Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:8824064.5                       6 END     1           4       16                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL492a02ex.5                          8 PI      90       1156     1663                hypothetical protein LOC100036859 [Xenopus laevis]
     3   0.0    0Xl3.1-XL063p24.5                            6 PI      89          2      875                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:5505902.5                       5 PI      97       2011     2316                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012838779 Xl3.1-IMAGE:8464574.3.5 - 22 ESTs
                                                                       -180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8464574.3.5                                                                                                                                                                                     CTTGATGCTTGATAATTGGAAGAAAGGCGACAATGCATTTGAAAAGCACAAAAAATTATACCCCAGCTGTAGTTTTATTCAGAATGTGCCGCCGGTAAATCTCGGTGCATCTTTGCATTCTGCCTTCTCACCACCTGCCTCCAATAGTACTCCCATGTCCTCTGCTGCTTCTGAGAATGACAAAGTTGAGGCGATCAGTATGAAATATTGTAGTATTCCCCAAAATCCAGTCACATTCAGAGGCATCGAGGATCTGTCACACATCCGGACTAGTGAATACATGTATACAGAAGAAGCCAGGCTTAACAGTTTCAAAGAGTGGACAAATGCGTTTCTTACTCCTCCTGAACTTGCAAAAGCTGGTTTTTACTTTGTCGGGCCTGGAGATAAAGTCGCCTGCTTTACCTGCGATGGTAAATTGAGCAACTGGGAACCAAATGACAATGCCATGTCCGAGCACCGTCGACATTTTCCAGATTGTCCCTTTGTGAAGACCTCTACTAGGGTTTCCTCAAGGTTCAGTGTTTCAAATGTCAGCATGCAGGCCTCCTCGGCTCGACTCAAAACCTTTGTCAGTTGGCCGCCTAGGATTCCTGTGAGTCCAACACAACTTGCAGAAGCCGGATTCTACTATGTTGGCAGAAATGACGATGTTAAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCACATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATTTAATAGAAGATTAGTGAAACGAACCATTCAGAGTAAAATTTTGACATCCGGAGAAAATTATATTCAGCTTGATGATTTAATAAGTGATCTTCTAAGTGCACAAGAAGAACAGACTGAGGAAGAGCGAAACAGACAGGCAGAAGAAAACTCAATGGATGATATCTCTGTAATTCGTAAGAGCAGAATGGCTTTGTCACAGCACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAAAAATTGTCTACAGAAGCACGATCCAAACCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCCTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCACCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTGATATATATATATAGATATATAGATATATAATACTGAGACGTAATGCACTATAATAAAACAATGTGTTTGAATATTTCCTACATAGCTCTTATATCTGCTGAATTACAGTCTGTGCTTGCATAATTATATGATATCTCTCTGTAGAGTGTATGGGGAAAACATGAGAGCTGTCCCTGCTATGCAGAGTTTCATCATGGCCAATTTGACTAGTCATGAGTCCATTCTATATCAGGCCATGCCCAAATGGGTGAATAGTTCTGGCCTCTTGCTAAGGGACTATAACACATTAGGAGCTTTACACTACTGTCTGAGGGATAATTGATGTTTTACGAGGGAGACAGAACCAGCAAAAAGGTGCATGACAGACCTGCAACCCCACACTTTCTGACGTGAGAATAGACTTTAACTTCTTGGGAGGATGGGGTTGAAACACTCGGGCAAAACGTTAACATTTGATTTTAATTGGGAACTTCAGCATCAGTAGTTGCTTTTATATCCAGCTTCTGTCATATGGATGATTCTTCTCTGCTGTGCCCGTCCCTCTTTTTTTGGCTTTCCTTCAAACTAGGGATGCACCATATCAGTGTTTTTCAGTTTCATTTGGTCAAAATCTGAATTCTCTAGGAAAGA
                                                  Xl3.1-CHK-1012722542                                                                                                                                                                                           GCTTGATAATTGGAAGAAAGGCGACAATGCATTTGAAAAGCACAAAAAATTATACCCCAGCTGTAGTTTTATTCAGAATGTGCCGCCGGTAAATCTCGGTGCATCTTTGCATTCTGCCTTCTCACCACCTGCCTCCAATAGTACTCCCATGTCCTCTGCTGCTTCTGAGAATGACAAAGTTGAGGCGATCAGTATGAAATATTGTAGTATTCCCCAAAATCCAGTCACATTCAGAGGCATCGAGGATCTGTCACACATCCGGACTAGTGAATACATGTATACAGAAGAAGCCAGGCTTAACAGTTTCAAAGAGTGGACAAATGCGTTTCTTACTCCTCCTGAACTTGCAAAAGCTGGTTTTTACTTTGTCGGGCCTGGAGATAAAGTCGCCTGCTTTACCTGCGATGGTAAATTGAGCAACTGGGAACCAAATGACAATGCCATGTCCGAGCACCGTCGACATTTTCCAGATTGTCCCTTTGTGAAGACCTCTACTAGGGTTTCCTCAAGGTTCAGTGTTTCAAATGTCAGCATGCAGGCCTCCTCGGCTCGACTCAAAACCTTTGTCAGTTGGCCGCCTAGGATTCCTGTGAGTCCAACACAACTTGCAGAAGCCGGATTCTACTATGTTGGCAGAAATGACGATGTTAAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCACATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATTTAATAGAAGATTAGTGAAACGAACCATTCAGAGTAAAATTTTGACATCCGGAGAAAATTATATTCAGCTTGATGATTTAATAAGTGATCTTCTAAGTGCACAAGAAGAACAGACTGAGGAAGAGCGAAACAGACAGGCAGAAGAAAACTCAATGGATGATATCTCTGTAATTCGTAAGAGCAGAATGGCTTTGTCACAGCACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAAAAATTGTCTACAGAAGCACGATCCAAACCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCCTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCACCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTGATATATATATATAGATATATAGATATATAATACTGAGACGTAATGCACTATAATAAAACAATGTGTTTGAATATTTCCTACATAGCTCTTATATCTGCTGAATTACAGTCTGTGCTTGCATAATTATATGATATCTCTCTGTAGAGTGTATGGGGAAAACATGAGAGCTGTCCCTGCTATGCAGAGTTTCATCATGGCCAATTTGACTAGTCATGAGTCCATTCTATATCAGGCCATGCCCAAATGGGTGAATAGTTCTGGCCTCTTGCTAAGGGACTATAACACATTAGGAGCTTTACACTACTGTCTGAGGGATAATTGATGTTTTACGAGGGAGACAGAACCAGCAAAAAGGTGCATGACAGACCTGCAACCCCACACTTTCTGACGTGAGAATAGACTTTAACTTCTTGGGAGGATGGGGTTGAAACACTCGGGCAAAACGTTAACATTTGATTTTAATTGGGAACTTCAGCATCAGTAGTTGCTTTTATATCCAGCTTCTGTCATATGGATGATTCTTCTCTGCTGTGCCCGTCCCTCTTTTTTTGGCTTTCCTTCAAACTAGGGATGCACCATATCAGTGTTTTTCAGTTTCATTTGGTCAAAATCTGAATTCTCTAGGAAAGAAGCTTA
                                                      consensus depths                                                                                                                                                                                          2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     6     5     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     6     8     6     8     5     8     6     9     6     9     6     9     6     9     5     9     5     9     5     8     5     8     5     8     5     9     5    10     5    10     5    10     6    10     5    10     4    10     4    10     3    10     3    10     3     9     3     8     3     8     3     8     3     7     4     7     5     7     4     7     4     7     5     7     5     7     5     8     7     9     7     9     8    10     8    10     7    10     8    10     8    10     8    11     8    11     9    10     8    10     8    10     8    10    10    11    10    11     9    12    10    12    11    12     9    11    10    11     9    11    10    10    10    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8    10     9    10     9    10     9    10     8     9     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     4     8     4     8     3     7     3     4     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     3     4     3     4     3     4     3     4     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
  5   1   2       e>1                            Xl3.1-IMAGE:8464574.5                                                                                                                                                                                     CTTGATGCTTGATAATTGGAAGAAAGGCGACAATGCATTTGAAAAGCACAAAAAATTATACCCCAGCTGTAGTTTTATTCAGAATGTGCCGCCGGTAAATCTCGGTGCATCTTTGCATTCTGCCTTCTCACCACCTGCCTCCAATAGTACTCCCATGTCCTCTGCTGCTTCTGAGAATGACAAAGTTGAGGCGATCAGTATGAAATATTGTAGTATTCCCCAAAATCCAGTCACATTCAGAGGCATCGAGGATCTGTCACACATCCGGACTAGTGAATACATGTATACAGAAGAAGCCAGGCTTAACAGTTTCAAAGAGTGGACAAATGCGTTTCTTACTCCTCCTGAACTTGCAAAAGCTGGTTTTTACTTTGTCGGGCCTGGAGATAAAGTCGCCTGCTTTACCTGCGATGGTAAATTGAGCAACTGGGAACCAAATGACAATGCCATGTCCGAGCACCGTCGACATTTTCCAGATTGTCCCTTTGTGAAGACCTCTACTAGGGTTTCCTCAAGGTTCAGTGTTTCAAATGTCAGCATGCAGGCCTCCTCGGCTCGACTCAAAACCTTTGTCAGTTGGCCGCCTAGGATTCCTGTGAGTCCAACACAACTTGCAGAAGCCGGATTCTACTATGTTGGCAGAAATGACGATGTTAAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCACATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATT
