Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL164a04.3                            3 PI      91        542     1524                noggin 1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 79%

 1012838761 Xl3.1-xlk118h13ex.3.5 - 20 ESTs
                                                                       ........-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-xlk118h13ex.3.5                                                           AGGGCAGAGAGGAGCAGCAAAAGCTGCGCAGCTCTCTCACTCCCCCTTTCCTTCTGCTTCACTCTATAAGGGCCTGCAAATGAAAGAGACCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTGCGCGCCGCTGGCTGATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGTTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGGAGCCAGCAGGCAGACAAAGTGGTGCCACCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGGGCTCTGCTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGCCTCGGGGGCAATGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGGGCATGG------------CAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCGTGGATAACCATTCAGTACCCTGTCATTTCCGAGTGCAAATGCTCATGCTGAGACTCTTGGACTAATGCAAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATTGGTCTAAATTACTATTAAAAGGTCAGTATTATTCTTTTAAATAACCAGTGTCTACTGTATTTCCAACACTATTATCCNGGTTGTGTTTTATTTTAAATAATATTATTATTTTTTTTTTTTTGCCTAATGTATCTCTATTTATATCCAAAAAAAGAG------------GAAGCATTTTTTTTTAAAGAAAAAAAAAACAAATTTAATAGTTTAATNANATAGAAGCATTTTTTTCCTTTAATGGAAAATGTGCCTTTTTTTGATGGACCTCAAAAAAAAAATGAATAAAAACCAGAGCAAGATATAATTTTCAGTTTATTGTACATAGAAAGAGAACACATTTTGAAAGATGAAAAATTTTACTCTTGTAAATGAGAACTNTCTGCTATTTATTCT
                                                  Xl3.1-CHK-1012722538                                                                 GAGAGGAGCAGCAAAAGCxxxxxxGCTCTCxCxCxCCCCCTTTCCTTCTGCTTCACTCTAxxxGxxCCTGCAAATGAAAGAGACCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTGCGCGCCGCTGGCTGATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGTTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGGAGCCAGCAGGCAGACAAAGTGGTGCCACCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGGGCTCTGCTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGCCTCGGGGGCAATGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGG------------AGCTGCCAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCGTGGATAACCATTCAGTACCCTGTCATTTCCGAGTGCAAATGCTCATGCTGAGACTCTTGGACTAATGCAAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATTGNTCTAAATTACTATTAAAAGGTCAGTATTATTCTTTTAAATxAxCxxxxxxxxCTGTATTTCCAAxxxxxxTxxxCCGGTTGTGNTTTATTTTAAxxAxxxTTATTATTATTTTTTTTTTGCCTAATGTATCTCTATTTATATCCAAAA------------------------TTTTTTTTTAAAGAAAAAAAAAACAAATTTAATAGTTTAATNATATAGAAGCATTTTTTTCCTTTAATGGAAAATGTGCCTTTTTTTGATGGACCTCAAAAAAAAAATGAATAAAAACCAGAGCAAGATATAATTTTCAGTTTATTGTACATAGAAAGAGAACACATTTTGAAAGATGAAAAATTTTACTCTTGTAAATGAGAACTNTCTGCTATTTATTCTTTTATT
                                                      consensus depths                                                                2     5     2     5     2     5     2     5     2     5     2     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     5     7     5     7     5     7     5     7     5     8     5     8     5     8     5     9     5     9     5     9     3     9     6     9     6     9     7     9     7     9     6     9     4     9     7     9     7     9     6     9     7     9     8    10     8    10    10    12    10    12     9    10     8    10     9    10    10    10    10    10     8    10    10    10    10    10     8    10    11    11    11    11    11    11    10    11    11    11    11    11     9     9     9     9     8     9     8     9     7     9     8    10     8    10     9    11     9    10     8     9     9     9     9     9     8     9     9     9     5     9     3     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     8     9     8     9     7    10     8    10     6     9     7     9     7     9     7     9     7     8     5     8     0     8     7     8     6     8     7     8     6     8     7     8     6     8     7     8     7     8     6     7     6     7     6     7     5     7     6     7     6     7     6     7     6     7     6     7     6     7     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     1     3     2     3     2     3     1     3     1     2     0     1     1     2     3     3     3     3     2     3     3     3     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4
