Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4757600-IMAGp.5                19 PI      90         12     1524                MGC80089 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012838767 Xl3.1-IMAGE:6947866.3.5 - 14 ESTs
                                                                       ..-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:6947866.3.5             GAAGCCAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGTCTGAGAGTGAAGCATCCCATGGCTCTGTAGCACTGACACTGCCTGCCGAGGGATCCCCTGTGAGCTCTGCATCTGAGCCCTCCTCTACCTCATCTCCACACTGAGGAAGAAGAGAGGCAGAATCTCCTCTGAAGCCCAGGCAGCTTATTTTGCACAGGACACTGTTGCTGCACAAAGAGAGGTGTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTTTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGTGTAGCAGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATACATGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGACTTCAGTGGCTGAAATGACCAAAGAGCAGGCATCCCAGCTTGGAGGAGCTGTCATGTCTGGAGCTGGGAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAAGAGGGCCAGGAAGCTTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACTAGAAGGGGAGAACTATGAAGAGGCCCCACAGGATGATTACCAGGAATATGAGCCTGAAGCATAACAACACAATATTCTGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAATAAAAAAAAATACAAATAAAGTTCCTTTTCCTAAGCCCCCCCCATTTCTTTTAAAAAGATGGATGAAGCCCACCTCCCTCTTCTCCTAAGAAGTGACTTCTCCCTTCAATTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTACGGAAACCATGAATGCATTGTTACTGTTTTTTGCAGTCCTTTTTGCCCCCGAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGTGAATTTTGTGTCCTATATTTATTTTGTAACTTGTTTATTGTTTTTTTCTCTTTTGCTCTGACGTAATAGCTGATTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATGCTACAGGGTGTCTACCTTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTTGCTGTTGTTTTTTTATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGATTGTTCTGTAAAGCAGAGAGAAATATGTGTGAATCCATACAGAATCTTTTGAATGTTCTTGTGTT
                                                  Xl3.1-CHK-1012722085                   AGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGTCTGAGAGTGAAGCATCCCATGGCTCTGTAGCACTGACACTGCCTGCCGAGGGATCCCCTGTGAGCTCTGCATCTGAGCCCTCCTCTACCTCATCTCCACACTGAGGAAGAAGAGAGGCAGAATCTCCTCTGAAGCCCAGGCAGCTTATTTTGCACAGGACACTGTTGCTGCACAAAGAGAGGTGTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTTTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGTGTAGCAGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATACATGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGACTTCAGTGGCTGAAATGACCAAAGAGCAGGCATCCCAGCTTGGAGGAGCTGTCATGTCTGGAGCTGGGAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAAGAGGGCCAGGAAGCTTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACTAGAAGGGGAGAACTATGAAGAGGCCCCACAGGATGATTACCAGGAATATGAGCCTGAAGCATAACAACACAATATTCTGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAATAAAAAAAAATACAAATAAAGTTCCTTTTCCTAAGCCCCCCCCATTTCTTTTAAAAAGATGGATGAAGCCCACCTCCCTCTTCTCCTAAGAAGTGACTTCTCCCTTCAATTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTACGGAAACCATGAATGCATTGTTACTGTTTTTTGCAGTCCTTTTTGCCCCCGAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGTGAATTTTGTGTCCTATATTTATTTTGTAACTTGTTTATTGTTTTTTTCTCTTTTGCTCTGACGTAATAGCTGATTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATGCTACAGGGTGTCTACCTTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTTGCTGTTGTTTTTTTATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGATTGTTCTGTAAAGCAGAGAGAAATATGTGTGAATCCATACAGAATCTTTTGAATGTTCT
                                                      consensus depths                  2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     4     6     4     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     7     4     7     4     8     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     4     8     4     8     4     8     4     9     4     9     4     8     6     9     6     9     6     9     6     8     6     8     6     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     6     6     7     7     7     7     7     7     6     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     7     5     7     5     7     5     7     5     7     5     7     4     6     4     6     4     6     4     6     4     6     3     6     3     6     2     4
