Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8322197.5                       4 PI      88       1124     1792                Notch protein [Xenopus laevis]
     2   0.0    0Xl3.1-IMAGE:3749724.5                       2 PI      99       1974     2124                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012838851 Xl3.1-xlk112k21ex.3.5 - 16 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-xlk112k21ex.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGTTTGATGGCACTACCCCTCTGATCCTAGCCGCTCGGCTGGCCGTGGAAGGGATGGTGGAGGAGCTTATCAATGCTCATGCAGATGTCAACGCTGTTGATGAATTTGGAAAATCTGCTTTGCATTGGGCAGCGGCTGTGAATAACGTTGATGCTGCAGCTGTGCTTCTCAAGAATAGTGCAAATAAGGACATGCAAAACAACAAGGAAGAGACATCCCTGTTCTTGGCCGCAAGAGAAGGCAGCTACGAAACTGCCAAAGTCCTTTTGGATCACTACGCCAACCGTGACATCACAGACCACATGGATCGGCTGCCTCGTGACATCGCCCAAGAACGCATGCACCACGACATTGTTCACCTGCTGGATGAATATAACCTTGTGAAGAGCCCAACGCTGCACAATGGTCCGTTGGGAGCAACGACATTATCACCTCCCATCTGCTCCCCTAATGGTTACATGGGGAACATGAAGCCTTCTGTTCAGAGCAAGAAAGCCCGCAAGCCCAGTATCAAAGGTAATGGCTGCAAAGAGGCCAAGAGCTGAAAGCCAGAAGGAAAAAATCTCAAGATGGGAAAACAACTCTCTTGGATTCTGGCAGTTCTGGAGTGTTGTCCCCAGTGGACTCCCTGGAGTCAACACATGGATACTTATCAGATGTGTCTTCTCCTCCGCTGATGACCTCTCCGTTTCAGCAGTCTCCATCCATGCCTCTGAACCACTTGACAAGCATGCCAGAGTCCCACCTTGGCATGAATCACATAAACATGGCCACCAAGCAGGAAATGGCAGCAGGTTCCAACAGAATGGCTTTTGATGCCATGGTGCCACGTCTGACCCATCTCAATGCCTCAAGCCCTAATACCATCATGAGCAATGGATCCATGCATTTCACTGTGGGAGGAGCTCCGACTATGAACAGCCAATGTGACTGGTTAGCTAGGCTGCAGAATGGGATGGTCCAGAATCAGTATGACCCAATCAGAAATGGCATCCAACAAGGCAATGCTCAACAAGCTCAAGCTCTTCAGCATGGCCTTATGACCTCGCTCCATAATGGTCTGCCAGCAACAACTCTCTCCCAAATGATGACCTATCAGGCCATGCCCAACACAAGGCTAGCCAATCAGCCACATCTAATGCAAGCCCAGCAAATGCAACAGCAGCAAAACTTGCAGTTGCACCAGAGCATGCAGCAACAACATCACAATTCCAGCACGACCTCTACTCACATCAACTCACCATTCTGCAGCAGTGACATAAGCCAGACGGACCTGCAGCAAATGTCAAGCAACAACATTCATTCAGTAATGCCCCAGGACACTCAGATATTTGCCGCATCTCTGCCTTCCAATCTTACGCAGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCAATGGACAATACACCAAGCCATCAACTACAAGTACCAGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCCAATATGTCTGACTGGTCAGAAGGAATATCAAGTCCTCCCACGAGTATGCAGCCTCAGCGCACCCACATACCTGAAGCTTTCAAGTAAAAAAAAAAAAGTTTAAAAAAATGTAAAATATTTTTAAAGACACTGAGAGAGACTTTAAGAGACTGAAGGAAATTTTTATATGGTTTTTATACTTAAAATAACAGAACATTTGAATTTTCTAGTATTTATTTATATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTCATTTTTAGGACAAAATATTTTAACTTCTTGCCTTGAAAGTTTTTCAGTTCTAAATCTTATGAAATTGGTTCCTGCCTGGTATTGAAAACGGCAATGTATTTATTTTTTATTTACCTGAATAGTATACAGGAACAAACCACTGGGGTGGGGGGGTTATCGGGATGTGTATTTAGCAGAAAAAAGATTTTCTATAAAATGAAATCTTTCAGGTTTTCATTTATAGCACTAAAAAGATTCCAGTATTAATTTTAAATTAAATCATGAAGAAGATGCTCCGAATACCTCTCGCTGTCAGGGAGGTGCCCAATAGGTTTTTTTTTTTTGTTTTTTT
                                                  Xl3.1-CHK-1012721651                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATGGCACTACCCCTCTGATCCTAGCCGCTCGGCTGGCCGTGGAAGGGATGGTGGAGGAGCTTATCAATGCTCATGCAGATGTCAACGCTGTTGATGAATTTGGAAAATCTGCTTTGCATTGGGCAGCGGCTGTGAATAACGTTGATGCTGCAGCTGTGCTTCTCAAGAATAGTGCAAATAAGGACATGCAAAACAACAAGGAAGAGACATCCCTGTTCTTGGCCGCAAGAGAAGGCAGCTACGAAACTGCCAAAGTCCTTTTGGATCACTACGCCAACCGTGACATCACAGACCACATGGATCGGCTGCCTCGTGACATCGCCCAAGAACGCATGCACCACGACATTGTTCACCTGCTGGATGAATATAACCTTGTGAAGAGCCCAACGCTGCACAATGGTCCGTTGGGAGCAACGACATTATCACCTCCCATCTGCTCCCCTAATGGTTACATGGGGAACATGAAGCCTTCTGTTCAGAGCAAGAAAGCCCGCAAGCCCAGTATCAAAGGTAATGGCTGCAAAGAGGCCAAxxxxxxAAAGCCAGAAGGAAAAAATCTCAAGATGGGAAAACAACTCTCTTGGATTCTGGCAGTTCTGGAGTGTTGTCCCCAGTGGACTCCCTGGAGTCAACACATGGATACTTATCAGATGTGTCTTCTCCTCCGCTGATGACCTCTCCGTTTCAGCAGTCTCCATCCATGCCTCTGAACCACTTGACAAGCATGCCAGAGTCCCACCTTGGCATGAATCACATAAACATGGCCACCAAGCAGGAAATGGCAGCAGGTTCCAACAGAATGGCTTTTGATGCCATGGTGCCACGTCTGACCCATCTCAATGCCTCAAGCCCTAATACCATCATGAGCAATGGATCCATGCATTTCACTGTGGGAGGAGCTCCGACTATGAACAGCCAATGTGACTGGTTAGCTAGGCTGCAGAATGGGATGGTCCAGAATCAGTATGACCCAATCAGAAATGGCATCCAACAAGGCAATGCTCAACAAGCTCAAGCTCTTCAGCATGGCCTTATGACCTCGCTCCATAATGGTCTGCCAGCAACAACTCTCTCCCAAATGATGACCTATCAGGCCATGCCCAACACAAGGCTAGCCAATCAGCCACATCTAATGCAAGCCCAGCAAATGCAACAGCAGCAAAACTTGCAGTTGCACCAGAGCATGCAGCAACAACATCACAATTCCAGCACGACCTCTACTCACATCAACTCACCATTCTGCAGCAGTGACATAAGCCAGACGGACCTGCAGCAAATGTCAAGCAACAACATTCATTCAGTAATGCCCCAGGACACTCAGATATTTGCCGCATCTCTGCCTTCCAATCTTACGCAGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCAATGGACAATACACCAAGCCATCAACTACAAGTACCAGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCCAATATGTCTGACTGGTCAGAAGGAATATCAAGTCCTCCCACGAGTATGCAGCCTCAGCGCACCCACATACCTGAAGCTTTCAAGTAAAAAAAAAAAAGTTTAAAAAAATGTAAAATATTTTTAAAGACACTGAGAGAGACTTTAAGAGACTGAAGGAAATTTTTATATGGTTTTTATACTTAAAATAACAGAACATTTGAATTTTCTAGTATTTATTTATATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTCATTTTTAGGACAAAATATTTTAACTTCTTGCCTTGAAAGTTTTTCAGTTCTAAATCTTATGAAATTGGTTCCTGCCTGGTATTGAAAACGGCAATGTATTTATTTTTTATTTACCTGAATAGTATACAGGAACAAACCACTGGGGTGGGGGGGTTATCGGGATGTGTATTTAGCAGAAAAAAGATTTTCTATAAAATGAAATCTTTCAGGTTTTCATTTATAGCACTAAAAAGATTCCAGTATTAATTTTAAATTAAATCATGAAGAAGATGCTCCGAATACCTCTCGCTGTCAGGGAGGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     2     3     2     3     2     3     2     3     1     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     3     4     4     4     3     4     4     4     4     4     3     4     4     5     4     5     3     5     3     5     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     3     5     3     5     3     5     3     5     4     5     4     5     4     5     4     5     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     8     9     7     9     8     8     7     7     6     7     5     7     5     6     5     6     5     6     5     5     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3
  5   1   2       e50                              Xl3.1-xlk112k21ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGAATGGGGAGATGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATTCTCCCAGAACTTGTTGACGACAAAACTGACCCCCGACAGTGGACACGGCAGCACCTTGACGCCGCTGATCTGCGCATTTCATCCATGGCCCCAACGCCGCCGCAGGGAGAGATTGAGGCCGACTGTATGGATGTCAATGTCCGTGGCCCTGATGGCTTCACCCCACTTATGATTGCCTCCTGTAGCGGAGGTGGATTAGAGACTGGAAACAGCGAAGAGGAAGAGGATGCTTCAGCTAATATGATTTCCGACTTCATTGGGCAGGGTGCCCAACTGCATAACCAAACCGACCGCACTGGCGAGACAGCACTTCATCTGGCCGCAAGATACGCACGTGCTGATGCAGCCAAGCGCCTGTTGGAATCGAGTGCGGACGCCAACGTCCAGGATAACATGGGCAGGACTCCTCTCCATGCAGCAGTGGCGGCTGATGCTCAGGGCGTATTCCAGATTCTCATTCGGAACCGAGCGACAGACTTAGACGCTCGCATGTTTGATGGCACTACCCCTCTGATCCTAGCCGCTCGGCTGGCCGTGGAAGGGATGGTGGAGGAGCTTATCAATGCTCATGCAGATGTCAACGCTGTTGATGAATTTGGAAAATCTGCTTTGCATTGGGCAGCGGCTGTGAATAACGTTGATGCTGCAGCTGTGCTTCTCAAGAATAGTGCAAATAAGGACATGCAAAACAACAAGGAAGAGACATCCCTGTTCTTGGCCGCAAGAGAAGGCAGCTACGAAACTGCCAAAGTCCTTTTGGATCACTACGCCAACCGTGACATCACAGACCACATGGATCGGCTGCCTCGTGACATCGCCCAAGAACGCATGCACCACGACATTGTTCACCTGCTGGATGAATATAACCTTGTGAAGAGCCCAACGCTGCACAATGGTCCGTTGGGAGCAACGACATTATCACCTCCCATCTGCTCCCCTAATGGTTACATGGGGAACATGAAGCCTTCTGTTCAGAGCAAGAAAGCCCGCAAGCCCAGTATCAAAGGTAATGGCTGCAAAGAGGCCAAAGAGCTGAAAGCCGAAGGAAAAAATCTCAAGATGGGAAAACAACTCTCTTGGATTCTGGCA------------TGTCCCCAGTNGACTCCCTGGAGTCAACACATGGATACTTATCAGATGTGTCTTCTCCTCCGCTGATGACCTCTCCGNTTCAGCAGTCTCCATCCATGCCTCTGAACNNCTTGACAAGCATGCCAGAGTCCCAGCTTGGNATGAATCACATAAACATGGCCACCAAGC------------CAGGTTCCAACAGAATNGCTTTTG
