Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL437l23ex.3                         15 END     2          10       13                (no blast hit)
     2   2.0    0Xl3.1-xl271b09.3                            7 END     2          10       28                (no blast hit)

 This cluster: approximate FL confidence score = 99%

 1012838963 Xl3.1-xlk146a05ex.5.5 - 19 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     7     6     7     6     7     6     7     6     7     5     6     5     6     4     6     5     6     6     6     6     6     5     6     5     6     5     6     5     6     4     6     4     6     3     6     3     6     3     6     3     6     3     5     3     5     3     5     3     4     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     3     3     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     1     1     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     4     5     4     5     4     5     5     5     4     4     3     4     2     4     2     4     4     4     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     5     4     5     4     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3
  5   1   2      ests                            Xl3.1-IMAGE:5073802.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCACAGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACCAATGCAGAGAAGATCGCCACAATTACGACCACACATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCGAAACCAAAGCCGGAACCCCAATTTGAGTTTAAGAACGCACCGGTCATCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGGAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCAT
                                               BLH MIN     195     320                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     447     337                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     447     265                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 3e-008     NP_001027610.1 tyrosine phosphatase [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 3e-088     XP_001179535.1 PREDICTED: similar to MAGI-1 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 1e-095     NP_611551.1 CG30388-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 2e-098     XP_554297.3 AGAP010754-PA [Anopheles gambiae str. PEST] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 5e-102     NP_502219.2 K01A6.2 [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 0          A1A5G4.1 Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 3 (Membrane-associated guanylate kinase inverted 3) (MAGI-3) [Xenopus tropicalis]  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Bt ---- 0          XP_001251034.1 PREDICTED: similar to membrane-associated guanylate kinase-related 3 (MAGI-3) isoform 1 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Gg ---- 0          XP_415974.2 PREDICTED: similar to membrane associated guanylate kinase, WW and PDZ domain containing 2 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dr ---- 0          NP_001007064.1 BAI1-associated protein 1 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 0          XP_533770.2 PREDICTED: similar to Membrane associated guanylate kinase, WW and PDZ domain containing protein 1 (BAI1-associated protein 1) (BAP-1) (Membrane associated guanylate kinase inverted-1) (MAGI-1) (Atrophin-1 interacting protein 3) (AIP3) (WW domain-containin [Canis familiaris]  -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ---- 0          NP_001025021.1 membrane associated guanylate kinase, WW and PDZ domain containing 1 isoform c [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 0          NP_004733.2 membrane associated guanylate kinase, WW and PDZ domain containing 1 isoform b [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - ?? ---- 0          XP_001789410.1 PREDICTED: similar to membrane associated guanylate kinase, WW and PDZ domain containing 1 isoform 1 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          AAI66055.1 Unknown (protein for IMAGE:5078836) [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-xlk146a05ex.