  5   1   2       e50                            Xl3.1-IMAGE:6947866.5             GAAGCCAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGTCTGAGAGTGAAGCATCCCATGGCTCTGTAGCACTGACACTGCCTGCCGAGGGATCCCCTGTGAGCTCTGCATCTGAGCCCTCCTCTACCTCATCTCCACACTGAGGAAGAAGAGAGGCAGAATCTCCTCTGAAGCCCAGGCAGCTTATTTTGCACAGGACACTGTTGCTGCACAAAGAGAGGTGTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTTTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGTGTAGCAGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATACATGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGACTTCAGTGGCTGAAATGACCAAAGAGCAGGCATCCCAGCTTGGAGGAGCTGTCATGTCTGGAGCTGGGAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAAGAGGGCCAGGAAGCTTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACTAGAAGGGGAGAACTATGAAGAGGCCCCACAGGATGATTACCAGGAATATGAGCCTGAAGCATAACAACACAATATTCTGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAATAAAAAAAAATACAAATAAAGTTCCTTTTCCTAAGCCCCCCCCATTTCTTTTTAAAAGATGGATGAAGCCCACCTCCCTCTTCTCCTA
  5   1   2       e50                            Xl3.1-IMAGE:6947866.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACAAATAAAGTTCCTTTTCCTAAGCCCCCCCCATTTCTTTTAAAAAGATGGATGAAGCCCACCTCCCTCTTCTCCTAAGAAGTGACTTCTCCCTTCAATTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTACGGAAACCATGAATGCATTGTTACTGTTTTTTGCAGTCCTTTTTGCCCCCGAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGTGAATTTTGTGTCCTATATTTATTTTGTAACTTGTTTATTGTTTTTTTCTCTTTTGCTCTGACGTAATAGCTGATTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATGCTACAGGGTGTCTACCTTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTTGCTGTTGTTTTTTTATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGATTGTTCTGTAAAGCAGAGAGAAATATGTGTGAATCCATACAGAATCTTTTGAATGTTCT
                                               BLH ATG     252     460             
                                               BLH MIN     252      49             
                                               BLH MPR     252      49             
                                               BLH OVR     252     750             
                                               CDS MIN     252      49             
                                               ORF LNG     252      15             
                                                                                                                                                                                                                                                                                                                                               PROTEIN === Dr ==== 7e-042     NP_957263.1 similar to synuclein, beta [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PROTEIN === Gg ==== 2e-054     NP_990002.1 beta-synuclein [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 7e-055     NP_291088.1 synuclein, beta [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 2e-056     NP_001001502.1 beta-synuclein [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PREDICTED = Cf ==== 2e-056     XP_536421.2 PREDICTED: similar to synuclein, beta isoform 1 [Canis familiaris] ====================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PROTEIN === Bt ==== 3e-057     NP_001068828.1 synuclein, beta [Bos taurus] =======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 7e-066     CAJ82900.1 synuclein, beta [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PREDICTED = Xl ==== 8e-070     NP_001088570.1 hypothetical protein LOC495448 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================