  5   1   2       e50                              Xl3.1-xlk112k21ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACATGGATACTTATCAGATGTGTCTTCTCCTCCGCTGATGACCTCTCCGTTTCAGCAGTCTCCATCCATGCCTCTGAACCACTTGACAAGCATGCCAGAGTCCCACCTTGGCATGAATCACATAAACATGGCCACCAAGCAGGAAATGGCAGCAGGTTCCAACAGAATGGCTTTTGATGCCATGGTGCCACGTCTGACCCATCTCAATGCCTCAAGCCCTAATACCATCATGAGCAATGGATCCATGCATTTCACTGTGGGAGGAGCTCCGACTATGAACAGCCAATGTGACTGGTTAGCTAGGCTGCAGAATGGGATGGTCCAGAATCAGTATGACCCAATCAGAAATGGCATCCAACAAGGCAATGCTCAACAAGCTCAAGCTCTTCAGCATGGCCTTATGACCTCGCTCCATAATGGTCTGCCAGCAACAACTCTCTCCCAAATGATGACCTATCAGGCCATGCCCAACACAAGGCTAGCCAATCAGCCACATCTAATGCAAGCCCAGCAAATGCAACAGCAGCAAAACTTGCAGTTGCACCAGAGCATGCAGCAACAACATCACAATTCCAGCACGACCTCTACTCACATCAACTCACCATTCTGCAGCAGTGACATAAGCCAGACGGACCTGCAGCAAATGTCAAGCAACAACATTCATTCAGTAATGCCCCAGGACACTCAGATATTTGCCGCATCTCTGCCTTCCAATCTTACGCAGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCAATGGACAATACACCAAGCCATCAACTACAAGTACCAGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCCAATATGTCTGACTGGTCAGAAGGAATATCAAGTCCTCCCACGAGTATGCAGCCTCAGCGCACCCACATACCTGAAGCTTTCAAGTAAAAAAAAAAAAGTTTAAAAAAATGTAAAATATTTTTAAAGACACTGAGAGAGACTTTAAGAGACTGAAGGAAATTTTTATATGGTTTTTATACTTAAAATAACAGAACATTTGAATTTTCTAGTATTTATTTATATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTCATTTTTAGGACAAAATATTTTAACTTCTTGCCTTGAAAGTTTTTCAGTTCTAAATCTTATGAAATTGGTTCCTGCCTGGTATTGAAAACGGCAATGTATTTATTTTTTATTTACCTGAATAGTATACAGGAACAAACCACTGGGGTGGGGGGGTTATCGGGATGTGTATTTAGCAGAAAAAAGATTTTCTATAAAATGAAATCTTTCAGGTTTTCATTTATAGCACTAAAAAGATTCCAGTATTAATTTTAAATTAAATCATGAAGAAGATGCTCCGAATACCTCTCGCTGTCAGGGAG
                                               BLH MIN     528     136                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 6e-011     NP_001021269.1 UNCoordinated family member (unc-44) [Caenorhabditis elegans] ------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 4e-012     XP_001193325.1 PREDICTED: similar to ankyrin 2,3/unc44 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 2e-029     XP_617999.2 PREDICTED: similar to Notch4, partial [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 9e-049     NP_476859.2 CG3936-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 3e-049     XP_309208.4 AGAP001015-PA [Anopheles gambiae str. PEST] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 1e-073     NP_001037825.1 Notch [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 2e-090     NP_571377.2 notch homolog 1b [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 9e-117     XP_537795.2 PREDICTED: similar to notch1 preproprotein [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 4e-117     XP_001252843.2 PREDICTED: Notch homolog 1, translocation-associated (Drosophila) [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 5e-120     NP_032740.2 Notch gene homolog 1; Notch gene homolog 1, (Drosophila) [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 6e-123     NP_060087.3 notch1 preproprotein [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-142     XP_415420.2 PREDICTED: Notch homolog 1, translocation-associated [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          NP_001090757.1 Notch homolog 1, translocation-associated [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          NP_001081074.1 Notch protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-xlk112k21ex.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGA------------------------------------------------------------------------------------------TGATGA---------------------------------------TAA---TGA------------------------TAG------TAA---------------------------------------------------------------------------------------------------TGA------------------------------TGA---------------------------------------------TGA---TAA------------------------------------------------------------------------TAA------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------ATG------------------ATG------------ATG---------------ATG------------------ATG------