  5   1   2       e>1                            Xl3.1-IMAGE:8464574.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCGCATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATTTAATAGAAGATTAGTGAAACGAACCATTCAGAGTAAAATTTTGACATCCGGAGAAAATTATATTCAGCTTGATGATTTAATAAGTGATCTTCTAAGTGCACAAGAAGAACAGACTGAGGAAGAGCGAAACAGACAGGCAGAAGAAAACTCAATGGATGATATCTCTGTAATTCGTAAGAGCAGAATGGCTTTGTCACAGCACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAAAAATTGTCTACAGAAGCACGATCCAAACCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCCTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCACCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTGATATATATATATAGATATATAGATATATAATACTGAGACGTAATGCACTATAATAAAACAATGTGTTTGAATATTTCCTACATAGCTCTTATATCTGCTGAATTACAGTCTGTGCTTGCATAATTATATGATATCTCTCTGTAGAGTGTATGGGGAAAACATGAGAGCTGTCCCTGCTATGCAGAGTTTCATCATGGCCAATTTGACTAGTCATGAGTCCATTCTATATCAGGCCATGCCCAAATGGGTGAATAGTTCTGGCCTCTTGCTAAGGGACTATAACACATTAGGAGCTTTACACTACTGTCTGAGGGATAATTGATGTTTTACGAGGGAGACAGAACCAGCAAAAAGGTGCATGACAGACCTGCAACCCCACACTTTCTGACGTGAGAATAGACTTTAACTTCTTGGGAGGATGGGGTTGAAACACTCGGGCAAAACGTTAACATTTGATTTTAATTGGGAACTTCAGCATCAGTAGTTGCTTTTATATCCAGCTTCTGTCATATGGATGATTCTTCTCTGCTGTGCCCGTCCCTCTTTTTTTGGCTTTCCTTCAAACTAGGGATGCACCATATCAGTGTTTTTCAGTTTCATTTGGTCAAAATCTGAATTCTCTAGGAAAGAAGCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATATAATACTGAGACATAATGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---G-------G
  5   1   2       e>1                            Xl3.1-IMAGE:8464574.5                                                                                                                                                                                     CTTGATGCTTGATAATTGGAAGAAAGGCGACAATGCATTTGAAAAGCACAAAAAATTATACCCCAGCTGTAGTTTTATTCAGAATGTGCCGCCGGTAAATCTCGGTGCATCTTTGCATTCTGCCTTCTCACCACCTGCCTCCAATAGTACTCCCATGTCCTCTGCTGCTTCTGAGAATGACAAAGTTGAGGCGATCAGTATGAAATATTGTAGTATTCCCCAAAATCCAGTCACATTCAGAGGCATCGAGGATCTGTCACACATCCGGACTAGTGAATACATGTATACAGAAGAAGCCAGGCTTAACAGTTTCAAAGAGTGGACAAATGCGTTTCTTACTCCTCCTGAACTTGCAAAAGCTGGTTTTTACTTTGTCGGGCCTGGAGATAAAGTCGCCTGCTTTACCTGCGATGGTAAATTGAGCAACTGGGAACCAAATGACAATGCCATGTCCGAGCACCGTCGACATTTTCCAGATTGTCCCTTTGTGAAGACCTCTACTAGGGTTTCCTCAAGGTTCAGTGTTTCAAATGTCAGCATGCAGGCCTCCTCGGCTCGACTCAAAACCTTTGTCAGTTGGCCGCCTAGGATTCCTGTGAGTCCAACACAACTTGCAGAAGCCGGATTCTACTATGTTGGCAGAAATGACGATGTTAAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCACATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATT
                                                  Xl3.1-CHK-1012702632                                                                                                                                                                                           GCTTGATAATTGGAAGAAAGGCGACAATGCATTTGAAAAGCACAAAAAATTATACCCCAGCTGTAGTTTTATTCAGAATGTGCCGCCGGTAAATCTCGGTGCATCTTTGCATTCTGCCTTCTCACCACCTGCCTCCAATAGTACTCCCATGTCCTCTGCTGCTTCTGAGAATGACAAAGTTGAGGCGATCAGTATGAAATATTGTAGTATTCCCCAAAATCCAGTCACATTCAGAGGCATCGAGGATCTGTCACACATCCGGACTAGTGAATACATGTATACAGAAGAAGCCAGGCTTAACAGTTTCAAAGAGTGGACAAATGCGTTTCTTACTCCTCCTGAACTTGCAAAAGCTGGTTTTTACTTTGTCGGGCCTGGAGATAAAGTCGCCTGCTTTACCTGCGATGGTAAATTGAGCAACTGGGAACCAAATGACAATGCCATGTCCGAGCACCGTCGACATTTTCCAGATTGTCCCTTTGTGAAGACCTCTACTAGGGTTTCCTCAAGGTTCAGTGTTTCAAATGTCAGCATGCAGGCCTCCTCGGCTCGACTCAAAACCTTTGTCAGTTGGCCGCCTAGGATTCCTGTGAGTCCAACACAACTTGCAGAAGCCGGATTCTACTATGTTGGCAGAAATGACGATGTTAAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCACATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATTTAATAG
  5   1   2       add Spl                             IMAGE:8461962.5p ATNNNNNCCATTCACTANGGAAGAACATAAATAAAAANCGTCCCACTTCTCATGTGAACTCTATCGGCTCTCCACATTTTGTACCTTTCCGACCAACACACAGGTGTCTGAGCGGAACCTTGCCAAAGCTGGATTTTATTATACCGGTTCCGACGACAAGGTCAAGTGCTTTACCTGTGGCTTGATGCTTGATAATTGGAAGAAAGGCGACAATGCATTTGAAAAGCACAAAAAATTATACCCCAGCTGTAGTTTTATTCAGAATGTGCCGCCGGTAAATCTCGGTGCATCTTTGCATTCTGCCTTCTCACCACCTGCCTCCAATAGTACTCCCATGTCCTCTGCTGCTTCTGAGAATGACAAAGTTGAGGCGATCAGTATGAAATATTGTAGTATTCCCCAAAATCCAGTCACATTCAGAGGCATCGAGGATCTGTCACACATCCGGACTAGTGAATACATGTATACAGAAGAAGCCAGGCTTAACAGTTTCAAAGAGTGGACAAATGCATTTCTTACTCCTCCTGAACTTGCAAAAGCTGGTTTTTACTTTGTCGGGCCTGGAGATAAAGTCGCCTGCTTTACCTGCGATGGTAAATTGAGCAACTGGGAACCAAATGACAATGCCATGTCCGAGCACCGTCGACATTTTCCAGATTGTCCCTTTGTGAAGACCTCTACTAGGGTTTCCTCAAGGTTCAGTGTTTCAATGTCAGCATGCAAGCCTCCTCGGCTCGACTCAAAACTTTGTCAGTTGTCGCCTAGGATTCTGTGAGTCCAACCACTTGCAGAAGCGGATTTACTATGTGGCAGAATGAGATGTAA
  5   1   2       add Emb1                            IMAGE:6636771.5p                                                                                                                                                                                     CTTGATGCTTGATAATTGGAAGAAAGGCGACAATGCATTTGAAAAGCACAAAAAATTATACCCCAGCTGTAGTTTTATTCAGAATGTGCCGCCGGTAAATCTCGGTGCATCTTTGCATTCTGCCTTCTCACCACCTGCCTCCAATAGTACTCCCATGTCCTCTGCTGCTTCTGAGAATGACAAAGTTGAGGCGATCAGTATGAAATATTGTAGTATTCCCCAAAATCCAGTCACATTCAGAGGCATCGAGGATCTGTCACACATCCGGACTAGTGAATACATGTATACAGAAGAAGCCAGGCTTAACAGTTTCAAAGAGTGGACAAATGCGTTTCTTACTCCTCCTGAACTTGCAAAAGCTGGTTTTTACTTTGTCGGGCCTGGAGATAAAGTCGCCTGCTTTACCTGCGATGGTAAATTGAGCAACTGGGAACCAAATGACAATGCCATGTCCGAGCACCGTCGACATTTTCCAGATTGTCCCTTTGTGAAGACCTCTACTAGGGTTTCCTCAAGGGTTCAGTGTTTCAAATGTCAGCATGCAGGCCTCCTCGGCTCGACTCAAAACCTTTGTCAGTTGGCCGCCTAAGATTCCTGTGAGTCCAACACAACTTGCAGAAGCCGGATTCTACTATGTTGGCAGAAATGACGATGGTAAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGCCGGAGATGACCCGTGGGGTGAACATGCAAAATGGGTTCCCAGATGGGAGTATTTTGTTGAATGTAAGAGGCCAAAAATTTTGTTCGTGAAGGTTCAAAGAAAGAACTTCCGCAATCTTCTTGGAATCAGTTGCCTTTCCTTCTTCCAGAAAAACCCAAAATGAAACCGAAGGAAACCACCCCACTTATTTCCATTTGGGGAAACGGGAAAAAAAGACCCAGGAAGA
  5   1   2       bld Emb9                            IMAGE:7978123.5p                                                                                                                                                                                                                                                                                                     TTGCATTCTGCCTTCTCACCACCTGCCTCCAATAGTACTCCCATGTCCTCTGCTGCTTCTGAGAATGACAAAGTTGAGGCGATCAGTATGAAATATTGTAGTATTCCCCAAAATCCAGTCACATTCAGAGGCATCGAGGATCTGTCACACATCCGGACTAGTGAATACATGTATACAGAAGAAGCCAGGCTTAACAGTTTCAAAGAGTGGACAAATGCGTTTCTTACTCCTCCTGAACTTGCAAAAGCTGGTTTTTACTTTGTCGGGCCTGGAGATAAAGTCGCCTGCTTTACCTGCGATGGTAAATTGAGCAACTGGGAACCAAATGACAATGCCATGTCCGAGCACCGTCGACATTTTCCAGATTGTCCCTTTGTGAAGACCTCTACTAGGGTTTCCTCAAGGTTCAGTGTTTCAAATGTCAGCATGCAGGCCTCCTCGGCTCGACTCAAAACCTTTGTCAGTTGGCCGCCTAGGATTCCTGTGAGTCCAACACAACTTGCAGAAGCCGGATTCTACTATGTTGGCAGAAATGACGATGTTAAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGCCAGACTTTGTTCGTGAGTTCAGAAAGACATCGCATCTCTGATCAGTGCTTTCATCTTCAGAAACAAATGAGCAAGACACACCCATTATTCG
  5   1   2       bld Spl                             IMAGE:8462841.5p                                                                                                                                                                                                                                                                                                                                                                                                     TGTAGTATTCCCCAAAATCCAGTCACATTCAGAGGCATCGAGGATCTGTCACACATCCGGACTAGTGAATACATGTATACAGAAGAAGCCAGGCTTAACAGTTTCAAAGAGTGGACAAATGCGTTTCTTACTCCTCCTGAACTTGCAAAAGCTGGTTTTTACTTTGTCGGGCCTGGAGATAAAGTCGCCTGCTTTACCTGCGATGGTAAATTGAGCAACTGGGAACCAAATGACAATGCCATGTCCGAGCACCGTCGACATTTTCCAGATTGTCCCTTTGTGAAGACCTCTACTAGGGTTTCCTCAAGGTTCAGTGTTTCAAATGTCAGCATGCAGGCCTCCTCGGCTCGACTCAAAACCTTTGTCAGTTGGCCGCCTAGGATTCCTGTGAGTCCAACACAACTTGCAGAAGCCGGATTCTACTATGTTGGCAGAAATGACGATGTTAAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCGCATCTTCTTGATCAGTTGCTTTCATCTTCAGAAACCAAAATGAAGCAAAGACACACCCATTATTCGATTGGGACGGAGATAGCCAGAAAGATGAATATGATGAGCCTCCATGGTCAACTGCCTGAGATGGATTATAGAGATAGTGAACGACATCAAGTAAATTGACTCNGAGAATAATCACTGAGATATAGGACTCTATCCAGAGACGACGAGAACGACGACGCAGAA