                                               Xl3.1-IMAGE:6947866.3.5                                                    TAG---------------------ATG------TAG---TGA------------------------TGA------------------------------------------------------------------TGA---------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------ATG------------------TAA------------TAA------------------------ATG---------------------------------------------------------------------------TGA------------TAA------------------------------------------------------------------TGATAA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TGA---------TGA---------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TGA---------TAG---------------------------------------------------------------------------------------------------------TAA------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       e50                            Xl3.1-IMAGE:6947866.5             GAAGCCAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGTCTGAGAGTGAAGCATCCCATGGCTCTGTAGCACTGACACTGCCTGCCGAGGGATCCCCTGTGAGCTCTGCATCTGAGCCCTCCTCTACCTCATCTCCACACTGAGGAAGAAGAGAGGCAGAATCTCCTCTGAAGCCCAGGCAGCTTATTTTGCACAGGACACTGTTGCTGCACAAAGAGAGGTGTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTTTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGTGTAGCAGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATACATGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGACTTCAGTGGCTGAAATGACCAAAGAGCAGGCATCCCAGCTTGGAGGAGCTGTCATGTCTGGAGCTGGGAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAAGAGGGCCAGGAAGCTTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACTAGAAGGGGAGAACTATGAAGAGGCCCCACAGGATGATTACCAGGAATATGAGCCTGAAGCATAACAACACAATATTCTGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAATAAAAAAAAATACAAATAAAGTTCCTTTTCCTAAGCCCCCCCCATTTCTTTTTAAAAGATGGATGAAGCCCACCTCCCTCTTCTCCTA
                                                  Xl3.1-CHK-1012702144                   AGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGTCTGAGAGTGAAGCATCCCATGGCTCTGTAGCACTGACACTGCCTGCCGAGGGATCCCCTGTGAGCTCTGCATCTGAGCCCTCCTCTACCTCATCTCCACACTGAGGAAGAAGAGAGGCAGAATCTCCTCTGAAGCCCAGGCAGCTTATTTTGCACAGGACACTGTTGCTGCACAAAGAGAGGTGTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTTTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGTGTAGCAGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATACATGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGACTTCAGTGGCTGAAATGACCAAAGAGCAGGCATCCCAGCTTGGAGGAGCTGTCATGTCTGGAGCTGGGAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAAGAGGGCCAGGAAGCTTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACTAGAAGGGGAGAACTATGAAGAGGCCCCACAGGATGATTACCAGGAATATGAGCCTGAAGCATAACAACACAATATTCTGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAATAAAAAAAAATACAAATAAAGTTCCTTTTCCTAAGCCCCCCCCATTTCTTTTAAAAAGATGGATGAAGCCCACCTCCCTCTTCTCCTAAGAAAT
  5   1   2       bld Tbd1 5g                              AW871957.5p GCACGTAGGGAAGAAGCCAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGTCTGAGAGTGAAGCATCCCATGGCTCTGTAGCACTGACACTGCCTGCCGAGGGATCCCCTGTGAGCTCTGCATCTGAGCCCTCCTCTACCTCATCTCCACACTGAGGAAGAAGAGAGGCAGAATCTCCTCTGAAGCCCAGGCAGCTTATTTTGCACAGGACACTGTTGCTGCACAAAGAGAGGTGTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTTTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGTGTAGCAGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATACATGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGACTTCAGTGGCTGAAATGACCAAAGAGCAAGCA