------ATG---------------------------------------------ATG------------ATG---------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------ATGATG------------ATG---------------------------------ATG------------ATG---------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------TAA---------------------------------------------------------------TGA---------------------------TAA---------------------------------------------------TAA------------------------------------------------------------------------------------------ATG---------------------TGA------------------------------TGA------------------------------------------------------------------------------TGA---------------------TAG---TAA------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       e50                              Xl3.1-xlk112k21ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGAATGGGGAGATGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATTCTCCCAGAACTTGTTGACGACAAAACTGACCCCCGACAGTGGACACGGCAGCACCTTGACGCCGCTGATCTGCGCATTTCATCCATGGCCCCAACGCCGCCGCAGGGAGAGATTGAGGCCGACTGTATGGATGTCAATGTCCGTGGCCCTGATGGCTTCACCCCACTTATGATTGCCTCCTGTAGCGGAGGTGGATTAGAGACTGGAAACAGCGAAGAGGAAGAGGATGCTTCAGCTAATATGATTTCCGACTTCATTGGGCAGGGTGCCCAACTGCATAACCAAACCGACCGCACTGGCGAGACAGCACTTCATCTGGCCGCAAGATACGCACGTGCTGATGCAGCCAAGCGCCTGTTGGAATCGAGTGCGGACGCCAACGTCCAGGATAACATGGGCAGGACTCCTCTCCATGCAGCAGTGGCGGCTGATGCTCAGGGCGTATTCCAGATTCTCATTCGGAACCGAGCGACAGACTTAGACGCTCGCATGTTTGATGGCACTACCCCTCTGATCCTAGCCGCTCGGCTGGCCGTGGAAGGGATGGTGGAGGAGCTTATCAATGCTCATGCAGATGTCAACGCTGTTGATGAATTTGGAAAATCTGCTTTGCATTGGGCAGCGGCTGTGAATAACGTTGATGCTGCAGCTGTGCTTCTCAAGAATAGTGCAAATAAGGACATGCAAAACAACAAGGAAGAGACATCCCTGTTCTTGGCCGCAAGAGAAGGCAGCTACGAAACTGCCAAAGTCCTTTTGGATCACTACGCCAACCGTGACATCACAGACCACATGGATCGGCTGCCTCGTGACATCGCCCAAGAACGCATGCACCACGACATTGTTCACCTGCTGGATGAATATAACCTTGTGAAGAGCCCAACGCTGCACAATGGTCCGTTGGGAGCAACGACATTATCACCTCCCATCTGCTCCCCTAATGGTTACATGGGGAACATGAAGCCTTCTGTTCAGAGCAAGAAAGCCCGCAAGCCCAGTATCAAAGGTAATGGCTGCAAAGAGGCCAAAGAGCTGAAAGCCGAAGGAAAAAATCTCAAGATGGGAAAACAACTCTCTTGGATTCTGGCA------------TGTCCCCAGTNGACTCCCTGGAGTCAACACATGGATACTTATCAGATGTGTCTTCTCCTCCGCTGATGACCTCTCCGNTTCAGCAGTCTCCATCCATGCCTCTGAACNNCTTGACAAGCATGCCAGAGTCCCAGCTTGGNATGAATCACATAAACATGGCCACCAAGC------------CAGGTTCCAACAGAATNGCTTTTG
                                                  Xl3.1-CHK-1012713779                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGGGAGATGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATTCTCCCAGAACTTGTTGACGACAAAACTGACCCCCGACAGTGGACACGGCAGCACCTTGACGCCGCTGATCTGCGCATTTCATCCATGGCCCCAACGCCGCCGCAGGGAGAGATTGAGGCCGACTGTATGGATGTCAATGTCCGTGGCCCTGATGGCTTCACCCCACTTATGATTGCCTCCTGTAGCGGAGGTGGATTAGAGACTGGAAACAGCGAAGAGGAAGAGGATGCTTCAGCTAATATGATTTCCGACTTCATTGGGCAGGGTGCCCAACTGCATAACCAAACCGACCGCACTGGCGAGACAGCACTTCATCTGGCCGCAAGATACGCACGTGCTGATGCAGCCAAGCGCCTGTTGGAATCGAGTGCGGACGCCAACGTCCAGGATAACATGGGCAGGACTCCTCTCCATGCAGCAGTGGCGGCTGATGCTCAGGGCGTATTCCAGATTCTCATTCGGAACCGAGCGACAGACTTAGACGCTCGCATGTTTGATGGCACTACCCCTCTGATCCTAGCCGCTCGGCTGGCCGTGGAAGGGATGGTGGAGGAGCTTATCAATGCTCATGCAGATGTCAACGCTGTTGATGAATTTGGAAAATCTGCTTTGCATTGGGCAGCGGCTGTGAATAACGTTGATGCTGCAGCTGTGCTTCTCAAGAATAGTGCAAATAAGGACATGCAAAACAACAAGGAAGAGACATCCCTGTTCTTGGCCGCAAGAGAAGGCAGCTACGAAACTGCCAAAGTCCTTTTGGATCACTACGCCAACCGTGACATCACAGACCACATGGATCGGCTGCCTCGTGACATCGCCCAAGAACGCATGCACCACGACATTGTTCACCTGCTGGATGAATATAACCTTGTGAAGAGCCCAACGCTGCACAATGGTCCGTTGGGAGCAACGACATTATCACCTCCCATCTGCTCCCCTAATGGTTACATGGGGAACATGAAGCCTTCTGTTCAGAGCAAGAAAGCCCGCAAGCCCAGTATCAAAGGTAATGGCTGCAAAGAGGCCAAAGAGCTGAAAGCCxxAxGxAAAAATCTCAAGATGGGAAAACAACTCTCTTGGATT------------GAGNGTTGTCCCCAGTNGACTCCCTGGAGTCAACACATGGATACTTATCAGATGTGTCTTCTCCTCCGCTGATGACCTCTCCGNTTCAGCAGTCTCCATCCATGCCTC------------CAAGCATGCCAGAGTCCCAGCTTGGNATGAATCACATAAACATGGCCA------------TGGCAGCAGGTTCCAACAGAATNGCTTTTGATGCCA