  5   1   2      seed Spl       in                    IMAGE:8464574.5p                                                                                                                                                                                                                                                                                                                                                                                                                                TTCNGAGGCATCGAGGATCTGTCACACATCCGGACTAGTGAATACATGTATACAGAAGAAGCCAGGCTTAACAGTTTCAAAGAGTGGACAAATGCATTTCTTACTCCTCCTGAACTTGCAAAAGCTGGTTTTTACTTTGTCGGGCCTGGAGATAAAGTCGCCTGCTTTACCTGCGATGGTAAATTGAGCAACTGGGAACCAAATGACAATGCCATGTCCGAGCACCGTCGACATTTTCCAGATTGTCCCTTTGTGAAGACCTCTACTAGGGTTTCCTCAAGGTTCAGTGTTTCAAATGTCAGCATGCAGGCCTCCTCGGCTCGACTCAAAACCTTTGTCAGTTGGCCGCCTAGGATTCCTGTGAGTCCAACACAACTTGCAGAAGCCGGATTCTACTATGTTGGCAGAAATGACGATGTTAAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCACATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACCTCCATGGTTCAGACTGCCTTGGAGATGGGATTTAATATAAGTTAGTGAAACAAACATTTCGAGTAAATTTTGACTCCGGATAAATATAATCACTTGAA
  5   1   2       add Spl       in                    IMAGE:8464521.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GNCNGGCTTACAGTTTCAAGAGTGGACAAATGCATTTCTTACTCCTCCTGAACTTGCAAAAGCTGGTTTTTACTTTGTCGGGCCTGGAGATAAAGTCGCCTGCTTTACCTGCGATGGTAAATTGAGCAACTGGGAACCAAATGACAATGCCATGTCCGAGCACCGTCGACATTTTCCAGATTGTCCCTTTGTGAAGACCTCTACTAGGGTTTCCTCAAGGTTCAGTGTTTCAAATGTCAGCATGCAGGCCTCCTCGGCTCGACTCAAAACCTTTGTCAGTTGGCCGCCTAGGATTCCTGTGAGTCCAACACAACTTGCAGAAGCCGGATTCTACTATGTTGGCAGAAATGACGATGTTAAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCACATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATTTAATAGAAGATTAGTGAAACGAACCATTCAGAGTAAATTTTGACATCCGGAGAAAATATATTCAGCTTGATGATTTAATAGTGATCTTCTAGTGCACAGAAGACAGACTGAGAAA
  5   1   2       e>1                            Xl3.1-IMAGE:8464574.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCGCATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATTTAATAGAAGATTAGTGAAACGAACCATTCAGAGTAAAATTTTGACATCCGGAGAAAATTATATTCAGCTTGATGATTTAATAAGTGATCTTCTAAGTGCACAAGAAGAACAGACTGAGGAAGAGCGAAACAGACAGGCAGAAGAAAACTCAATGGATGATATCTCTGTAATTCGTAAGAGCAGAATGGCTTTGTCACAGCACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAAAAATTGTCTACAGAAGCACGATCCAAACCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCCTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCACCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTGATATATATATATAGATATATAGATATATAATACTGAGACGTAATGCACTATAATAAAACAATGTGTTTGAATATTTCCTACATAGCTCTTATATCTGCTGAATTACAGTCTGTGCTTGCATAATTATATGATATCTCTCTGTAGAGTGTATGGGGAAAACATGAGAGCTGTCCCTGCTATGCAGAGTTTCATCATGGCCAATTTGACTAGTCATGAGTCCATTCTATATCAGGCCATGCCCAAATGGGTGAATAGTTCTGGCCTCTTGCTAAGGGACTATAACACATTAGGAGCTTTACACTACTGTCTGAGGGATAATTGATGTTTTACGAGGGAGACAGAACCAGCAAAAAGGTGCATGACAGACCTGCAACCCCACACTTTCTGACGTGAGAATAGACTTTAACTTCTTGGGAGGATGGGGTTGAAACACTCGGGCAAAACGTTAACATTTGATTTTAATTGGGAACTTCAGCATCAGTAGTTGCTTTTATATCCAGCTTCTGTCATATGGATGATTCTTCTCTGCTGTGCCCGTCCCTCTTTTTTTGGCTTTCCTTCAAACTAGGGATGCACCATATCAGTGTTTTTCAGTTTCATTTGGTCAAAATCTGAATTCTCTAGGAAAGAAGCTT