  5   1   2       bld Eye1 5g                         IMAGE:6945398.5p CACGTAGGGGAAGAAGCCAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGTCTGAGAGTGAAGCATCCCATGGCTCTGTAGCACTGACACTGCCTGCCGAGGGATCCCCTGTGAGCTCTGCATCTGAGCCCTCCTCTACCTCATCTCCACACTGAGGAAGAAGAGAGGCAGAATCTCCTCTGAAGCCCAGGCAGCTTATTTTGCACAGGACACTGTTGCTGCACAAAGAGAGGTGTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTTTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGTGTAGCAGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATACATGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGACTTCAGTGGCTGAAATGACCAAAGAGCAGGCATCCCAGCTTGGAGGAGCTGTCATGTCTGGAGCTGGGAACATTGCTGCAGCTACTGGACTGGTGAAAAAGGATGAGTTCCCTACCAGACATCAAGGCCTGAAGAAGAGGGCCCAGGAAGCTTTTGGAAGAACCTTGCACCTGAGCCCTCTCCTGGAAACTAGAAAGGGGAGAAAACTATGAAAGAAGGCCCCCACCGGGAAGGATTTACCCCAGGAAATTATGAGCCCTGGAAGCCATTACCAACCCCAATTTTTCTTGGGGGGCCCCTTCCACCCCGGCAAACCTTCTCGGCACCAAAAGAATAAGGCTATTAAATGGCAATCTaaaaaaaaaaTTCCGCAATTAAAGGTTTCCCTTTTTTCCCTAAAGcccccccccccatttttcttttttaaacaaagatgggaatggaaagccccaaacctttcccttctttttctcccttaaaaaagttggccttttcttccccttttaaaattaacccccTGGCAGAAAGAAACCCTCCTTGGTTC
  5   1   2      seed Eye1 5g3  in                    IMAGE:6947866.5p                     GAATTCCCGGGATCAGAAAAGGAGGCGGGTGTAGGGTCTGAGAGTGAAGCATCCCATGGCTCTGTAGCACTGACACTGCCTGCCGAGGGATCCCCTGTGAGCTCTGCATCTGAGCCCTCCTCTACCTCATCTCCACACTGAGGAAGAAGAGAGGCAGAATCTCCTCTGAAGCCCAGGCAGCTTATTTTGCACAGGACACTGTTGCTGCACAAAGAGAGGTGTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTTTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGTGTAGCAGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATACATGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGACTTCAGTGGCTGAAATGACCAAAGAGCAGGCATCCCAGCTTGGAGGAGCTGTCATGTCTGGAGCTGGGAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAAGAGGGCCAGGAAGCTTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACTAGAAGGGGAGAACTATGAAGAGGCCCCACAGGATGATTACCAGGAATATGAGCCTGAAGCATAACAACACAATATTCTGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAATaaaaaaaaaatacaaataaagttccttttcctaagccccccccATTTCTTTTAAAAAGATGGGATGAAGCCCCACCTCCCCTTTTCTCCCTAAGAAAGTGGACTTCCCCCCTTTCAATTTCAACCTGGCAGAAGAAACCCTCCATGGTGGAAAGGGGATC
  5   1   2       bld Brn1 5g3  in                    IMAGE:6956429.5p                                                                                                                    TGTGAGCTCTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACTGAGGAAGAAGAGAGGCAGAATCTCCTCTGAAGCCCAGGCAGCTTATTTTGCACAGGACACTGTTGCTGCACAAAGAGAGGTGTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTTTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGTGTAGCAGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATACATGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGACTTCAGTGGCTGAAATGACCAAAGAGCAGGCATCCCAGCTTGGAGGAGCTGTCATGTCTGGAGCTGGGAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAAGAGGGCCAGGAAGCTTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACTAGAAGGGGAGAACTATGAAGAGGCCCCACAGGATGATTACCAGGAATATGAGCCTGAAGCATAACAACACAATATTCTGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAATaaaaaaaaatacaaataaagttccttttcctaagccccccccATTTCTNTTTAAAAGATGGATGAAGCCCACCTCCCTCTTCTCCTAAGAAATGACTTCTCCCCTTCAATTCACCCTGCAGAAGAACCTCATGTGAAAGTGATTTTTATGTATGGGTAACCCCCTTAAGCGTTGGAAGTCATAAGTCCAAGGcaaaaaaatgggattgttttaaaaacccaagggaaaaaaaaaGGGAATCCCCCTTTGAATTAATTGGTACCGGGAAAAACCCATTGGAAAT
  5   1   2       bld Ga15 5g3  in                       XL489h21ex.5p                                                                                                                                                              CTGAGGAAGAAGAGAGGCAGAATCTCCTCTGAAGCCCAGGCAGCTTATTTTGCACAGGACACTGTTGCTGCACAAAGAGAGGTGTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTTTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGTGTAGCAGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATACATGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGACTTCAGTGGCTGAAATGACCAAAGAGCAGGCATCCCAGCTTGGAGGAGCTGTCATGTCTGGAGCTGGGAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAAGAGGGCCAGGAAGCTTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACTAGAAGGGGAGAACTATGAAGAGGCCCCACAGGATGATTACCAGGAATATGAGCCTGAAGCATAACAACACAATATTCTGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAATaaaaaaaaatacaaataaagttccttttcctaagccccccccATTTCTTTTAAAAAGATGGATGAAGCCCACCTCCCTCTTCTCCTAAGAAGTGACTTCTCCCTTCAATTCACCTGCA