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGATGATGATGATGATGA---------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------TGAATG---------------------------------------------------------TAA---------------------------------TGA---------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2       bld Neu7      in                         XL034o02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACTTCTTTGCTGTGAGGCTtgatgatgatgatgatgaGGAGGAGGAGGGGAAGCAGCTGCTGGTATAAGTGCTCAGTCTCCTGCATGTAGATCGCTGCCCTTGCTCCATGGCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTtgatgatgatgatgatgCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACT
  5   1   2       bld Tbd7 5g3  in                         XL102o11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGGTAGATCGCTGCCCTTGCTCCTGGCTGGATATACAGAATATTTTGGATATTTCTAAGGATCGGACTGCTTGGGAAGCATTGAAGTTTGGCTGCAGAAGGCACCACCCGATCACCTAGAGAAGGAGAGGTACCGGGAGTGGACTATAAATTTTTGACTGTGCAGGAGTTTCTAGAACTTGAAAAAAGTGGAACATTACTTGAAGTTGGCACGTTTGAAGGTAACTATTATGGGACGCCCAAGCCTCCGAGCCAGCCCACCGGTGGGAAAGTGATTCCCAGGGATGCTCTGCAAAATCCTCCGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCTCAGCGACCACTATGAGTTtgatgatgatgatgatgCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAAGCAGCAG
  5   1   2       bld Ov1                    IMAGE:5073802-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCCCGGGGGGATGGATTGATAGCTGCCTTGAAATCGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTAGAGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAATGAGCAGAAGCCTCTAGAAGAATGTGAAGATGATGAATTGCCCTCTGGATGGGAGAAAATTGAAGACCCTGTGTATGGAGTCTACTATGTAGATCATATAAACAAGAAAACGCAATATGAAAACCCCGTATTGGAAGCCAAAAGAAAGAAACAGCTCGGACTGCAGCAAAGTGAAGAATGGACAGGGGATCATCCACCCATTGCTCCACCCCCTCTTGTGCTTCCAAACAACTTTACGCTAAAAAAGAAACAACCAGCAACTGCGGCACGTGCAAAACCATTCTTCACCAGAAACCCTTCTGAACTGAAAGGAAAGTTCATCAATACAAAGCTAAGGAAGAGCAGTCGAGGCTTTGGCTTTTACTGTTGTCGGAGGGGACGAGCCAGAT
  5   1   2       bld Ov1       in                    IMAGE:5073802.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACCCACGCGTCCGGATGATGATGCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACTCGACTAACCTTTCTCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCGGAATCTGCCTCTTTACCTACCTCCTTCTGACGAGGGAAGCCTTGGACCTCTACCTGAAAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCACAACACTAAAACAACATCTTGGCTAGACCCCCGGTGCCTGAACAAGCAGCAGAAGCCTCTAGAAGAATGTGAAGATGATGAATTGCCCTCTGGATGGGAGAAAATTGAAGACCCTGTGTATGGAGTCTACTATGTAGATCATATAAACAAGAAAACGCAATATGAAAACCCCGTATTGGAAGCCAAAAGAAAGAAACAGCTCGGACTGCAGCAAAGTGAAGAATGGACAGGGGATCATCCACCCATTGCTCCACCCCCTCTTGTGCTTCCAAACAACTTTACGCTAAAAAAGAAACAACCAGCAACTGCGGCACGTGCAAAACCATTCTTCACCAGAAACCCTTCTGAACTGAAAGG
  5   1   2      skin Ga12      out                        XL141c05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAACCCTTCTGAACTGAAAGGAAAGTTCATCAATACAAAGCTAAGGAAGAGCAGTCGAGGCTTTGGCTTTACTGTTGTCGGAGGGGACGAGCCAGATGAATTTTTGCAAATAAAGAGTTTGGTCGTCGATGGCCCGGCCGCATTGGATGGCAAAATGGAAACGGGCGACGTTATCGTAAGTGTGAATGATATCTGTGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGTGAAAATGTGAACCTTGAACTATGCCGGGGTTATCCTCTTCCATTTGACCCAGATGACCCCAACACCAGCCTTGTGACGTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGCCCTGGTGGTGGGGGCCAGAGGGTGAAGCAGATTGTAGACAGTCCAA