                                                  Xl3.1-CHK-1012691036                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCGCATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATTTAATAGAAGATTAGTGAAACGAACCATTCAGAGTAAAATTTTGACATCCGGAGAAAATTATATTCAGCTTGATGATTTAATAAGTGATCTTCTAAGTGCACAAGAAGAACAGACTGAGGAAGAGCGAAACAGACAGGCAGAAGAAAACTCAATGGATGATATCTCTGTAATTCGTAAGAGCAGAATGGCTTTGTCACAGCACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAAAAATTGTCTACAGAAGCACGATCCAAACCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCCTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCACCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTGATATATATATATAGATATATAGATATATAATACTGAGACGTAATGCACTATAATAAAACAATGTGTTTGAATATTTCCTACATAGCTCTTATATCTGCTGAATTACAGTCTGTGCTTGCATAATTATATGATATCTCTCTGTAGAGTGTATGGGGAAAACATGAGAGCTGTCCCTGCTATGCAGAGTTTCATCATGGCCAATTTGACTAGTCATGAGTCCATTCTATATCAGGCCATGCCCAAATGGGTGAATAGTTCTGGCCTCTTGCTAAGGGACTATAACACATTAGGAGCTTTACACTACTGTCTGAGGGATAATTGATGTTTTACGAGGGAGACAGAACCAGCAAAAAGGTGCATGACAGACCTGCAACCCCACACTTTCTGACGTGAGAATAGACTTTAACTTCTTGGGAGGATGGGGTTGAAACACTCGGGCAAAACGTTAACATTTGATTTTAATTGGGAACTTCAGCATCAGTAGTTGCTTTTATATCCAGCTTCTGTCATATGGATGATTCTTCTCTGCTGTGCCCGTCCCTCTTTTTTTGGCTTTCCTTCAAACTAGGGATGCACCATATCAGTGTTTTTCAGTTTCATTTGGTCAAAATCTGAATTCTCTAGGAAAG
  5   1   2       add Te2N                            IMAGE:7768528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGGTTCAGTGTTTCAATGTCAGCATGCAGGCCTCCTCGGCTCGACTCAAAACCTTTGTCAGTTGGCCGCCTAGGATTCCTGTGAGTCCAACACAACTTGCAGAAGCCGGATTCTACTATGTTGGCAGAAATGACGATGTTAAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCGCATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATTTAATAGAAGATTAGTGAAACGAACCATTCAGAGTAAAATTTTGACATCCGGAGAAAATTATATTCAGCTTGATGATTTAATAAGTGATCTTCTAAGTGCACAAGAAGAACAGACTGAGGAAGAGCGAAACAGACAGGCAGAAGAAAACTCAATGGATGATATCTCTGTAATTCGTAAGAGCAGAATGGCTTTGTCAAACACATTGCTAGTCGAGCATTCCCTCCTGGATATCTGTTGTCTCCATGAATCACACTGCCGATATGAGACATAAAGTGAAACACAGCCATTTGCAGCTCAGAGAGACGAGACATATACTAA
  5   1   2       bld Int2                            IMAGE:8529820.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACGATGTTAATGCTTTTGCTGTGACGGAGGGCTTCGTTGCTGGGAGTCCGGAGATGACCCGTGGGTTGAACATGCAAAATGGTTTCCCAGATGTGAGTATTTGTTGAATGTAAGAGGCCAAGACTTTGTTCGTGAGGTTCAAGAAAGACATCCACATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAATCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATTTAATAGAAGATTAGTGAAACGAACTATTCAGAGTAAAATTTTGACATCCGGAGAAAATTATATTCAGCTTGATGATTTAATAAGTGATCTTCTAAGTGCACAAGAAGAACAGACTGAGGAAGAGCGAAACAGACAGGCAGAAGAAAACTCAATGGATGATATCTCTGTAATTCGTAAGAGCAGAATGGCTTTGTCACAGCACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAAAAATTGTCTACAGAAGCACGATCCAAATCTCTTCAGACAACTATTCACTGAACAGTCTCTGAA
  3   1   2       bld Ga18                              rxlk72p17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGACGATNNNNANTGNNTTTGCTNTGNCGNNGGGCTTCGTTGCTGGNAGTCCGNAGATGACCCNNGGGTTGAACATGCAAAATGNNTNCCAGATGTGAGTATTTGTTNNATGTAAGAGGCCAAGNCTTTNTTCGTGAGGTTCAAGAAAGACNNNCACNTCTTCTTGNNNAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTNNCTTGGAGATGGNTTTAATAGAAGATTAGTGAAACGNNCATTCAGAGTAAAATTTTGACATCCGGAGAAAATTATATTCAGCTTGATGATTTAATAAGTGATCTTCTAAGTGCACAAGAAGAACAGACTGAGGAAGAGCGAAACAGACAGGCAGAAGAAAACTCAATGGATGATATCTCTGTAATTCGTAAGAGCAGAATGGCTTTGTCACAGCACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAGAAATTGTCTACAGAAGCACGATCCAAACCTCTTCAGACAACTATTCAATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCCTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCACCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTGATATATATAGATATATAGATATATAATACTGAGANATAATNCACNAT
  5   1   2       bld Skin                            IMAGE:8642167.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGTTCGTGAGGTTCAAGAAAGACATCCGCATCTTCTTGATCAGTTGCTTTCATCTTCAGAAAACCAAAATGAAGCAAAGAACACACCCATTATTCGATTGGGAACGGAGAATAGCCAGGAAGATGAAATTATGATGAGCACTCCCATGGTTCAGACTGCCTTGGAGATGGGATTTAATAGAAGATTAGTGAAACGAACCATTCAGAGTAAAATTTTGACATCCGGAGAAAATTATATTCAGCTTGATGATTTAATAAGTGATCTTCTAAGTGCACAAGAAGAACAGACTGAGGAAGAGCGAAACAGACAGGCAGAAGAAAACTCAATGGATGATATCTCTGTAATTCGTAAGAGCAGAATGGCTTTGTCACAACACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAAAAATTGTCTACAGAAGCACGATCCAAATCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGCAGAACACTAAAGAGACTGCCTGAAGAAGAACCTGTAAAAATGTTTGGGTCCGAAGTCCCATGGTCTCAACCTGTGGCCAATAGAATCGGTAGATGCGCCTTTTCTCTGATGCCATCTCAAGGGGCTTTAGCCATTCGATCTTCTCGTTCTTCATTTTCAAA