  5   1   2      skin DMZ                                  xl302e18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGAATGGGGAGATGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATTCTCCCAGAACTTGTTGACGACAAAACTGACCCCCGACAGTGGACACGGCAGCACCTTGACGCCGCTGATCTGCGCATTTCATCCATGGCCCCAACGCCGCCGCAGGGAGAGATTGAGGCCGACTGTATGGATGTCAATGTCCGTGGCCCTGATGGCTTCACCCCACTTATGATTGCCTCCTGTAGCGGAGGTGGATTAGAGACTGGAAACAGCGAAGAGGAAGAGGATGCTTCAGCTAATATGATTTCCGACTTCATTGGGCAGGGTGCCCAACTGCATAACCAAACCGACCGCACTGGCGAGACAGCACTTCATCTGGCCGCAAGATACGCACGTGCTGATGCAGCCAAGCGCCTGTTGGAATCGAGTGCGGACGCCAACGTCCAGGATAACATGGGCAGGACTCCTCTCCATGCAGCAGTGGCGGCTGATGCTCAGGGCGTATTCCAGATTCTCATTCGGAACCGAGCGACAGACTTAGACGCTCGCATGTTTGATGGCACTACCCCTCTGATCCTAGCCGCTCGGCTGGCCGTGGAAGGGATGGTGGAGGAGCTTATCAATGCTCATGCAGATGTCAACGCTGTTGATGAATTTGGAAAATCTGCTT
  5   1   2      seed Tbd7      in                         XL083p22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTNATTCGGAACCGAGCGACAGACTTAGNACGCCCGCATGTTTGATGGCACTACCCCTCTGATCCTGGCCGCTCGGCTGGCCGTGGAAGGGATGGTGGAGGAGCTTATCAATGCTCATGCAGATGTCAACGCTGTTGATGAATTTGGAAAATCTGCTTTGCATTGGGCAGCGGCTGTGAATAACGTTGATGCTGCAGCTGTGCTTCTCAAGAATAGTGCAAATAAGGACATGCAAAACAACAAGGAAGAGACATCCCTGTTCTTGGCCGCAAGAGAAGGCAGCTACGAAACTGCCAAAGTCCTTTTGGATCACTACGCCAACCGTGACATCACAGACCACATGGATCGGCTGCCTCGTGACATCGCCCAAGAACGCATGCACCACGACATTGTTCACCTGCTGGATGAATATAACCTTGTGAAGAGCCCAACGCTGCACAATGGTCCGTTGGGAGCAACGACATTATCACCTCCCATCTGCTCCCCTAATGGTTACATGGGGAACATGAAGCCTTCTGTTCAGAGCAAGAAAGCCCGCAAGCCCAGTATCAAAGGTAATGGCTGCAAAGAGGCCAAAGAGCTGAAAGCCAGAAGGAAAAAATCTCAAGATGGGAAAACAACTCTCTTGGATTCTGGCAGTTC
  5   1   2       bld Ga18      in                      xlk112k21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGTGAATAACGTTGATGCTNNNNNNTCTNCTCAAGAATAGTGCAAATAAGGACATGCAAAACAACAAGGAAGAGACATCCCTGTTCTTGGCCGCAAGAGAAGGCAGCTACGAAACTGCCAAAGTCCTTTTGGATCACTACGCCAACCGTGACATCACAGACCACATGGATCGGCTGCCTCGTGACATCGCCCAAGAACGCATGCACCACGACATTGTTCACCTGCTGGATGAATATAACCTTGTGAAGAGCCCAACGCTGCACAATGGTCCGTTGGGAGCAACGACATTATCACCTCCCATCTGCTCCCCTAATGGTTACATGGGGAACATGAAGCCTTCTGTTCAGAGCAAGAAAGCCCGCAAGCCCAGTATCAAAGGNAATGGCTGCAAAGAGGCCAAAGAGCTGNNNNNNGAAGGAAAAAATCTCAAGATGGGAAAACAACTCTCTTGGATTCTGGCAGTNCTNGAGNGTTGTCCCCAGTNGACTCCCTGGAGTCAACACATGGATACTTATCAGATGTGTCTTCTCCTCCGCTGATGACCTCTCCGNTTCAGCAGTCTCCATCCATGCCTCTGAACNNCTTGACAAGCATGCCAGAGTCCCAGCTTGGNATGAATCACATAAACATGGCCACCAAGCNNGAAATGGCAGCAGGTTCCAACAGAATNGCTTTTGATGCCATNGTNCNCGNCTGACCC
  5   1   2       e50                              Xl3.1-xlk112k21ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACATGGATACTTATCAGATGTGTCTTCTCCTCCGCTGATGACCTCTCCGTTTCAGCAGTCTCCATCCATGCCTCTGAACCACTTGACAAGCATGCCAGAGTCCCACCTTGGCATGAATCACATAAACATGGCCACCAAGCAGGAAATGGCAGCAGGTTCCAACAGAATGGCTTTTGATGCCATGGTGCCACGTCTGACCCATCTCAATGCCTCAAGCCCTAATACCATCATGAGCAATGGATCCATGCATTTCACTGTGGGAGGAGCTCCGACTATGAACAGCCAATGTGACTGGTTAGCTAGGCTGCAGAATGGGATGGTCCAGAATCAGTATGACCCAATCAGAAATGGCATCCAACAAGGCAATGCTCAACAAGCTCAAGCTCTTCAGCATGGCCTTATGACCTCGCTCCATAATGGTCTGCCAGCAACAACTCTCTCCCAAATGATGACCTATCAGGCCATGCCCAACACAAGGCTAGCCAATCAGCCACATCTAATGCAAGCCCAGCAAATGCAACAGCAGCAAAACTTGCAGTTGCACCAGAGCATGCAGCAACAACATCACAATTCCAGCACGACCTCTACTCACATCAACTCACCATTCTGCAGCAGTGACATAAGCCAGACGGACCTGCAGCAAATGTCAAGCAACAACATTCATTCAGTAATGCCCCAGGACACTCAGATATTTGCCGCATCTCTGCCTTCCAATCTTACGCAGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCAATGGACAATACACCAAGCCATCAACTACAAGTACCAGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCCAATATGTCTGACTGGTCAGAAGGAATATCAAGTCCTCCCACGAGTATGCAGCCTCAGCGCACCCACATACCTGAAGCTTTCAAGTAAAAAAAAAAAAGTTTAAAAAAATGTAAAATATTTTTAAAGACACTGAGAGAGACTTTAAGAGACTGAAGGAAATTTTTATATGGTTTTTATACTTAAAATAACAGAACATTTGAATTTTCTAGTATTTATTTATATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTCATTTTTAGGACAAAATATTTTAACTTCTTGCCTTGAAAGTTTTTCAGTTCTAAATCTTATGAAATTGGTTCCTGCCTGGTATTGAAAACGGCAATGTATTTATTTTTTATTTACCTGAATAGTATACAGGAACAAACCACTGGGGTGGGGGGGTTATCGGGATGTGTATTTAGCAGAAAAAAGATTTTCTATAAAATGAAATCTTTCAGGTTTTCATTTATAGCACTAAAAAGATTCCAGTATTAATTTTAAATTAAATCATGAAGAAGATGCTCCGAATACCTCTCGCTGTCAGGGAG
