Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL437l23ex.3                         15 END     2          10       13                (no blast hit)
     2   2.0    0Xl3.1-xl271b09.3                            7 END     2          10       28                (no blast hit)

 This cluster: approximate FL confidence score = 99%

 1012838963 Xl3.1-xlk146a05ex.5.5 - 19 ESTs
                                                                       ........-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-xlk146a05ex.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCCAAGTGGACTTCTTTGCTGTGAGGCTTGATGATGATGATGATGAGGAGGAGGAGGGGAAGCAGCTGCTGGTATAAGTGCTCAGTCTCCTGCGTGTAGATCGCTGCCCTTGCTCCATGGCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTTGATGATGATGATGATGCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAAGCAGCAGAAGCCTCTAGAAGAATGTGAAGATGATGAATTGCCCTCTGGATGGGAGAAAATTGAAGACCCTGTGTATGGAGTCTACTATGTAGATCATATAAACAAGAAAACGCAATATGAAAACCCCGTATTGGAAGCCAAAAGAAAGAAACAGCTCGGACTGCAGCAAAGTGAAGAATGGACAGGGGATCATCCACCCATTGCTCCACCCCCTCTTGTGCTTCCAAACAACTTTACGCTAAAAAAGAAACAACCAGCAACTGCGGCACGTGCAAAACCATTCTTCACCAGAAACCCTTCTGAACTGAAAGGAAAGTTCATCAATACAAAGCTAAGGAAGAGCAGTCGAGGCTTTGGCTTTACTGTTGTCGGAGGGGACGAGCCAGATGAATTTTTGCAAATAAAGAGTTTGGTCGTCGATGGCCCGGCCGCATTGGATGGCAAAATGGAAACGGGCGACGTTATCGTAAGTGTGAATGATATCTGTGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGTGAAAATGTGAACCTTGAACTATGCCGGGGTTATCCTCTTCCATTTGACCCAGATGACCCCAACACCAGCCTTGTGACGTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGCCCTGGTGGTGGGGGCCAGAGGGTGAAGCAGATTGTAGACAGTCCAAGATGCCGTGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCTGAACCTTACCCATAATCAAGTTGTGGATTTACTCATCGAATGTCCTAAGGGAAGTGAAGTCACCCTACTGGTTCAGAGAGGAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAGCCACTTGAAAGGAAAGACAGCCAAAATAGCTCGCAGCACAGTGTTTCCAGCCAGCACAGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACCAATGCAGAGAAGATCGCCACAATTACGACCACACATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCGAAACCAAAGCCGGAACCCCAATTTGAGTTTAAGAACGCACCGGCCACCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGGAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCATTGGAGT
                                                  Xl3.1-CHK-1012722588                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTGGACTTCTTTGCTGTGAGGCTTGATGATGATGATGATGAGGAGGAGGAGGGGAAGCAGCTGCTGGTATAAGTGCTCAGTCTCCTGCGTGTAGATCGCTGCCCTTGCTCCATGGCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTTGATGATGATGATGATGCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAAGCAGCAGAAGCCTCTAGAAGAATGTGAAGATGATGAATTGCCCTCTGGATGGGAGAAAATTGAAGACCCTGTGTATGGAGTCTACTATGTAGATCATATAAACAAGAAAACGCAATATGAAAACCCCGTATTGGAAGCCAAAAGAAAGAAACAGCTCGGACTGCAGCAAAGTGAAGAATGGACAGGGGATCATCCACCCATTGCTCCACCCCCTCTTGTGCTTCCAAACAACTTTACGCTAAAAAAGAAACAACCAGCAACTGCGGCACGTGCAAAACCATTCTTCACCAGAAACCCTTCTGAACTGAAAGGAAAGTTCATCAATACAAAGCTAAGGAAGAGCAGTCGAGGCTTTGGCTTTACTGTTGTCGGAGGGGACGAGCCAGATGAATTTTTGCAAATAAAGAGTTTGGTCGTCGATGGCCCGGCCGCATTGGATGGCAAAATGGAAACGGGCGACGTTATCGTAAGTGTGAATGATATCTGTGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGTGAAAATGTGAACCTTGAACTATGCCGGGGTTATCCTCTTCCATTTGACCCAGATGACCCCAACACCAGCCTTGTGACGTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGCCCTGGTGGTGGGGGCCAGAGGGTGAAGCAGATTGTAGACAGTCCAAGATGCCGTGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCTGAACCTTACCCATAATCAAGTTGTGGATTTACTCATCGAATGTCCTAAGGGAAGTGAAGTCACCCTACTGGTTCAGAGAGGAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAGCCACTTGAAAGGAAAGACAGCCAAAATAGCTCGCAGCACAGTGTTTCCAGCCAGCACAGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACCAATGCAGAGAAGATCGCCACAATTACGACCACACATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCGAAACCAAAGCCGGAACCCCAATTTGAGTTTAAGAACGCACCGGxCAxCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGGAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     