  3   1   2       bld Spl       in                    IMAGE:8464574.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTGCATGTCTTCGAACAAGACAAACCCCTTTCGTGGACGGATGCAGAGTGATTAGAGGCATCCATGTCGCTGCTGAGATGGATTATAGAGATAGGAACGACCATCGAGTAAAATTGACATCGGAGAAATTATATCAGCTGATGATTAATAAGTGATCTCTAAGTGCACAGAAGAACAGACTGAGGAGAGCGAAACAGACAGGCAGAAGAAAACTCAATGGATGATATCTCTGTAATTCGTAAGAGCAGAATGGCTTTGTCACAGCACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAAAAATTGTCTACAGAAGCACGATCCAAACCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCCTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCACCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTGATATATATAGATATATAGATATATAATACTGAGACATAATGCACTTAATAAACAATGGTGT
  3   1   2       bld Spl       in                    IMAGE:8464521.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCATCGATGGTCTTGAACAGAGCAGACACATTTGTTGACGGATGCAGAGTGATTGTGGCATCATGTCGATGCTGAGATGATATAGAGATAGGAACGACCATCAAGTAAATTGCATCNGAGAAATATATCAGCTGAGATTAATAGTGTCTCTAGTGCACAGAAGACAGATGAGAAGAGCGAACAGACAGCAGAAGAAACTCAATGGATGAATCTCTGTAATCGTAAGAGCAGAATGGCTTTGTCACAGCACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAAAAATTGTCTACAGAAGCACGATCCAAACCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCCTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCACCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTGATATATATAGATATATAGATATATAATACTGAGACATAATGCACTATAATAAACAAGGT
  3   1   2       bld Spl                             IMAGE:8464895.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTATAATTATTAATATAAATATAATAGAAGAAAGGAATAAATTGTTAAGAAAAAGAACAGAAAGTAGAACTTAAAGTAAAAAGAAATAATAAATAGAAAGACATAGTAAAAGGTAAAACAGTAAAATTGTTAAGGGAATGAAGAATAAAATCTAGAACCATATAAAAGGATGAGAGAGAGAACAAAAGGAGAAGAAACTCAAGGGAGAATCATCTTATTTATAAGAGCAGATGGCTTGTCAAACACAATAGTAGTCGAAGCATACCCATCCGGGAATATCGGTGGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAAAAATTGTCTACAGAAGCACGATCCAAATCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTTTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCTTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCATCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTGATATATATATATAGATATATAGATATATAATACTGCGACGACAGCACTCTATAC
  5   1   2      seed Skin                            IMAGE:8640939.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCTTTGTCACAGCACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAGAAATTGTCTACAGAAGCACGATCCAAACCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCCTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCACCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTGatatatatagatatatagatatataataCTGAGACATAATGCACTATAATAAAACAATGTGTTTGAATATTTCaaaaaaaaaaaaaaaaaaaaaaaGG
  5   1   2       bld Gas5      in                    IMAGE:3748171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACATTGCTAGTCGAAGCATTCCCATCCTGGATTATCTGTTGTCTTCCAATGATATCACCACTGCCGAATATGAAGACATAAAAGTGAAAACACAGCCCATTTTGCAAGCTCAAGAGATGATCGAGACTATAATAACTAAAGGAAAAACAGCAGTTCAGACATTAAAAAATTGTCTACAGAAGCACGATCCAAACCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCCTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGGTCGGACGTTTCTTTCA
  3   1   2       add Gas5      in                    IMAGE:3748171.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTCTGGATTATCTGTTGTGTTCTAATGATATTATTATTGTTGAATATGAAGATATAAAAGTGAAAATATAGTTTATTTTGCAAGNTTAAGAGATGATTGAGACTATAATAAGTAAAGGAAAACTAGTAGTTTAGACATTAAAAAATTGTCTATAGAAGTATGATTTAAACTTCTTTAGATAAGTATTTACTGAACAGTCTTTGAAATGTATATCATTAGATGATTGTTTAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTNTGTAAGGATTGCGCCCCCTCTTTCCGGAAGTGCCCAATATGCAGAGGCATGATTAAAGGCACAGTTTGGACGTTTCTTT
  3  -1   2       add Neu7                                 XL032a10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGAAAACACAGCCCATTNTGCAAGCTCAAGAGATGATCGAGACTATNATAACTAANGGAAAAACAGCAGTTCANACATTAAAAAATTGTCTACAGAAGCACGATCCAAACCTATTNAGACAACTATTCACTGAACAGTCTNTGAAATGTATATCATTAGATGATNGTTCAGAT