                                                  Xl3.1-CHK-1012693455                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATACTTATCAGATGTGTCTTCTCCTCCGCTGATGACCTCTCCGTTTCAGCAGTCTCCATCCATGCCTCTGAACCACTTGACAAGCATGCCAGAGTCCCACCTTGGCATGAATCACATAAACATGGCCACCAAGCAGGAAATGGCAGCAGGTTCCAACAGAATGGCTTTTGATGCCATGGTGCCACGTCTGACCCATCTCAATGCCTCAAGCCCTAATACCATCATGAGCAATGGATCCATGCATTTCACTGTGGGAGGAGCTCCGACTATGAACAGCCAATGTGACTGGTTAGCTAGGCTGCAGAATGGGATGGTCCAGAATCAGTATGACCCAATCAGAAATGGCATCCAACAAGGCAATGCTCAACAAGCTCAAGCTCTTCAGCATGGCCTTATGACCTCGCTCCATAATGGTCTGCCAGCAACAACTCTCTCCCAAATGATGACCTATCAGGCCATGCCCAACACAAGGCTAGCCAATCAGCCACATCTAATGCAAGCCCAGCAAATGCAACAGCAGCAAAACTTGCAGTTGCACCAGAGCATGCAGCAACAACATCACAATTCCAGCACGACCTCTACTCACATCAACTCACCATTCTGCAGCAGTGACATAAGCCAGACGGACCTGCAGCAAATGTCAAGCAACAACATTCATTCAGTAATGCCCCAGGACACTCAGATATTTGCCGCATCTCTGCCTTCCAATCTTACGCAGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCAATGGACAATACACCAAGCCATCAACTACAAGTACCAGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCCAATATGTCTGACTGGTCAGAAGGAATATCAAGTCCTCCCACGAGTATGCAGCCTCAGCGCACCCACATACCTGAAGCTTTCAAGTAAAAAAAAAAAAGTTTAAAAAAATGTAAAATATTTTTAAAGACACTGAGAGAGACTTTAAGAGACTGAAGGAAATTTTTATATGGTTTTTATACTTAAAATAACAGAACATTTGAATTTTCTAGTATTTATTTATATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTCATTTTTAGGACAAAATATTTTAACTTCTTGCCTTGAAAGTTTTTCAGTTCTAAATCTTATGAAATTGGTTCCTGCCTGGTATTGAAAACGGCAATGTATTTATTTTTTATTTACCTGAATAGTATACAGGAACAAACCACTGGGGTGGGGGGGTTATCGGGATGTGTATTTAGCAGAAAAAAGATTTTCTATAAAATGAAATCTTTCAGGTTTTCATTTATAGCACTAAAAAGATTCCAGTATTAATTTTAAATTAAATCATGAAGAAGATGCTCCGAATACCTCTCGCTGTCAGGGAGGTGCCC
  5   1   2       bld Egg1                               PBX0136F09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGAGGACGCATGCACCACGACATTGTTCACCTGCTGGATGAATATAACCTTGTGAAGAGCCCAACGCTGCACAATGGTCCGTTGGGAGCAACGACATTATCACCTCCCATCTGCTCCCCTAATGGTTACATGGGGAACATGAAGCCTTCTGTTCAGAGCAAGAAAGCCCGCAAGCCCAGTATCAAAGGTAATGGCTGCAAAGAGGCCAAAGAGCTGAAAGCCAGAAGGAAAAAATCTCAAGATGGGAAAACAACTCTCTTGGATTCTGGCAGTTCTGGAGTGTTGTCCCCAGTGGACTCCCTGGAGTCAACACATGGATACTTATCAGATGTGTCTTCTCCTCCGCTGATGACCTCTCCGTTTCAGCAGTCTCCATCCATGCCTCTGAACCACTTGACAAGCATGCCAGAGTCCCACCTTGGCATGAATCACATAAACATGGCCACCAAGCAGGAAATGGCAGCCGGTTCCAACAGAATGGCTTTTGATGCCATGGTGCCACGTCTGACCCATCTCAATGCCTCAAGCCCTAATACCATCATGAGCAATGGATCCATGCATTTCACTGTGGGAGGAGCTCCGACTATGAACAGCCAATGTGACTGGTTAGCTAGGCTGCAGAATGGGATGGTCCAGAATCAGTATGACCCAATCAGAAATGGC
  5   1   2       bld Ga12                                 XL187n10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTGGAGTCAACACATGGATACTTATCAGATGTGTCTTCTCCTCCGCTGATGACCTCTCCGTTTCAGCAGTCTCCATCCATGCCTCTGAACCACTTGACAAGCATGCCAGAGTCCCAGCTTGGCATGAATCACATAAACATGGCCACCAAGCAGGAAATGGCAGCAGGTTCCAACAGAATGGCTTTTGATGCCATGGTGCCACGTCTGACCCATCTCAATGCCTCAAGCCCTAATACCATCATGAGCAATGGATCCATGCATTTCACTGTGGGAGGAGCTCCGACTATGAACAGCCAATGTGACTGGTTAGCTAGGCTGCAGAATGGGATGGTCCAGAATCAGTATGACCCAATCAGAAATGGCATCCAACAAGGCAATGCTCAACAAGCTCAAGCTCTTCAGCATGGCCTTATGACCTCGCTCCATAATGGTCTGCCAGCAACAACTCTCTCCCAAATGATGACCTATCAGGCCATGCCCAACACAAGGCTAGCCAATCAGCCACATCTAAT