  5   1   2      ests                              Xl3.1-xlk118h13ex.3                                                           AGGGCAGAGAGGAGCAGCAAAAGCTGCGCAGCTCTCTCACTCCCCCTTTCCTTCTGCTTCACTCTATAAGGGCCTGCAAATGAAAGAGACCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTGCGCGCCGCTGGCTGATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGTTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGGAGCCAGCAGGCAGACAAAGTGGTGCCACCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGGGCTCTGCTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGCCTCGGGGGCAATGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGGGCATGG------------CAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCGTGGATAACCATTCAGTACCCTGTCATTTCCGAGTGCAAATGCTCATGCTGAGACTCTTGGACTAATGCAAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATT
  5   1   2      ests                              Xl3.1-xlk127o24ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTAAAGAAAAAAAAAACAAATTTAATAGTTTA------------CATTTTTTTCCTTTAATGGAAAATGTGCCTTTTTTTGATGGACCTCAAAAAAAAAATGAATAAAAACCAGAGCAAGATATAATTTTCAGTTTATTGTACATAGAAAGAGAACACATTTTGAAAGATGAAAAATTTTACTCTTGTAAATGAGAACTNTCTGCTATTTATTCTTTTATTTTT
                                               BLH ATG     458      67                                                           
                                               BLH MIN     836      25                                                           
                                               BLH MPR     496      24                                                           
                                               BLH OVR     845     324                                                           
                                               CDS MIN     845      24                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 2e-011     XP_001186635.1 PREDICTED: similar to noggin4 [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 3e-021     NP_001071777.1 noggin protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Gg ---- 2e-054     NP_989454.1 noggin [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Bt ---- 1e-050     XP_582573.3 PREDICTED: similar to noggin [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 7e-052     NP_005441.1 noggin precursor [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 5e-052     NP_032737.1 noggin [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dr ---- 6e-060     NP_571058.2 noggin 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xt ---- 9e-061     AAT91717.1 noggin 1 [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xl ---- 3e-061     NP_001079113.1 noggin [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                 Xl3.1-xlk118h13ex.3.5                                                                                                                                           TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------TGA---TGA---------------------------------------------------------------------------------------------------------TGA---------TGA------TGA---------------------------------------------------------ATG---------TGA---------------------------------------------------------------------------------------------------------------TAG------------------------------------------------TAGTGA------------------------TGA------------------TGA------------------TAA------------------------------------TGA---------------------------------------------------------------------------TAG------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TGA------TAA------------------------------------------TAA---------------------------------------------------------ATG------------------ATG------------------ATG---------ATGTAG---------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------TAA------------------TAATAG---------------------------------------------------TGA------------------TGA------------------------------------------------------------------TGA---------------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                        ...