7     6     7     6     7     6     7     6     7     5     6     5     6     4     6     5     6     6     6     6     6     5     6     5     6     5     6     5     6     4     6     4     6     3     6     3     6     3     6     3     6     3     5     3     5     3     5     3     4     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     3     3     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     1     1     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     4     5     4     5     4     5     5     5     4     4     3     4     2     4     2     4     4     4     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     5     4     5     4     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3
  5   1   2      ests                              Xl3.1-xlk146a05ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCCAAGTGGACTTCTTTGCTGTGAGGCTTGATGATGATGATGATGAGGAGGAGGAGGGGAAGCAGCTGCTGGTATAAGTGCTCAGTCTCCTGCGTGTAGATCGCTGCCCTTGCTCCATGGCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTTGATGATGATGATGATGCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAAGCAGCAGAAGCCTCTAGAAGAATGTGAAGATGATGAATTGCCCTCTGGATGGGAGAAAATTGAAGACCCTGTGTATGGAGTCTACTATGTAGATCATATAAACAAGAAAACGCAATATGAAAACCCCGTATTGGAAGCCAAAAGAAAGAAACAGCTCGGACTGCAGCAAAGTGAAGAATGGACAGGGGATCATCCACCCATTGCTCCACCCCCTCTTGTGCTTCCAAACAACTTTACGCTAAAAAAGAAACAACCAGCAACTGCGGCACGTGCAAAACCATTCTTCACCAGAAACCCTTCTGAACTGAAAGGAAAGTTCATCAATACAAAGCTAAGGAAGAGCAGTCGAGGCTTTGGCTTTACTGTTGTCGGAGGGGACGAGCCAGATGAATTTTTGCAAATAAAGAGTTTGGTCGTCGATGGCCCGGCCGCATTGGATGGCAAAATGGAAACGGGCGACGTTATCGTAAGTGTGAATGATATCTGTGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGTGAAAATGTGAACCTTGAACTATGCCGGGGTTATCCTCTTCCATTTGACCCAGATGACCCCAACACCAGCCTTGTGACGTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGCCCTGGTGGTGGGGGCCAGAGGGTGAAGCAGATTGTAGACAGTCCAAGATGCCGTGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAAT
  5   1   2      ests                            Xl3.1-IMAGE:5073802.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCACAGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACCAATGCAGAGAAGATCGCCACAATTACGACCACACATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCGAAACCAAAGCCGGAACCCCAATTTGAGTTTAAGAACGCACCGGTCATCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGGAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCAT
                                               BLH MIN     195     320                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     447     337                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     447     265                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 3e-008     NP_001027610.1 tyrosine phosphatase [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 3e-088     XP_001179535.1 PREDICTED: similar to MAGI-1 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 1e-095     NP_611551.1 CG30388-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 2e-098     XP_554297.3 AGAP010754-PA [Anopheles gambiae str. PEST] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 5e-102     NP_502219.2 K01A6.2 [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 0          A1A5G4.1 Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 3 (Membrane-associated guanylate kinase inverted 3) (MAGI-3) [Xenopus tropicalis]  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Bt ---- 0          XP_001251034.1 PREDICTED: similar to membrane-associated guanylate