  5   1   2       bld Brn2                             Brn2-za40b12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               AAACGTCCTTTCTCTTTGGAGAGGCAAGGGTTCGGGGAGCTGTCATGTCTGGAGCTGGGAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAAGAGGGCCAGGAAGCTTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACTAGAAGGGGAGAACTATGAAGAGGCCCCACAGGATGATTACCAGGAATATGAGCCTGAAGCATAACAACACAATATTCTGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAATaaaaaaaaatacaaataaagttccttttcctaagccccccccATTTCTTTTAAAAAGATG
  5   1   2       e50                            Xl3.1-IMAGE:6947866.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACAAATAAAGTTCCTTTTCCTAAGCCCCCCCCATTTCTTTTAAAAAGATGGATGAAGCCCACCTCCCTCTTCTCCTAAGAAGTGACTTCTCCCTTCAATTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTACGGAAACCATGAATGCATTGTTACTGTTTTTTGCAGTCCTTTTTGCCCCCGAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGTGAATTTTGTGTCCTATATTTATTTTGTAACTTGTTTATTGTTTTTTTCTCTTTTGCTCTGACGTAATAGCTGATTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATGCTACAGGGTGTCTACCTTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTTGCTGTTGTTTTTTTATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGATTGTTCTGTAAAGCAGAGAGAAATATGTGTGAATCCATACAGAATCTTTTGAATGTTCT
                                                  Xl3.1-CHK-1012697948                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAAGTTCCTTTTCCTAAGCCCCCCCCATTTCTTTTAAAAAGATGGATGAAGCCCACCTCCCTCTTCTCCTAAGAAGTGACTTCTCCCTTCAATTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTACGGAAACCATGAATGCATTGTTACTGTTTTTTGCAGTCCTTTTTGCCCCCGAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGTGAATTTTGTGTCCTATATTTATTTTGTAACTTGTTTATTGTTTTTTTCTCTTTTGCTCTGACGTAATAGCTGATTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATGCTACAGGGTGTCTACCTTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTTGCTGTTGTTTTTTTATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGATTGTTCTGTAAAGCAGAGAGAAATATGTGTGAATCCATACAGAATCTTTTGAATGTTCTTGTGTT
  5   1   2       bld Ga12      in                         XL216j05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGAAGTGGCCATGGAAGTGTCCATGTAACCATCTAATGTCTGACCATAACCTGCAAAATGTTGCCATTGAAGGATCCGCACCCAACCAGTACCCACGTCTCCTCCCACTCCTGAAGAAGAGGGCCAGGAAGCTTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACTAGAAGGGGAGAACTATGAAGAGGCCCCACAGGATGATTACCAGGAATATGAGCCTGAAGCATAACAACACAATATTCTGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAATaaaaaaaaaatacaaataaagttccttttcctaagccccccccATTTCTTTTAAAAAGATGGATGAAGCCCACCTCCCTCTTCTCCTAANAAGTGACTTCTCCCTTCAATTCACCTGCANAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCaaaaatggatgtttaaaacaaagaaaaaaaaGAATCCCTTGATAATGTACGGAAACCATGAATGCATTGTTACTGTTTTTTGCAGTCCTTTTTGCCCCCGAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGNGAATTTTGNGTCCTATATTTATTTTG
  3   1   2       bld Eye1 5g3  in                    IMAGE:6947866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAACAAACACCAATTTTTTTTGGGCCCCCTTCCCCCCAGCAAACATTCAGGCACAAAGGATAGCTTTTAATGAATTAAAAAAAAAATTCCAAATTAAGGTTCCTTTTTCTTAAGGCCCCCCCCCATTTCTTTAAAAAAAGATGGATGAAGCCCCACTTCCCTTCTTCTCTTAAGAAGTGACTTCCCCCCTTCAATTCACTTGCAGAGAACNTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTACGGAAACCATGAATGCATTGTTACTGTTTTTTGCAGTCCTTTTCGCCCCCGAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGTGAATTTTGTGTCCTATATTTATTTTGTAACTTGTTTATTGTTTTTTTCTCTTTTGCTCTGACGTAATAGCTGATTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATGCTACAGGGTGTCTACCTTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTTGCTGTTGTTTTTTTATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGATTGTTCTGTAAAGCAGAGAGAAATATGTGTGAATCCATACAGAATCTTTTGAATTTC
