Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl263o15.3                            6 PI      86       1058     1543                hypothetical protein LOC414529 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012838965 Xl3.1-xlk66k08ex.3.5 - 13 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-xlk66k08ex.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGATCTTGCACAGACAGTATTAAGCCCCCTTATCATAAAGGACGCACTAGATTTCCTCAACTTCATCCTTAATAAAGAGGAGAAACAACTCTGGACGTCGTTAGGTGATGCATGGAACAAATCCAGAGCAGAATGGCAAAAAGAGCAGTTTATTCCCCCATATATTCCGCGCTTCAGGAATGGCTGGGAGCCCCCTCTTCTGAACTGTGCTGGGGTGCCAAAGGAACAGGAACTATCTCTTCTGGCTGAGTCTGTGGCAAACGTTACAGAGTTTCAGCAGAAACAAGATTTCAACAGTGTGCCAATTGTGTTTTCCAATGTGTCCCGTTATCCATCGTCAGAGGGGAATGTGTATAGCTGCGGCCAATCAGAGCCCCAGAAATACGCCACGTGCAAGTACGACTTTGTAGCTCGCAACACTAATGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCATCGATGATAAGAAGCAGTGGTGGAAAGTTCGGAACGGAGGTGGGGCAGTTGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAGGCCTCAAGATCACTCTGCAAAGNCAATGGAAGCAGTGTACACTCAAACAATCCAGAAACAGAAGTCCAACTTTATACAAAACCAAGCAGGTCCAATTCCAGAGGCTCCCTCTCCACCACCAAGTCCAGCACCAACATATTCCCCTTTAGTCCCTACTCAGCGCCATCACTGCCCGTGGCTAAGCTCTTTACTGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGGACGTAGTGCGGCACAGAAGAAATTTACTGTGCCGCGGCAAAGCACACTGGCCGTCCATATTTCTTACAATTCACCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAGGGATTCAATTCAGTAACTGTCGACAGCCTTGGGGTGCTCACAGGAGCCCAGCTTTTCTCTCTCACTAAAGATGAACTGAAGACTGTGTGTCCGGAAGGCTCAAGGGTGTATAACCAAGTTACAGTACAGAAGGCTGCTATTGAGGAACAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGGCAGGAACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTGGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACCTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGTTTGTATTATTATTAATAACCAGATGTTATTTAAATCCTTTGTGGAACTGATGCCAATTTATTTAAGGATGAGCTTGTCGTGTGGCAGGTGGACTTGGATAATGTAGGGGCAAATCGCTGCTGCTAGAGAGAGAGAGAGATGGGGGGACCCTTGTACTTACACTCAGGGGCTGGTATGTTCAGCACAATGACCTGCTCTGTGTTTGCACCTTTCCTCTAGCAGAGCCAGCGGCCCCCCTATAGTGGCATGTCGTGTGTAAATAGGAACATTATCAGTATTTGCCATGCTGTCCCGTGTAACAGG
                                                  Xl3.1-CHK-1012722132                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGCACAGACAGTATTAAGCCCCCTTATCATAAAGGACGCACTAGATTTCCTCAACTTCATCCTTAATAAAGAGGAGAAACAACTCTGGACGTCGTTAGGTGATGCATGGAACAAATCCAGAGCAGAATGGCAAAAAGAGCAGTTTATTCCCCCATATATTCCGCGCTTCAGGAATGGCTGGGAGCCCCCTCTTCTGAACTGTGCTGGGGTGCCAAAGGAACAGGAACTATCTCTTCTGGCTGAGTCTGTGGCAAACGTTACAGAGTTTCAGCAGAAACAAGATTTCAACAGTGTGCCAATTGTGTTTTCCAATGTGTCCCGTTATCCATCGTCAGAGGGGAATGTGTAxxxxTGCGGCCAATCAGAGCCCCAGAAATACGCCACGTGCAAGTACGACTTTGTAGCTCGCAACACTAATGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCATCGATGATAAGAAGCAGTGGTGGAAAGTTCGGAACGGAGGTGGGGCAGTTGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAGGCCTCAAGATCACTCTGCAAAGNCAATGGAAGCAGTGTACACTCAAACAATCCAGAAACAGAAGTCCAACTTTATACAAAACCAAGCAGGTCCAATTCCAGAGGCTCCCTCTCCACCACCAAGTCCAGCACCAACATATTCCCCTTTAGTCCCTAxxxxxCGCCATCACTGCCCGTGGCTAAGCTCTTTACTGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGGACGTAGTGCGGCACAGAAGAAATTTACTGTGCCGCGGCAAAGCACACTGGCCGTCCATATTTCTTACAATTCACCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAGGGATTCAATTCAGTAACTGTCGACAGCCTTGGGGTGCTCACAGGAGCCCAGCTTTTCTCTCTCACTAAAGATGAACTGAAGACTGTGTGTCCGGAAGGCTCAAGGGTGTATAACCAAGTTACAGTACAGAAGGCTGCTATTGAGGAACAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGGCAGGAACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTGGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACCTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGTTTGTATTATTATTAATAACCAGATGTTATTTAAATCCTTTGTGGAACTGATGCCAATTTATTTAAGGATGAGCTTGTCGTGTGGCAGGTGGACTTGGATAATGTAGGGGCAAATCGCTGCTGCTAGAGAGAGAGAGAGATGGGGGGACCCTTGTACTTACACTCAGGGGCTGGTATGTTCAGCACAATGACCTGCTCTGTGTTTGCACCTTTCCTCTAGCAGAGCCAGCGGCCCCCCTATAGTGGCATGTCGTGTGTAAATAGGAACATTATCAGTATTTGCCATGCTGTCCCGTGTAACAGGCTTTGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     3     2     4     2     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     6     4     6     3     6     3     6     4     6     3     6     2     6     5     6     2     6     4     6     6     6     4     7     6     8     4     7     5     7     4     7     5     7     5     7     4     7     5     7     4     7     5     7     4     7     4     7     5     7     5     7     5     7     4     7     4     7     4     7     4     7     5     8     5     8     6     8     6     8     6     8     6     8     5     8     6     9     6     9     6     8     6     8     6     8     7     8     7     8     7     8     7     8     6     7     6     7     5     7     5     7     5     7     6     8     5     7     5     7     6     7     6     7     5     7     5     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     3     6     2     6     2     6     2     6     2     6     2     6     2     6