  5   1   2       bld Tbd7                                 XL097j15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTGTCTTCTCCTCCGCTGATGACCTCTCCGTTTCAGCAGTCTCCATCCATGCCTCTGAACCACTTGACAAGCATGCCAGAGTCCCACCTTGGCATGAATCACATAAACATGGCCACCAAGCAGGAAATGGCAGCAGGTTCCAACAGAATGGCTTTTGATGCCATGGTGCCACGTCTGACCCATCTCAATGCCTCAAGCCCTAATACCATCATGAGCAATGGATCCATGCATTTCAATGTGGGAGGAGCTCCGACTATGAACAGCCAATGTGACTGGTTAGCTAGGCTGCAGAATGGGATGGTCCAGAATCAGTATGACCCAATCAGAAATGGCATCCAACAAGGCAATGCTCAACAAGCTCAAGCTCTTCAGCATGGCCTTATGACCTCGCTCCATAATGGTCTGCCAGCAACAACTCTCTCCCAAATGATGACCTATCAGGCCATGCCCAACACAAGGCTAGCCAATCAGCCACATCTAatgcaagcccagcaaatgcaacagcagcaaaacttgcagttgcaccagagcatgcagcaacaaCATCACAATTCCAGCACGACCTCTACTCACATCAACTCGCCATTCTGCAGCAGTGACATAAGCC
  3   1   2       bld Ga18      in                      xlk112k21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATGCAGCAGGTTCCANNAGAATGGCTTTTGATGCCATGGTGCCACNNCTGNCCCNTCTCAATGCCTCAAGNCCTAATACCNTCATGAGCAATGGATCCATGCATTTCACTGTGGGNGGAGCTCCGACTATGNACAGCCAATGTGACTGGTTANNTAGGCTGCAGAATGGGATGGTCCAGAATCAGTATGACCCAATCAGAAATGGCATCCAACAAGGNAATGCTCAACAAGCTCAAGCTCTTCAGCATGNNCTTATGNCCTCGCTCCATAATGGTCTGCCAGCAACAACTCTCTCCCAAATGATGACCTATCAGNCATGCCCAACACAAGGCTANCCAATCAGCCACATCTAATGCAANCCCAGCAAATGCAACAGCAGCAAAACTTGCAGTTGCACCAGAGCATGCAGCAACAACATCACAATTCCAGCACGACCTCTACTCACATCAACTCACCATTCTGCAGCAGTGACATAAGCCAGACGGACCTGCAGCAAATGTCAAGCAACAACATTCATTCAGTAATGCCCCAGGACACTCAGATATTTGCCGCATCTCTGCCTTCCAATCTTACGCAGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCAATGGACAATACACCAAGCCATCAACTACAAGTACCAGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGTGNTCAANCTCCTCCCCTCATTCCAATATGTCTGACTGGTCAGAAGGAATATCNANCCTCCCACGAGT
  3   1   2       bld Egg1                            IMAGE:3301686.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAAGTCCTAAACCCATCATGAGCAAGGGTGCATGCGATTTCACTGGGGGAGAGCTACCGACTATGACCAGCCAATGTGACTGGTAAGCTAGGCTGCAAGAATGGAATGGTCCAGAATCAGTATGTCCCAATCAGTAATGGCATCCACAAAGCCAATGCTCACAAAGCTCAAGCTCGTCAGCATGGCCTTATGACCTCGCTCCATAATGGTCTGCCAGCAACAACTCTCTCCCAAATGATGACCTATCAGGCCATGCCCAACACAAGGCTAGCCAATCAGCCACATCTAATGCAAGCCCAGCAAATGCAACAGCAGCAAAACTTGCAGTTGCACCAGAGCATGCAGCAACAACATCACAATTCCAGCACGACCTCTACTCACATCAACTCGCCATTCTGCAGCAGTGACATAAGCCAGACGGACCTGGCAGCCAAATGTCAAGCAACAACATTCATTCAGTAATGCCCCAGGACACTCAGATATTTGCCGCATCTCTGCCTTCCAATCTTACGCAGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCTCATTCCAATATGTCTGACTGGTCAGAAGGAATATCAAGTCCTCCCACGAGTATGCAGCCTCAGCGCACCCACATACCTGAAGCTTTCAAGTAAA
  3   1   2      seed Ga12                                 XL148j02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGCTGCAGAATGGGATGGTCCAGAATCAGTATGACCCAATCAGAAATGGCATCCAACAAGGCAATGCTCAACAAGCTCAAGCTCTTCAGCATGGCCTTATGACCTCGCTCCATAATGGTCTGCCAGCAACAACTCTCTCCCAAATGATGACCTATCAGGCCATGCCCAACACAAGGCTAGCCAATCAGCCACATCTAATGCAAGCCCAGCAAATGCAACAGCAGCAAAACTTGCAGTTGCACCAGAGCATGCAGCAACAACATCACAATTCCAGCACGACCTCTACTCACATCAACTCACCATTCTGCAGCAGTGACATAAGCCAGACGGACCTGCAGCAAATGTCAAGCAACAACATTCATTCAGTAATGCCCCAGGACACTCAGATATTTGCCGCATCTCTGCCTTCCAATCTTACGCAGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCAATGGACAATACACCAAGCCATCAACTACAAGTACCAGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCCAATATGTC
  3   1   2       bld Tbd7      in                         XL083p22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTCCCAAATGATGACCTATCAGGCCATGCCCAACACAAGGCTAGCCAATCAGCCACATCTAATGCAAGCCCAGCAAATGCAACAGCAGCAAAACTTGCAGTTGCACCAGAGCATGCAGCAACAACATCACAATTCCAGCACGACCTCTACTCACATCAACTCACCATTCTGCAGCAGTGACATAAGCCAGACGGACCTGCAGCAAATGTCAAGCAACAACATTCATTCAGTAATGCCCCAGGACACTCAGATATTTGCCGCATCTCTGCCTTCCAATCTTACGCAGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCAATGGACAATACACCAAGCCATCAACTACAAGTACCAGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCCAATATGTCTGACGGTCAGAAGGAATATCAAGTCCTCCCACGAGTATGCAGCCTCAGCGCACCCACATACCTA