  5   1   2      ests                              Xl3.1-xlk118h13ex.3                                                           AGGGCAGAGAGGAGCAGCAAAAGCTGCGCAGCTCTCTCACTCCCCCTTTCCTTCTGCTTCACTCTATAAGGGCCTGCAAATGAAAGAGACCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTGCGCGCCGCTGGCTGATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGTTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGGAGCCAGCAGGCAGACAAAGTGGTGCCACCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGGGCTCTGCTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGCCTCGGGGGCAATGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGGGCATGG------------CAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCGTGGATAACCATTCAGTACCCTGTCATTTCCGAGTGCAAATGCTCATGCTGAGACTCTTGGACTAATGCAAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATT
                                                  Xl3.1-CHK-1012690992                                                                 GAGAGGAGCAGCAAAAGCxxxxxxGCTCTCxCxCxCCCCCTTTCCTTCTGCTTCACTCTAxxxGxxCCTGCAAATGAAAGAGACCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTGCGCGCCGCTGGCTGATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGTTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGGAGCCAGCAGGCAGACAAAGTGGTGCCACCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGGGCTCTGCTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGCCTCGGGGGCAATGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGG------------AGCTGCCAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCGTGGATAACCATTCAGTACCCTGTCATTTCCGAGTGCAAATGCTCATGCTGAGACTCTTGGACTAATGCAAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATTGNTCTA
  5   1   2       bld Ga18 5g3  in                      xlk162b09ex.5p AATAAATCCTAAGTAGCCAGAGGACGAGCTACAGACTGGTTGCGNNNNNGGTTTATCCAGGGCAGAGAGGAGCAGCAAAAGCACATTGCNNNNNTCACTCCCCCTTTCCTTCTGCTTCACTCTATAAGGGCTCCTGCAAATGAAAGAGACCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTNCnnnnnnnnnnnATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGTTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGGAGNNAGCAGNNAGACAAAGTGGTGCCACCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGGGCTCTGNTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGNAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGNATGGATCATTCCCAGTGCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGANCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCT
  5   1   2       bld Ga14                               Ga14-p14h8.5p                       CTACAGACNGGTTGNGGTGCAGGGTTTATCCANGGGCAGAGAGGANCAGCAAAAGCACATTGCGCAGCTCTCACTCCCCCTTTCCTTCTTCTTCACTCTATAAGGGCTCCTGCAAATGAAAGANACCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTGCGCGCCGCTGGCTGATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGTTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGNTGGAGCCAGCAGGCAGACAAAGTGGTGCCACCAAGGACTGT
  5   1   2       add Ga18      in                      xlk127o24ex.5p                         ANNGCTACAGACTGGTTGCNNNNNNGGTTTATCCAGGGCAGAGAGGAGCAGCAAAAGCACATTGCNCNNNTCACTCCCCCTTTCCTTCTGCTTCACTCTATAAGGGCTCCTGCAAATAAAAGAGANCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTNCnnnnnnnnnnnATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGNTTCTTCTAGGAGCAGATCGAGTCTCTGGNTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGGAGCAGCAGNAGACAAAGNGGTNNCNCCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGAGCTCTNNTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCNATCCNCTAGNGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTNTGATCTCTGGCAAGAAA
  5   1   2       bld Ga16                                 DN828606.5p                                         CGCAGGGTTTATCCAGGGCAGAGAGGAGCAGCAAAAGCACATTGCGCAGCTCTCACTCCNCCTTTCCTTCTGCTTCACTCTATAAGGGCTCCTGCAAATGAAAGAGACCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTGCGCGCCGCTGGCTGATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGTTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGGAGCCAGCAGGCAGACAAAGTGGTGCCACCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGGGCTCTGCTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGCAA
  5   1   2       bld DMZ  5g                              xl312i16.5p                                                        GGCAGAGAGGAGCAGCAAAAGCACATTGCGCAGCTCTCACTCCCCCTTTCCTTCTTCTTCACTCTAGTAAGGGCTCCTGCAAATGAAAGAGACCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTGCGCGCCGCTGGCTGATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGTTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGGAGCCAGCAGGCAGACAAAGTGGTGCCACCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGGGCTCTGCTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGC
  5   1   2       add Ga18 5g3  in                      xlk105o16ex.5p                                                                                                               TTCTGCTTCACTCTATAAGGGCTCCTGCAAATGAAAGAGACCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTGCGnnnnnnnnnnATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGTTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGGAGNCAGCNNNNNACAAAGTGGTGCCACCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGGGCTCTNNTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGNCTTAGAATAGANCAAGGGGGTTGCCAACATTATCTGCACANCAGANCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGNATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCNTNCTGAGGACTTTAANGGTTGGACACTTTGACCCCCNACTTTATG
  5   1   2       add Ga18 5g3  in                      xlk118h13ex.5p                                                                                                                     TTCACTCTATAAGGNCTCCTGNAAATGAAAGAGACCTGCGGGGATTTGCGCGGACAGATGTAAAGGAGATCCTGCAACTTTCTCTGGTTGCATCCCTGGGAGTCGCTNCnnnnnnnnnnnATTGCGACTGTTGCTTTCCACAGCTCCCTTCTTCCGCAGTTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGGAGCCAGCNNNNNACAAAGTGGTGCCACCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGGGCTCTNNTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGNGACTATATATGCTCTGATGGTCTTCTTGGGACTTNGAATAGACCAAGGGGGNTGCCAACATTATCTGCACATCAGANCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCANNGAGAAGGNNCTNNACGAGACCTTGCTGAGNANTTTNATGGTTGGNCACTTTGNCCCCAACTTTNTNNNNCATCCTGCC
  5   1   2       bld Ga18 5g3  in                      xlk144c09ex.5p                                                                                                                                                                                                                                                                                      TTTCTTCTAGGAGCAGATCGAGTCTCTGGTTACCATGGTGATCGAGCTGAAAGTGAAGAATATTTAAGAGAGGGGAGGCTGNNNNNGCNGNNGACAAAGTGGTGCCACCAAGGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGAGCTCTGCTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATCCGCTAGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGNTGGATCTCCTTCTTAGNCAGAANNCCTCGGGNNAATGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGNTTCAGAGCAAAAAGCACAGACTGAGCAAGAAANTCAGGAGAAAGTTGCAGATGTGGCTCTGGNCCCAGACCTTCTGTCCTGTCCTTTANACATGGNANGANCTAGGNNNCAGGNTTTGGC
  3   1   2       bld Ga18 5g3  in                      xlk118h13ex.3p                                                                                                                                                                                                                                                                                                                              TCGAGCNNNAAGNNANNANNTNANNNGAGGGGANGCNNGANCCNGNAGGCAGNCAAAGTGNNGCNNCNANGGNCTGTGCGTAAAGGGTGAGNGCATTGGAGACAGACAGNNNNTCTGCTGNACTTCCACTTGACTGCGATGAGAGGGGGGANTCCCCANTTCGCTAGGNGCCCCTGANCCCCCCAGAATTCCTCNTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGNGNCTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGCCTCGGGGGCAATGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGGGCATGGTTNNNAAGCTGCCAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCGTGGATAACCATTCAGTACCCTGTCATTTCCGAGTGCAAATGCTCATGCTGAGACTCTTGGACTAATGCAAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATTGNTCTAAATAC
  5   1   2      seed DMZ  5x3                             xl333g24.5p                                                                                                                                                                                                                                                                                                                                                                                                    GGACTGTGCGTAAAGGGTGAGCGCATTGGAGACAGACAGGGGCTCTGCTGAACTTCCACTTGACTGCGATGAGAGGGGGGAATCCCCAATTCGCTAGGTGCCCCTGAACCCCCCAGAATTCCTCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGCCCTCGGGGGCAATGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGG
  3   1   2       bld Ga18 5g3  in                      xlk162b09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCTGNNCCCCNANAANNCNNCNTCTGATGCNNNNTTTNNGNTCTCTGNNANNAAATNNNANNACCCAACTCNNNTTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTNCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGNATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGNCTCCTAGTGAAANCCTACCACTGGTGGNCCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGNCCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACATTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGCCTCGGGGGCAATGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGNCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGGGCATGGTNNNNAAGCTGCCAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCGTGGATAACCATTCAGTACCCTGTCATTTCCGAGTGCAAATGCTCATGCTGAGACTCTTGGACTAATGCAAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATTGNTCTAA
  3   1   2       bld Ga18 5g3  in                      xlk140p11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGANNACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGNCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAANCCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGCCTCGGGGGCAATGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGGGCATGGTTNNAAAGCTGCCAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCGTGGATAACCATTCAGTACCCTGTCATTTCCGAGTGCAAATGCTCATGCTGAGACTCTTGGACTAATGCAAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATTGNTCTAAATAC
  5   1   2       bld Ga18 5g3  in                      xlk140p11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTCTGATGCATTATTTATGATCTCTGGCAAGAAATCGGGAGCACCCAACTCTTATTTTGTGCAGCTGTGTGCAGCATGGATCATTCCCAGTGCCTTGTGACTATATATGCTCTGATGGTCTTCTTGGGACTTAGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGNCCTCGNNNNNATGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGNTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGNCTTGTTCTGTGCCAGAGNNNTGGTTTGCANNNNNNCCAAGNCTATGCATTTGACCATCTTAAGGTGGAGANGTCAACGCAGGGNTCAGCAGAAGNGTGCGNGGATAACCATTCAGTACCCTGTCATTTCCNAGTGCAAAT
  5   1   2       bld Ga18      in                      xlk123f07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAATAGACCAAGGGGGTTGCCAACATTATCTGCACATCAGACCGGCTCCTAGTGAAAACCTACCACTGGTGGACCTTATTGAGCACCCGGATCCCATCTATGATCCCAAGGAGAAGGATCTTAACGAGACCTTGCTGAGGACTTTAATGGTTGGACACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGCCCTCGNNNNNNTGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGNTTTGGCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGNCTTGTTCTGTGCCAGAGGNNATGGTTTGCANNNNNCCAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGNTCAGCAGAAGTGTGCGTGGATAACCATTCAGTACCCTGTCATTTCCGAGTGCAAATGCTCATNCTGAGACTCTTGGACTAATGCAAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATNTGTGTGTATATATGGCATTGNNCTAAATTACTNNTNAAAGGNCAGNNTTNNTCTTTTAAATAANC