  5   1   2       e50                               Xl3.1-xlk68p13ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCACATGATGGTAGAGGCCACAGGGGGCCCTGATCTTGCACAGACAGTATTAAGCCCCCTTATCATAAAGGACGCACTAGATTTCCTCAACTTCATCCTTAATAAAGAGGAGAAACAACTCTGGACGTCGTTAGGTGATGCATGGAACAAATCCAGAGCAGAATGGCAAAAAGAGCAGTTTATTCCCCCATATATTCCGCGCTTCAGGAATGGCTGGGAGCCCCCTCTTCTGAACTGTGCTGGGGTGCCAAAGGAACAGGAACTATCTCTTCTGGCTGAGTCTGTGGCAAACGTTACAGAGTTTCAGCAGAAACAAGATTTCAACAGTGTGCCAATTGTGTTTTCCAATGTGTCCCGTTATCCATCGTCAGAGGGGAATGTGTAGGAGTGCGGCCAATCAGAGCCCCAGAAATACGCCACGTGCAAGTACGACTTTGTAGCTCGCAACACTAATGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCATCGATGATAAGAAGCAGTGGTGGAAAGTTCGGAACGGAGGTGGGGCAGTTGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAGGCCTCAAGATCACTCTGCAAAGNCAATGGAAGCAGTGTACACTCAAACAATCCAGAAACAGAAGTCCAACTTTATACAAAACCAAGCAGGTCCAATTCCAGAGGCTCCCTCTCCACCACCAAGTCCAGCACCAACATATTCCCCTTTAGTCCCTACTCAGCCGCCAT------------------------TGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGG------------ACAGAAGAAATT------------------------GGCCGTCCATATTTCTTACAANTCACCNGCAGAGGA
  5   1   2       e50                               Xl3.1-xlk66k08ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTACTCAGCCGCCATCACTGCCCGTGGCTAAGCTCTTTACTGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGGACGTAGTGCGGCACAGAAGAAATTTACTGTGCCGCGGCAAAGCACACTGGCCGTCCATATTTCTTACAATTCACCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAGGGATTCAATTCAGTAACTGTCGACAGCCTTGGGGTGCTCACAGGAGCCCAGCTTTTCTCTCTCACTAAAGATGAACTGAAGACTGTGTGTCCGGAAGGCTCAAGGGTGTATAACCAAGTTACAGTACAGAAGGCTGCTATTGAGGAACAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGGCAGGAACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTGGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACCTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGTTTGTATTATTATTAATAACCAGATGTTATTTAAATCCTTTGTGGAACTGATGCCAATTTATTTAAGGATGAGCTTGTCGTGTGGCAGGTGGACTTGGATAATGTAGGGGCAAATCGCTGCTGCTAGAGAGAGAGAGAGATGGGGGGACCCTTGTACTTACACTCAGGGGCTGGTATGTTCAGCACAATGACCTGCTCTGTGTTTGCACCTTTCCTCTAGCAGAGCCAGCGGCCCCCCTATAGTGGCATGTCGTGTGTAAATAGGAACATTATCAGTATTTGCCATGCTGTCCCGTGTAACAGGCT
                                               BLH MIN     796      11                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ce ---- 3e-009     NP_502803.3 EPS (human endocytosis) related family member (eps-8) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-011     XP_001190240.1 PREDICTED: similar to Eps8, partial [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 3e-033     XP_871592.3 PREDICTED: EPS8-like 2 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 3e-099     NP_956536.1 similar to epidermal growth factor receptor pathway substrate 8 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 2e-136     XP_416405.2 PREDICTED: similar to Epidermal growth factor receptor pathway substrate 8 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 7e-136     NP_031971.2 epidermal growth factor receptor pathway substrate 8 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-139     NP_004438.3 epidermal growth factor receptor pathway substrate 8 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 4e-142     XP_866670.1 PREDICTED: similar to Epidermal growth factor receptor kinase substrate EPS8 isoform 2 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 2e-109     NP_001072508.1 epidermal growth factor receptor pathway substrate 8 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 1e-129     NP_001084577.1 hypothetical protein LOC414529 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xl3.1-xlk66k08ex.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---TAA------------------------------------------------------------------------------------------------------ATGTGA---------------------------------TAA------------------------------------------------------ATG---TGA------------------------------------------------------------------------------------------ATG------TGA------------------TAA------------------------------------ATG---------------------------------------------------------------------------------------------------------------TGA---------------------------TGA---ATG------------------------------------TAATGA------------ATG---TGA---------------------------------------------------------------TGA------------TAA---TGA---------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------TAG------------------TAG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                           ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                       ...