kinase-related 3 (MAGI-3) isoform 1 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Gg ---- 0          XP_415974.2 PREDICTED: similar to membrane associated guanylate kinase, WW and PDZ domain containing 2 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dr ---- 0          NP_001007064.1 BAI1-associated protein 1 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 0          XP_533770.2 PREDICTED: similar to Membrane associated guanylate kinase, WW and PDZ domain containing protein 1 (BAI1-associated protein 1) (BAP-1) (Membrane associated guanylate kinase inverted-1) (MAGI-1) (Atrophin-1 interacting protein 3) (AIP3) (WW domain-containin [Canis familiaris]  -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ---- 0          NP_001025021.1 membrane associated guanylate kinase, WW and PDZ domain containing 1 isoform c [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 0          NP_004733.2 membrane associated guanylate kinase, WW and PDZ domain containing 1 isoform b [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - ?? ---- 0          XP_001789410.1 PREDICTED: similar to membrane associated guanylate kinase, WW and PDZ domain containing 1 isoform 1 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          AAI66055.1 Unknown (protein for IMAGE:5078836) [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-xlk146a05ex.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGATGATGATGATGATGA---------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------TGAATG---------------------------------------------------------TAA---------------------------------TGA---------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2      ests                              Xl3.1-xlk146a05ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCCAAGTGGACTTCTTTGCTGTGAGGCTTGATGATGATGATGATGAGGAGGAGGAGGGGAAGCAGCTGCTGGTATAAGTGCTCAGTCTCCTGCGTGTAGATCGCTGCCCTTGCTCCATGGCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTTGATGATGATGATGATGCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAAGCAGCAGAAGCCTCTAGAAGAATGTGAAGATGATGAATTGCCCTCTGGATGGGAGAAAATTGAAGACCCTGTGTATGGAGTCTACTATGTAGATCATATAAACAAGAAAACGCAATATGAAAACCCCGTATTGGAAGCCAAAAGAAAGAAACAGCTCGGACTGCAGCAAAGTGAAGAATGGACAGGGGATCATCCACCCATTGCTCCACCCCCTCTTGTGCTTCCAAACAACTTTACGCTAAAAAAGAAACAACCAGCAACTGCGGCACGTGCAAAACCATTCTTCACCAGAAACCCTTCTGAACTGAAAGGAAAGTTCATCAATACAAAGCTAAGGAAGAGCAGTCGAGGCTTTGGCTTTACTGTTGTCGGAGGGGACGAGCCAGATGAATTTTTGCAAATAAAGAGTTTGGTCGTCGATGGCCCGGCCGCATTGGATGGCAAAATGGAAACGGGCGACGTTATCGTAAGTGTGAATGATATCTGTGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGTGAAAATGTGAACCTTGAACTATGCCGGGGTTATCCTCTTCCATTTGACCCAGATGACCCCAACACCAGCCTTGTGACGTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGCCCTGGTGGTGGGGGCCAGAGGGTGAAGCAGATTGTAGACAGTCCAAGATGCCGTGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAAT
                                                  Xl3.1-CHK-1012694327                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTGGACTTCTTTGCTGTGAGGCTTGATGATGATGATGATGAGGAGGAGGAGGGGAAGCAGCTGCTGGTATAAGTGCTCAGTCTCCTGCGTGTAGATCGCTGCCCTTGCTCCATGGCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTTGATGATGATGATGATGCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAAGCAGCAGAAGCCTCTAGAAGAATGTGAAGATGATGAATTGCCCTCTGGATGGGAGAAAATTGAAGACCCTGTGTATGGAGTCTACTATGTAGATCATATAAACAAGAAAACGCAATATGAAAACCCCGTATTGGAAGCCAAAAGAAAGAAACAGCTCGGACTGCAGCAAAGTGAAGAATGGACAGGGGATCATCCACCCATTGCTCCACCCCCTCTTGTGCTTCCAAACAACTTTACGCTAAAAAAGAAACAACCAGCAACTGCGGCACGTGCAAAACCATTCTTCACCAGAAACCCTTCTGAACTGAAAGGAAAGTTCATCAATACAAAGCTAAGGAAGAGCAGTCGAGGCTTTGGCTTTACTGTTGTCGGAGGGGACGAGCCAGATGAATTTTTGCAAATAAAGAGTTTGGTCGTCGATGGCCCGGCCGCATTGGATGGCAAAATGGAAACGGGCGACGTTATCGTAAGTGTGAATGATATCTGTGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGTGAAAATGTGAACCTTGAACTATGCCGGGGTTATCCTCTTCCATTTGACCCAGATGACCCCAACACCAGCCTTGTGACGTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGCCCTGGTGGTGGGGGCCAGAGGGTGAAGCAGATTGTAGACAGTCCAAGATGCCGTGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCTG
  5   1   2       bld Emb1 5g                         IMAGE:6635215.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCTTCCATTCCCCACTAGCCGGGCTCTGAATACACCACATTGGCTCAGCTCTCTCAATGGCCAAGTGGACTTCTTTGCTGTGAGGCTtgatgatgatgatgatgaGGAGGAGGAGGGGAAGCAGCTGCTGGTATAAGTGCTCAGTCTCCTGCGTGTAGATCGCTGCCCTTGCTCCATGGCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTtgatgatgatgatgatgCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAAGCCTTGGACCTCTACCCTGAAAACTGGGGAAATGGCCTTTTACAGAAGAATGGGAGAAAGTCTATTTTTATAGGACCCACAACCACCTAAAACCAACATTCTTGGGCTTAGACCCT
  5   1   2       bld Ga18 5g                           xlk146a05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCACATTGGCTCANNTCTCTCAATGGCCAAGTGGACTTCTTTGCTGTGAGGNTtgatgatgatgatgatgaGGAGGAGGAGGGGAAGCAGCTNCTGGTATAAGTGCTCAGTCTCCTGCGTGTAGATCGCTGCCCTTGCTCCATGGCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTTTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTtgatgatgatgatgatgCTCCTGAAANGAGCAGTAGNTTTACAGGAGANTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGNCCCACCGGCGGCTTGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAANCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAACTGGGAAANGGCCTTTACAGAGAANGGAGAAGNCTATTTNNAGAGTAANTTATTTNATTT
  5   1   2       bld Neu7      in                         XL034o02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACTTCTTTGCTGTGAGGCTtgatgatgatgatgatgaGGAGGAGGAGGGGAAGCAGCTGCTGGTATAAGTGCTCAGTCTCCTGCATGTAGATCGCTGCCCTTGCTCCATGGCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTtgatgatgatgatgatgCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACT
  5   1   2       bld Tbd7 5g3  in                         XL102o11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGGTAGATCGCTGCCCTTGCTCCTGGCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTTTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTtgatgatgatgatgatgCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAAGCAGCAG
  5   1   2      seed Oo1  5g                         IMAGE:5078836.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTtgatgatgatgatgatgCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAACACTCGACTAACCTTTCTCAAGATAAAGTTCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAAGCAGCAGAAGCCTCTAGAAGAATGTGAAGATGATGAAGGGGTACACACCNGAGGAGCTGGACAGTGAAACTAGAATTGCCCTCTGGATGGGAGAAAATTTGAAGACCCTGTGAATGGAGTCTACTATGTAGATCCTATAAACCAGAAAAACGCAATATGAAAAACCCCGTATTGGAAGCCAAAAGGAAAGAAACAGCTCCGGACTTGCACCAAAGGGAAGAATTGGACCGGGGGATTCATCCCCCCATTGGCTCCAACCCCCTCTTGGGGC
  5   1   2       bld Ov1                    IMAGE:5073802-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCCCGGGGGGATGGATTGATAGCTGCCTTGAAATCGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTAGAGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAATGAGCAGAAGCCTCTAGAAGAATGTGAAGATGATGAATTGCCCTCTGGATGGGAGAAAATTGAAGACCCTGTGTATGGAGTCTACTATGTAGATCATATAAACAAGAAAACGCAATATGAAAACCCCGTATTGGAAGCCAAAAGAAAGAAACAGCTCGGACTGCAGCAAAGTGAAGAATGGACAGGGGATCATCCACCCATTGCTCCACCCCCTCTTGTGCTTCCAAACAACTTTACGCTAAAAAAGAAACAACCAGCAACTGCGGCACGTGCAAAACCATTCTTCACCAGAAACCCTTCTGAACTGAAAGGAAAGTTCATCAATACAAAGCTAAGGAAGAGCAGTCGAGGCTTTGGCTTTTACTGTTGTCGGAGGGGACGAGCCAGAT