  3   1   2       bld Brn1 5g3  in                    IMAGE:6956429.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACACAATATTCTGGGGCCCCTCCCACCAGCACATTCAGCACAAAGATAGCTATAATGAATAAAAAAAAATACAAATAAAGTTCCTTTTCCTAAGCCCCCCCCATTTCTTTTAAAAAGATGGATGAAGCCCACCTCCCTCTTCTCNTAAGAAGTGACTTCTCCTTTCAATTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTACGGAAACCATGAATGCATTGTTACTGTTTTTTGCAGTCCTTTTTGCCCCCGAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGTGAATTTTGTGTCCTATATTTATTTTGTAACTTGTTTATTGTTTTTTTCTCTTTTGCTCTGACGTAATAGCTGATTCTGTGCCAGGGGGGCCTGCAACTCCTTGCAACCGACCCAGCTAATGCTACAGGGTGTCTACCTTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTTGCTGTTGTTTTTTTATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGATTGTTCTGTAAAGCAGAGAGAAATATGTGTGAATCCATACAGAATCTTTTGAATGTTCTGGTGTTCCAAAGGAAA
  3   1   2       bld Brn1                            IMAGE:6950154.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTCCACCCAGCAAACATTCAGCACAAAAGATAGCCTATAATGGATTAAAAAAAAAAATTCAAATTAAAGTTCTTTTTCCTAAGCCCCCCCCCCATTTTTTTTAAAAAGATGGATGAAGCCCACCTCCCTCTTTCTCCTAAGAAGTGACTTCTCCTTCAATTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTACGGAAACCATGAATGCATTGTTACTGTTTTTTGCAGTCCTTTTTGCCCCCGAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGTGAATTTTGTGTCCTATATTTATTTTGTAACTTGTTTATTGTTTTTTTCTCTTTTGCTCTGACGTAATAGCTGATTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATGCTACAGGGTGTCTACCTTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTTGCTGTTGTTTTTTTATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGATTGTTCTGTCAAGCAGAGAGAACTATGTGGAATCCACACAGACTCCTCTGCATGTCAGAACAACCACAAACCCGCTGACCCAGATCAACATTTCGA
  3   1   2       bld Ga15 5g3  in                       XL489h21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTAAGAAGGGGACTTCTCCCTTCAATTCACCTGCAGAGAACCTCATGTGAAGNGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTACGGAAACCATGAATGCATTGTTACTGTTTTTTGCAGTCCTTTTTGCCCCCGAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGTGAATTTTGTGTCCTATATTTATTTTGTAACTTGTTTATTGTTTTTTTCTCTTTTGCTCTGACGTAATAGCTGATTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATGCTACAGGGTGTCTACCTTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTTGCTGTTGTTTTTTTATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGATTGTTCTGTAAAGCAGAGAGAAATATGTGNGAATCCATACAGAATCTTTTGNATGTTCT
  3   1   2      seed Ga12      in                         XL216j05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTACGGAAACCATGAATGCATTGTTACTGTTTTTTGCAGTCCTTTTTGCCCCCGAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGTGAATTTTGTGTCCTATATTTATTTTGTAACTTGTTTATTGTTTTTTTCTCTTTTGCTCTGACGTAATAGCTGATTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATGCTACAGGGTGTCTACCTTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTTGCTGTTGTTTTTTTATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGATTGTTCTGTAAAGCAGAGAGAAATATGTGTGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAA
  3   1   2       bld Ga12                                 XL155p07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTTTCCCTCCCAGAGAATAATTGTCGGGGGTTCAGTGAATTTTGTGTCCTATATTTATTTTGTAACTTGTTTATTGTTTTTTTCTCTTTTGCTCTGANGTAATAGCTGATTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGNTAATGCTACAGGGTGTCTACCTTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTnGCTGTTGTTTTTTTATACATATCTA
  3   1   2       bld Tbd1                                 AW782670.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAACCTTTTCTCTTTAACTACTCATTTGCCAAGAATTTGCACGAGGCGGCATCTTTTGGGCATTTGTGGAGTTAAAACCAAAAAAAATGTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGACAGTTCTCTCTCTTTTTTTGCTGTTGTTTTTTTATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGATTGTTCTGTAAAGCAGAGAGAAATATGTGTGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAATAGGATTAACCAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)