  5   1   2       bld Neu7                                 XL017e06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATCTAATGCAAGCCCAGCAAATGCAACAGCAGCAAAACTTGCAGTTGCACCAGAGCATGCAGCAACAACATCACAATTCCAGCACGACCTCTACTCACATCAACTCACCATTCTGCAGCAGTGACATAAGCCAGACGGACCTGCAGCAAATGTCAAGCAACAACATTCATTCAGTAATGCCCCCAGGACACTCAGATATTTGCCGCATCTCTGCCTTCCAATCTTACGCAGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCAATGGACAATACACCAAGCCATCAACTACAAGTACCAGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCCAATATGTCTGACTGGTCAGAAGGAATATCAAGTCCTCCCACGAGTATGCAGCCTCAGCGCACCCACATACCTGAAGCTTTCAAGTaaaaaaaaaa
  5   1   2       bld Emb4                   IMAGE:4683944-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCAATGGACAATACACCAAGCCATCAACTACAAGTACCAGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCCAATATGTCTGACTGGTCAGAAGGAATATCAAGTCCTCCCACGAGTATGCAGCCTCAGCGCACCCACATACCTGAAGCTTTCAAGTaaaaaaaaaaaagtttaaaaaaaTGTAAAATATTTTTAAAGACACTGAGAGAGACTTTAAGAGACTGAAGGAAatttttatatggtttttatacttaaaataacagaacatttgaattttctagtatttatttatatatacgtttgacctaaaacactgcccttttatttataagctttttttcatttttAGGACAAAATATTTTAACTTCTTGCCTTGAAAGTTTTTCAGTTCTAAATCTTATGAAATTGGTTCCTGCCTGGTATTGAAAACGGCAATGTATTTATTTTTTATTTACCTGAATAGTATACAGGAACAAACCACTggggtgggggggTTATCGGGATGTGTATTTAGCAGAAAAAAGATTTTCTATAAAATGAAATCTTTCAGGTTTTCATTTATAGCACTAAAAAAGATTCCAGTATTAATTTTAAAATTAAATCATGAAGAAGATGCTCCGAATACCTCTCGCTGTCAGGGAGGTGCCCAAATAGGttttttttttttgttttttttttttGGGAAACCTGAAACTCTTGGGAAAGTACAGAAAGAAAGCATAAAATAC
  5   1   2       bld Emb4                            IMAGE:4683944.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTCTATGACAACTGCACAATTTTTAACCCCCCCTTCCCAGCATAGCTACTCCTCCCCAATGGACAATACACCAAGCCATCAACTACAAGTACCAGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCCAATATGTCTGACTGGTCAGAAGGAATATCAAGTCCTCCCACGAGTATGCAGCCTCAGCGCACCCACATACCTGAAGCTTTCAAGTaaaaaaaaaaaagtttaaaaaaaTGTAAAATATTTTTAAAGACACTGAGAGAGACTTTAAGAGACTGAAGGAAAtttttatatggtttttatacttaaaataacagaacatttgaattttctagtatttatttatatatacgtttgacctaaaacactgcccttttatttataagctttttttcatttttAGGACAAAATATTTTAACTTCTTGCCTTGAAAGTTTTTCAGTTCTAAATCTTATGAAATTGGTTCCTGCCTGGTATTGAAAACGGCAATGTATTTATTTTTTATTTACCTGAATAGTATACAGGAACAAACCACTggggtgggggggTTATCGGGATGTGTATTTAGCAGAAAAAAGATTTTCTATAAAATGAAATCTTTCAGGTTTTCATTTATAGCACTAAAAAGATTCCAGTATTAATTTTAAATTAAATCATGAAGAAGATGCTCCGAATACCTCTCGCTGTCAGGGAGGTGCCCCAATAGttttttttttttgtttttttttttGGGAAACCTGAAACTCTTGGTAAGTACCGAAAGAAAGCCTAAAATACAGGGAGGGCACGCCCTAGGGCTGATGCATTCTCAATGGGAATAAAAATCCTGGAAAAGGGACTCCTTttaaaaaattaaatttggtagaaaaaaacaaaCTGCC
  5   1   2       bld DMZ                                  xl240m05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAACTACAAGTACCNGACCACCCGTTCCTGACGCCTTCTCCTGAGTCACCTGACCAGNGGTCAAGCTCCTCCCCTCATTCCNATATGTCGGACTGGTCAGAAGGAATATCAAGTCCTCCCNCGAGTATGCAGCCTCAGCGCACCCACATACCTGAAGCTTTCAAGTAANAAANANA
  5   1   2       bld DMZ                                  xl244a02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCCAATATGTCTGACTGGTCAGAAGGAATATCAAGTCCTCCCACGAGTATGCAGCCTCAGCGCACCCACATACCTGAAGCTTTCAAGTaaaaaaaaaa
  5   1   2       bld Ga18                                xlk3p22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAGAGACTGAAGGAAATTTTTATATGGTTTTTATACTTAAAATAACAGAACATTTGAATTTTCTAGTATTTATTTATATATACGTTTGACCTAAAACACTGCCcttttatttataagctttttttcatttttAGGACAAAATATTTTAACTTCTTGCCTTGAAAGTTTTTCAGTTCTAAATCTTATGAAATTGGTTCCTGCCTGGTATTGAAAACGGCAATGTATTTATTTTTTATTTACCTGAATAGTATACAGGAACAAACCACTggggtgggggggTTATCGGGATGTGTATTTAGCAGAAAAAAGATTTTCTATAAAATGAAATCTTTCAGGTTTTCATTTATAGCACTAAAAAGATTCCAGTATTAATTTTAAATTAAATCATGAAGAAGATGCTCCGAATACCTCTCGCTGTCAGGGAGGTGCCCAATAGGttttttttttttgttttttttttGGAAAACCTGAAACTCTTGGTAAGTACAGAAAGAAAGCATAAAATACAGGAGGGCACGCCTAGGTCTGATGCATTCTCAATGGGAATAAAATCCTGAAAAGTGACTCATTTTAAAAAATTATATTTGTTAGAAAAAACAAACTGCCATTTTGAATCCCTTGTGTCGCATGGGGTANTGGTCAGAAAATGCATGCAATTTTTGGGNAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)