  5   1   2       bld Ov1       in                    IMAGE:5073802.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACCCACGCGTCCGGATGATGATGCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAAGCAGCAGAAGCCTCTAGAAGAATGTGAAGATGATGAATTGCCCTCTGGATGGGAGAAAATTGAAGACCCTGTGTATGGAGTCTACTATGTAGATCATATAAACAAGAAAACGCAATATGAAAACCCCGTATTGGAAGCCAAAAGAAAGAAACAGCTCGGACTGCAGCAAAGTGAAGAATGGACAGGGGATCATCCACCCATTGCTCCACCCCCTCTTGTGCTTCCAAACAACTTTACGCTAAAAAAGAAACAACCAGCAACTGCGGCACGTGCAAAACCATTCTTCACCAGAAACCCTTCTGAACTGAAAGG
  5   1   2      skin Ga12      out                        XL141c05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAACCCTTCTGAACTGAAAGGAAAGTTCATCAATACAAAGCTAAGGAAGAGCAGTCGAGGCTTTGGCTTTACTGTTGTCGGAGGGGACGAGCCAGATGAATTTTTGCAAATAAAGAGTTTGGTCGTCGATGGCCCGGCCGCATTGGATGGCAAAATGGAAACGGGCGACGTTATCGTAAGTGTGAATGATATCTGTGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGTGAAAATGTGAACCTTGAACTATGCCGGGGTTATCCTCTTCCATTTGACCCAGATGACCCCAACACCAGCCTTGTGACGTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGCCCTGGTGGTGGGGGCCAGAGGGTGAAGCAGATTGTAGACAGTCCAA
  5   1   2      skin Ooc2                            IMAGE:3747166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAATTCCGCCGCATTGGATGGCAAAATGGAAACGGGCGACGTTATCGTAAGTGTGAATGATATCTGTGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGTGAAAATGTGAACCTTGAACTATGCCGGGGTTATCCTCTTCCATTTGACCCAGATGACCCCAACACCAGCCTTGTGACGTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCATCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACTCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGCCCTTGGTGGTGGGGCCAGAGGGTGAAGCAGATTGTAGACAGTCCAAGATGCTCTTGCCTCAAAGAACGAGATCTTATAGTAAACGTGAATAAAAAGAAG
  5   1   2      skin Ooc2                            IMAGE:3746807.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGCAAAATGGAAACGGGCGACGTTATCGTAAGTGTGAATGATATCTGTGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGTGAAAATGTGAACCTTGAACTATGCCGGGGTTATCCTCTTCCATTTGACCCAGATGACCCCAACACCAGCCTTGTGACGTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAATGACCAATGGGATTTGGCTATACCATAGCAGACATCCCTGGTGGTGGGGGCCACAAGGTGAAGCAGATTGTAGACAGTTCAAGATGCCGTAGCCTCAAAGTACGAGATCTTATAGTTCAGGTGAATAAAAAGAATGGTCTGACCTTA
  5   1   2       bld DMZ       out                        xl262h15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGCCCTGGTGGTGGGGGCCAGAGGGTGAAGCAGATTGTAGACAGTCCAAGATGCCGTGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCTGAACCTTACCCATAATCAAGTTGTGGATTTACTCATCGAATGTCCTAAGGGAAGTGAAGTCACCCTACTGGTTCAGAGAGGAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAACCACTTGAAAGGAAAGACAGCCAAAATAGCTCGCAGCACAGTGTTTCCAGCCAGCACAGTGGGCACACGGCTTCACCCCTTCACGTCGCGCCTGTGCTCCCCGATTATCCTACTGGCGAGGTGCCCACTCTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCTGATCCATTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACT
  5   1   2      ests                            Xl3.1-IMAGE:5073802.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCACAGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACCAATGCAGAGAAGATCGCCACAATTACGACCACACATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCGAAACCAAAGCCGGAACCCCAATTTGAGTTTAAGAACGCACCGGTCATCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGGAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCAT
                                                  Xl3.1-CHK-1012698819                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACCAATGCAGAGAAGATCGCCACAATTACGACCACACATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCGAAACCAAAGCCGGAACCCCAATTTGAGTTTAAGAACGCACCGGxCAxCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGGAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCATTGGAGT
  5   1   2      skin Tbd7      out                        XL070o04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATAGTAAAAGGACCATGGGATTTGGCTTTACCATAGCAGACAGTCCAGGTGGCGGGGGCCAGAGAGTGAAGCAAATTGTAGACAGTCCAAGATGCCGTGGCCTCAAAGAAGGAGATCTCATCGTTGAGGTGAATAAAAAGAATGTTCAGAACCTTACCCATAATCAAGTTGTGGATTTACTCATCGAATGTCCAAAGGGAAGTGAAGTCACCCTACTGGTTCAAAGAGGAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAGCCACTTGAAAGGAAAGACAGCCAAAATAGCTCGCAGCACAGTGTTTCCAGCCAGCACAGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGAT
  5   1   2      skin Ov1                             IMAGE:8332626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCACAGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGNATTTGTATGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGAC
  5   1   2      skin Ga12                                 XL194f22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACC
  5   1   2       bld Ov1       out                   IMAGE:8329613.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGCCGGCAATGCATGTGTGGCCATGCCTCACAAAATAGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACCAATGCAGAGAAGATCGCCACAATTACGACCACACATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCGAAACCAAAGCCGGAACCCCAATTTGAGTTTAAGAACGCACCGGCCACCCAGCCGGAGCAAGACCTTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTCGGGTTTAGTCTACGAGGAGGTCGGGAATATAACATGGATCTCTACGTTTTACGTTTAGCAGAAGACGGACCTGCTGCCAAATGTGGGAAAATGAGGGTCGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAACTGATTAAAAATGGCGGCCG
  3   1   2      seed Neu7      in                         XL034o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATGCAGAGAAGATCGCCACAATCACGACCACACACACGCCACAGACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAACCCCAATTCGAATTTAAGAACGCACCAGTCATCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGAATGATGAGGAATGGTCAACGTAGCATCATTGGAGTCTAAAAAAACAAAAAAAAGCAAAAGCAAAAACTTGATCCTTTTGTTAAAACTATACTGCATTGAACTGTGCCAAACCATTTTTCATTATTTTGTATTAAAAAGTCAAACTAAGGAACCACCAACTTATTAAAACC
  3   1   2       bld Ov1       in                    IMAGE:5073802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCATCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACTTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATTCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGGAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCATTGGAGTCTAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd7 5g3  in                         XL102o11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTAAAAGGATTNGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATNTATACGTTTTACGCCTAGCAGAANATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTNTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGNAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCATTGGAGTCTAAAAAACAAAAAAAAGCnAAAGCAAAAACTTGATCCTNANGTTAAAACTATACTGCATTGNAGGCTGTGCCAAACC
  5   1   2       bld Eye1                            IMAGE:6946160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGCTGGACCGGTCCGGATTCCCGGGATGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGCGATGATTCCTCCTAATATCACTGCATGTATGAGAAATGACAAGCTCGGGGAACCTTGCTTCTACCTAATGGGCCAAAATCAAACTACGAACCCAGCGGTGACGGAAACAGCCCCACAACCAGTCCACAAAATGTACCGAAAATGAACTCGTTAACATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCAGATCTTCACAAATCATTACAGCATGGAGACAAACAAACTTATGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCCCATAATGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAATGATCGATCACCTGAGGGGTAGACGACCAAAGCAGACGGATCGAACAATGGTGAATGGTCAGAAAAGACAGTCTCCTGAGAAGAGAAAATGAAGAACACGGAGTGCTGAAAACACATTggagaggagagagagaAATGACCGAAGAAAAGAGGCTTCTCCTCAAAAGCCTAGGGAAAGATCACCCATGCGCAGAAGGGATGGTTCCCCCAACCAGGAAGAAGAAAATCCTTGGATAGATTTTATGGAATCAAAGAAAGATCACCCTGATTGAAAGAAGAGGAGAGTTTCACCTGGACGAAAAAAGAGCAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)