  3   1   2       add Ga18 5g3  in                      xlk105o16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNNNTNCTNNGACTTTAATGNTTGGNNNCTTTGACCCCNACTTTATGGCCNCCNTNCTGCNAGAGGAGAGNCTTGGAGTGGAGGACATTGGGGAGTTGGNTCTCCTTCTTAGNNAGAAGCCTCGGGGNNAATGCCANNGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGANAGTTGCAGATGTGGCTCTGNTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGNCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGGGCATGGTTTNNAAAGCTGCCAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCGTGGATAACCATTCAGTACCCTGTCATTTCCGAGTGCAAATGCTCATGCTGAGACTCTTGGACTAATGCAAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATTGGTCTAAATTACTATTAAAAGGTCAGTATTATTCTTTTAAATAACCAGTGTCTACTGTATTTCCAACACTATTATCCTGGTTGTGTTTTATTTTAATAATATTATTATTATTTTTTTTTTGCCTAATGTATCTCTATTTATATCCAAAAAAAGAG
  5   1   2       bld Ga18      in                       xlk71g06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGNCACTTTGACCCCAACTTTATGGCCACCATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGNCCTCGNNNNNNTGCCAGCGGAAATCAAGGGACTGGAGTTTTACGAGGGGCTTCAGAGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGGAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGGGNATGGTTTGCANNNNNCCAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCGTGGATAACCATTCAGTACCCTGTCATTTCCGAGTGCAAATGCTCATGCTGAGACTCTTGGACTAATGCAAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGNATTGGNCTAAATTACTATTAAAAGGNCAGNATTATTCTTTTAAATAACCAGTGTCTACTGTATTTCCAACACTATTATCCTGGTTGNGTTTTATTTTAATAATATTATTATTAtttttttttttGCCTAATGNATCTCTATTNTNTCNAAAAAANGAG
  3   1   2       add Ga18      in                      xlk123f07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCCTTTNNNCATGGAATGACCTAGGGACCAGGTTTNGNCTCGCTNTGTGAAAGTAGGGAGCTGCTACAGTNAGAGNTCTTGTTCTGTNCCAGAGGGCATGGTNNNNANAGCTNCCAAGTCTATGCATTTGNNCATCTTAAGGTGGAGATGNCNACGCAGGGTTCAGCAGAAGTGTGCGTGGATANCCATTCAGTACCCTGTCATTTCCGAGTGCAAANGCTCATGCTGAGACTCTTGGACTAATGCAAAAAGACANNANCTTCATGGTTCAAGCTTCATGTNATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATTGGTCTAAATTACTATTAAAAGGTCAGTATTATTCTTTTAAATANCCAGTNTCTACTGTATTTCCAACACTANTATCCNGGTTGTGNTTTATTTTAATAATATNATTANTTTTTTTTTTTTNCCTAANGNANCTCTATTNATATCCAAAAAAAGAGNNNNNNNCTNGNNGAAGCATTTTTTTTTAAAGAAAAAAAAAACAAATTTAATAGTTTAATnATATAGAAGCATTTTTTTCCTTTAATGGAAAATGTGCCTTTTTTTGATGGACCTCAAAAAAAAAATGAATAAAAACCAGAGCAAGATATAATTTTCAGTTTATTGTACATAGAAAGAGAACACATTTTGAAAGATGAAAAATTTTACTCTTGTAAATGAGAACTATCTGCTATTTANTCTTNT
  5   1   2      ests                              Xl3.1-xlk127o24ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTAAAGAAAAAAAAAACAAATTTAATAGTTTA------------CATTTTTTTCCTTTAATGGAAAATGTGCCTTTTTTTGATGGACCTCAAAAAAAAAATGAATAAAAACCAGAGCAAGATATAATTTTCAGTTTATTGTACATAGAAAGAGAACACATTTTGAAAGATGAAAAATTTTACTCTTGTAAATGAGAACTNTCTGCTATTTATTCTTTTATTTTT
                                                  Xl3.1-CHK-1012713894                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGAAAAAAAAAACAAATTTAAT------------TAGAAGCATTTTTTTCCTTTAATGGAAAATGTGCCTTTTTTTGATGGACCTCAAAAAAAAAATGAATAAAAACCAGAGCAAGATATAATTTTCAGTTTATTGTACATAGAAAGAGAACACATTTTGAAAGATGAAAAATTTTACTCTTGTAAATGAGAACTNTCTGCTATTTATTCTTTT
  3   1   2      seed Ga18 5g3  in                      xlk144c09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGNGAANNNTTTTTTTTTAAAGAAAAAAAAAACAAATTTAATAGTTnAAnnAnATAGAAGCATTTTTTTCCTTTAATGGAAAATGTGCCTTTTTTTGATGGACCTCAAAAAAAAAATGAATAAAAACCAGAGCAAGATATAATTTTCAGTTTATTGTACATAGAAAGAGAACACATTTTGAAAGATGAAAAATTTTACTCTTGTAAATGAGAACTNTCTGCTATTTATTCTTTTATTTTTNNTTCCTCCC
  3   1   2       bld Ga18      in                      xlk127o24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNNTTTTTTTTTAAAGAAAAAAAAAACAAATTTAATAGTTTAAnAAnATAGAAGCATTTTTTTCCTTTAATGGAAAATGTGCCTTTTTTTGATGGACCTCAAAAAAAAAATGAATAAAAACCAGAGCAAGATATAATTTTCAGTTTATTGTACATAGAAAGAGAACACATTTTGAAAGATGAAAAATTTTACTCTTGTAAATGAGAACTNTCTGCTATTTATTCTTTTANTTTT
  3   1   1       add Ga18      in                       xlk71g06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANNGAAGCATTTTTTTCCTTTAANGGAAAATGTGCCTTTTTTNGANGGACCTCAAAAAAAAAATGAATAAAAACCAGAGCAAGATATAATTTTCAGTTTATTGTACATAGAAAGAGAACACATTTTGAAAGATGAAAAATTTTACTCTTGTAAATGAGAACTNTCTGCTATNNNNCNTTTATTTTNNNTNCCTCCCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)