  5   1   2      skin Ooc2                            IMAGE:3747166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAATTCCGCCGCATTGGATGGCAAAATGGAAACGGGCGACGTTATCGTAAGTGTGAATGATATCTGTGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGTGAAAATGTGAACCTTGAACTATGCCGGGGTTATCCTCTTCCATTTGACCCAGATGACCCCAACACCAGCCTTGTGACGTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCATCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACTCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGCCCTTGGTGGTGGGGCCAGAGGGTGAAGCAGATTGTAGACAGTCCAAGATGCTCTTGCCTCAAAGAACGAGATCTTATAGTAAACGTGAATAAAAAGAAG
  5   1   2      skin Ooc2                            IMAGE:3746807.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGCAAAATGGAAACGGGCGACGTTATCGTAAGTGTGAATGATATCTGTGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGTGAAAATGTGAACCTTGAACTATGCCGGGGTTATCCTCTTCCATTTGACCCAGATGACCCCAACACCAGCCTTGTGACGTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAATGACCAATGGGATTTGGCTATACCATAGCAGACATCCCTGGTGGTGGGGGCCACAAGGTGAAGCAGATTGTAGACAGTTCAAGATGCCGTAGCCTCAAAGTACGAGATCTTATAGTTCAGGTGAATAAAAAGAATGGTCTGACCTTA
  5   1   2       bld DMZ       out                        xl262h15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCAGTCGCAATATTGGACAAAGACCCCATCATTGTCAATGGGCAAGAGAATTATGACTCTCCATCAAGCAACAACAGTAAAACTAGAAAAGCCAATAACATAATGGATCCGAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGCCCTGGTGGTGGGGGCCAGAGGGTGAAGCAGATTGTAGACAGTCCAAGATGCCGTGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCTGAACCTTACCCATAATCAAGTTGTGGATTTACTCATCGAATGTCCTAAGGGAAGTGAAGTCACCCTACTGGTTCAGAGAGGAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAACCACTTGAAAGGAAAGACAGCCAAAATAGCTCGCAGCACAGTGTTTCCAGCCAGCACAGTGGGCACACGGCTTCACCCCTTCACGTCGCGCCTGTGCTCCCCGATTATCCTACTGGCGAGGTGCCCACTCTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCTGATCCATTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACT
  5   1   2      ests                            Xl3.1-IMAGE:5073802.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCACAGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACCAATGCAGAGAAGATCGCCACAATTACGACCACACATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCGAAACCAAAGCCGGAACCCCAATTTGAGTTTAAGAACGCACCGGTCATCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGGAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCAT
                                                  Xl3.1-CHK-1012698819                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACCAATGCAGAGAAGATCGCCACAATTACGACCACACATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCGAAACCAAAGCCGGAACCCCAATTTGAGTTTAAGAACGCACCGGxCAxCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGGAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCATTGGAGT
  5   1   2      skin Tbd7      out                        XL070o04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATAGTAAAAGGACCATGGGATTTGGCTTTACCATAGCAGACAGTCCAGGTGGCGGGGGCCAGAGAGTGAAGCAAATTGTAGACAGTCCAAGATGCCGTGGCCTCAAAGAAGGAGATCTCATCGTTGAGGTGAATAAAAAGAATGTTCAGAACCTTACCCATAATCAAGTTGTGGATTTACTCATCGAATGTCCAAAGGGAAGTGAAGTCACCCTACTGGTTCAAAGAGGAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAGCCACTTGAAAGGAAAGACAGCCAAAATAGCTCGCAGCACAGTGTTTCCAGCCAGCACAGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGAT
  5   1   2      skin Ov1                             IMAGE:8332626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCACAGTGGGCACACAGCTTCACCCCTCCACGTCGTGCCTGTGCTCCCCGATTATCCTACCGGCGAGGTGCCTGCTGTAGACCAAGCTGATAACTCTGGGCAGAAAAAGCCGGATCCTTTTAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTTGGTGGAAATGAGCCTGGAGAACCAATCTACATAGGTCACATTGTGCCAGTGGGTTCAGCAGATGCCGACGGGAGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGNATTTGTATGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGAC
  5   1   2      skin Ga12                                 XL194f22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGTTGCGTTCTGGCGATGAGCTTATCTGCGTAGATGGAACAGCGGTTGTTGGAAAATCTCACCAACTTGTTGTGCAGCTTATGCAACAGGCAGCAAAGCAAGGCCACGTCAATTTAACTATCAGACGCAAAACCATCTATCCAGTTCCAAAGGCAGAGAATGAAACTCCTGCTTCACCAGCATCATCGCACCATAGCAGTACCCAGCCAGCCTCTCTAACGGAGGAGAAACGGACGCCACAAGGCAGCCAAAACTCCTTAAACACTGTTAGTTCAGGCAGCGGCAGCACCAGCGGGATTGGCAGCGGCGGTGGCGGTGGGAGTGGAAATGTCAGCACTGTGGTTCAGCCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACC
  5   1   2       bld Ov1       out                   IMAGE:8329613.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTTACGACGTTGAGATCCGGCGCGGTGAAAATGAAGGATTTGGATTTGTTATTGTGTCTTCGGTCAGCCGGCCAGAAGCAGGGACAACTTTCGCCGGCAATGCATGTGTGGCCATGCCTCACAAAATAGGTCGGATAATAGAGGGGAGCCCCGCAGATCGTTGTGGCAAGCTAAAGGTGGGGGACCGGATCCTGGCGGTTAATGGATGCTCGATCACCAACAAGTCGCACTCGGACATCGTCAATTTAATAAAGGAAGCGGGAAACACCGTGACTCTGCGCATCATTCCTGGCGATGAATCTTCCAACGCAACGTTATTAACCAATGCAGAGAAGATCGCCACAATTACGACCACACATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCGAAACCAAAGCCGGAACCCCAATTTGAGTTTAAGAACGCACCGGCCACCCAGCCGGAGCAAGACCTTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTCGGGTTTAGTCTACGAGGAGGTCGGGAATATAACATGGATCTCTACGTTTTACGTTTAGCAGAAGACGGACCTGCTGCCAAATGTGGGAAAATGAGGGTCGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAACTGATTAAAAATGGCGGCCG
  3   1   2      seed Neu7      in                         XL034o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATGCAGAGAAGATCGCCACAATCACGACCACACACACGCCACAGACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAACCCCAATTCGAATTTAAGAACGCACCAGTCATCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGAATGATGAGGAATGGTCAACGTAGCATCATTGGAGTCTAAAAAAACAAAAAAAAGCAAAAGCAAAAACTTGATCCTTTTGTTAAAACTATACTGCATTGAACTGTGCCAAACCATTTTTCATTATTTTGTATTAAAAAGTCAAACTAAGGAACCACCAACTTATTAAAACC
  3   1   2       bld Ov1       in                    IMAGE:5073802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCATCCAGCCGGAGCAAGACATTTATTCAGTGGAACTAGACAGAGGATTAAAAGGATTCGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACTTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATTCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGGAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCATTGGAGTCTAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd7 5g3  in                         XL102o11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTAAAAGGATTNGGGTTCAGTCTACGAGGAGGTCGGGAGTATAACATGGATNTATACGTTTTACGCCTAGCAGAANATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTNTGAAACGTGGAGATGGTTCTGTACCGGAATATGGTGGGTCAAACATTGAAAACATTCCTTTGCTTCCTGCCATCTCTCCATGAATGATCTCTCTTTCTCAAGATCTGGAGCAGNAAATCTTTTACTTTCTCCCCTTTCTCTTATAATCACCAGTGTCTTACCAACTTTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTTCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCATTGGAGTCTAAAAAACAAAAAAAAGCnAAAGCAAAAACTTGATCCTNANGTTAAAACTATACTGCATTGNAGGCTGTGCCAAACC
  5   1   2       bld Eye1                            IMAGE:6946160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGCTGGACCGGTCCGGATTCCCGGGATGGGAGTATAACATGGATCTCTACGTTTTACGCCTAGCAGAAGATGGACCTGCTGCCAAATGTGGAAAAATTAGGGTTGGCGATGAAATCCTGGAAATAAATGGAGAGACCACAAAGAACATGAAGCATGCTCGGGCAATAGAAATGATAAAAAATGGCGGCCGAAGAGTACGTCTGTGTCTGAAACGTGGAGATGGTTCTGTACCGGAATATGCGATGATTCCTCCTAATATCACTGCATGTATGAGAAATGACAAGCTCGGGGAACCTTGCTTCTACCTAATGGGCCAAAATCAAACTACGAACCCAGCGGTGACGGAAACAGCCCCACAACCAGTCCACAAAATGTACCGAAAATGAACTCGTTAACATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCAGATCTTCACAAATCATTACAGCATGGAGACAAACAAACTTATGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCCCATAATGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAATGATCGATCACCTGAGGGGTAGACGACCAAAGCAGACGGATCGAACAATGGTGAATGGTCAGAAAAGACAGTCTCCTGAGAAGAGAAAATGAAGAACACGGAGTGCTGAAAACACATTggagaggagagagagaAATGACCGAAGAAAAGAGGCTTCTCCTCAAAAGCCTAGGGAAAGATCACCCATGCGCAGAAGGGATGGTTCCCCCAACCAGGAAGAAGAAAATCCTTGGATAGATTTTATGGAATCAAAGAAAGATCACCCTGATTGAAAGAAGAGGAGAGTTTCACCTGGACGAAAAAAGAGCAA

In case of problems mail me! (