  5   1   2       bld Ga12                                 XL178c19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATTAAAAAATTGTCTACAGAAGCACGATCCAAACCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTCTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCCTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCACCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTgatatatatatatagatatatagatatataataCTGAGACGTAATGCACTATAATAAAACAATGTGTTTGAATATTTCCTACATAGCTCTTATATCTGCTGAATTACAGTCTGTGCTTGCATAATTATATGATATCTCTCTGTAGAGTGTATGGGGAAAACATGAGAGCTGTCCCTGCTATGCAGAGTTTCATCATGGCCAATTTGACTAGTCATGAGTCCATTCTATATCAGGCCATGCCCAAATGGGTGAATAGTTC
  5   1   2       bld Egg3      in                    IMAGE:3377458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGTCCAAATCTCTTCAGACAACTATTCACTGAACAGTCTCTGAAATGTATATCATTAGATGATTGTTCAGATTTATCTATGGAAGAACAACTAAGGAGACTGCAGGAAGAAAGAACCTGTAAAATATGTATGGATCAGGAGGTTTCCATTGTTTTCATACCTTGTGGCCATTTGGTAGTCTGTAAGGATTGCGCCCCTTCTCTCCGGAAGTGCCCAATATGCAGAGGCACGATTAAAGGCACAGTTCGGACGTTTCTTTCATGAACTGGTACAGTGATCATTCAACACAAGCCATCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTgatatatatatatagatatatagatatataataCTGAGACGTAATGCACTATAATAAAACAATGTGTTTGAATATTTCCTACATAGCTCTTATATCTGCTGAATTACAGTCTGTGCTTGCATAATTATATGATATCTCTCTGTAGAGTGTATGGNGAAAACATGAGAGCTGTCCCTGCTATGCAGAGTTTCATCATGG
  5   1   2       bld Emb1                            IMAGE:5161721.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATCATTCAACACAAGCCATCCTGATTGCTTTAAGAGAATCCAGTTATGATGCAATTATTACTTTAACAAAAGAACTGatatatatatatagatatatagatatataataCTGAGACGTAATGCACTATAATAAAACAATGTGTTTGAATATTTCCTACATAGCTCTTATATCTGCTGAATTACAGTCTGTGCTTGCATAATTATATGATATCTCTCTGTAGAGTGTATGGGGAAAACATGAGAGCTGTCCCTGCTATGCAGAGTTTCATCATGGCCAATTTGACTAGTCATGAGTCCATTCTATATCAGGCCATGCCCAAATGGGTGAATAGTTCTGGCCTCTTGCTAAGGGACTATAACACATTAGGAGCTTTACACTACTGTCTGAGGGATAATTGATGTTTTACGAGGGAGACAGAACCAGCAAAAAGGTGCATGACAGACCTGCAACCCCACACTTTCTGACGTGAGAATAGACTTTAACTTCTTGGGAGGATGGGGTTGAAACACTCGGGCAAAACGTTAACATTTGATTTTAATTGGGAACTTCAGCATCAGTAGTTGCTTTTATATCCAGCTTCTGTCATATGGATGATTCTTCTCTGCTGTGCCCGTCCCTCTTTTTTTGGCTTTCCTTCAAACTAGGGATGCACCATATCAGTGTTTTTCAGTTTCATTTGGTCAAAATCTGAATTCTCTAGGAAAGAAGCTTAATTTTCATGTCAAAATTAGGCATGTaaaaaaaaaaaaaaaaGAGGCTAAGATTTGTCTAAATTCAGACTTCAGTTTGTCCCTACTTAAGGCAGAAACTGACTTACTACACTACCATTCCTGGATGTTTAnnnnnnaanannnnnnnC
  3   1   1       add DMZ       out                        xl282a02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAATTACNGTCTGTGCTTGCATAATTATATGATATCTCTCTTTAGAGTGTATGGGGAAAACNTGAGAGCTGTCCCTGCTATGCAGAGTTTCATCATGGCCAATTTGACTAGTCNTGAGTCCNTTCTATATCNGGCCNTGCCCAAATGGGNGAATAGTTNTGCCCTCTTGNTAAGGGACTAACNCNTTAGGAGCTTTACNCTACTGTNTGAGGGATAATTGATGTTTTAGGAGGGNGACAGAACCNGCAAAAAGGTGCNTGACNGACCTGCAACCCCNCACTTTNTGACGTGNGAATAGACTTTAACTTCTTGGGAGGATGGGGTTGAAACNCCCGGGCAAAACGTTAACNTTTGATTTTAATTGTGAACTTCAGCATCNGTAGTTGCTTTTATATCCAGCTTNTGTCATATGGATGATTNTTNTNTGCTGTGCCCGTCCCTCTTTTTTTTGGCTTTCCTTGAAACTAGGGATGCNCCATATCCGTGTTTTTCAGTTTCATTTGGCCAAAATNTGAATTCTCTAGGAAAGAATNTTAATTTTCATGTCAAAATTAGGCATGTAAAAAAAAAAGAGGCTAAGATTTGTCCAAATTCAGACTTCAGTTTGTCCCACTAAGGC
  3   1   2       bld Egg3      in                    IMAGE:3377458.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATTTGACTAGTCATGAGTCCATTCTATATCAGGCCATGCCCAAATGGGTGAATAGTTCTGGCCTCTTGCTAAGGGACTATAACACATTAGGAGCTTTACACTACTGTCTGAGGGATAATTGATGTTTTACGAGGGAGACAGAACCAGCAAAAAGGTGCATGACAGACCTGCAACCCCACACTTTCTGACGTGAGAATAGACTTTAACTTCTTGGGAGGATGGGGTTGAAACACTCGGGCAAAACGTTAACATTTGATTTTAATTGGGAACTTCAGCATCAGTAGTTGCTTTTATATCCAGCTTCTGTCATATGGATGATTCTTCTCTGCTGTGCCCGTCCCTCTTTTTTTGGCTTTCCTTCAAACTAGGGATGCACCATATCAGTGTTTTTCAGTTTCATTTGGTCAAAATCTGAATTCTCTAGGAAAGAAGCTTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)