGATTGTTGCCTGTTANATGTCAACCATTATGCAATTGTTNTANACTGGTTCCCNCAGTCCAGGGGCAAGTGAGTGGANATNATGCGAGGCCAAGGGGGATTTCCTGGNGTCAGGGGCCCCTTAGGGGGTGTGGTGGGGGGGGGGGTAGAAGTCCTTGTACACCCCAGTCCAACACTGGAGCCAATGAAACCTTCCCAGGGGCAGTACAAACGGCAAACACACAAATACAGCACCGNGAATATGTAGGCACTATANAATAAAGAACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)