  5   1   2       e50                               Xl3.1-xlk68p13ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCACATGATGGTAGAGGCCACAGGGGGCCCTGATCTTGCACAGACAGTATTAAGCCCCCTTATCATAAAGGACGCACTAGATTTCCTCAACTTCATCCTTAATAAAGAGGAGAAACAACTCTGGACGTCGTTAGGTGATGCATGGAACAAATCCAGAGCAGAATGGCAAAAAGAGCAGTTTATTCCCCCATATATTCCGCGCTTCAGGAATGGCTGGGAGCCCCCTCTTCTGAACTGTGCTGGGGTGCCAAAGGAACAGGAACTATCTCTTCTGGCTGAGTCTGTGGCAAACGTTACAGAGTTTCAGCAGAAACAAGATTTCAACAGTGTGCCAATTGTGTTTTCCAATGTGTCCCGTTATCCATCGTCAGAGGGGAATGTGTAGGAGTGCGGCCAATCAGAGCCCCAGAAATACGCCACGTGCAAGTACGACTTTGTAGCTCGCAACACTAATGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCATCGATGATAAGAAGCAGTGGTGGAAAGTTCGGAACGGAGGTGGGGCAGTTGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAGGCCTCAAGATCACTCTGCAAAGNCAATGGAAGCAGTGTACACTCAAACAATCCAGAAACAGAAGTCCAACTTTATACAAAACCAAGCAGGTCCAATTCCAGAGGCTCCCTCTCCACCACCAAGTCCAGCACCAACATATTCCCCTTTAGTCCCTACTCAGCCGCCAT------------------------TGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGG------------ACAGAAGAAATT------------------------GGCCGTCCATATTTCTTACAANTCACCNGCAGAGGA
                                                  Xl3.1-CHK-1012712280                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATGGTAGAGGCCACAGGGGGCCCTGATCTTGCACAGACAGTATTAAGCCCCCTTATCATAAAGGACGCACTAGATTTCCTCAACTTCATCCTTAATAAAGAGGAGAAACAACTCTGGACGTCGTTAGGTGATGCATGGAACAAATCCAGAGCAGAATGGCAAAAAGAGCAGTTTATTCCCCCATATATTCCGCGCTTCAGGAATGGCTGGGAGCCCCCTCTTCTGAACTGTGCTGGGGTGCCAAAGGAACAGGAACTATCTCTTCTGGCTGAGTCTGTGGCAAACGTTACAGAGTTTCAGCAGAAACAAGATTTCAACAGTGTGCCAATTGTGTTTTCCAATGTGTCCCGTTATCCATCGTCAGAGGGGAATGTGTAxxxxTGCGGCCAATCAGAGCCCCAGAAATACGCCACGTGCAAGTACGACTTTGTAGCTCGCAACACTAATGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCATCGATGATAAGAAGCAGTGGTGGAAAGTTCGGAACGGAGGTGGGGCAGTTGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAGGCCTCAAGATCACTCTGCAAAGNCAATGGAAGCAGTGTACACTCAAACAATCCAGAAACAGAAGTCCAACTTTATACAAAACCAAGCAGGTCCAATTCCAGAGGCTCCCTCTCCACCACCAAGTCCAGCACCAACATATTCCCCTTTAGTCCCTACTCAGCCGCCATCACTGC------------CTTTACTGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGGACGTAN------------GAAATTTACTGT------------NACACTGGCCGTCCATATTTCTTA------------AGAGGATGTGAA
  5   1   1       add Tbd7                                 XL100k17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCACATGATGGTAGAGGCCACAGGGGGCCCTGATCTTGCACAGACAGTATTAAGCCCCCTTATCATAAAGGACGCACTAGATTTCCTCAACTTCATCCTTAATAAAGAGGAGAAACAACTCTGGACGTCGTTAGGTGATGCATGGAACAAATCCAGAGCAGAATGGCAAAAAGAGCAGTTTATTCCCCCATATATTCCGCGCTTCAGGAATGGCTGGGAGCCCCCTCTTCTGAACTGTGCTGGGGTGCCAAAGGAACAGGAACTATCTCTTCTGGCTGAGTCTGTGGCAAACGTTACAGAGTTTCAGCAGAAACAAGATTTCAACAGTGTGCCAATTGTGTATTCCAATGTGTCCCGTTATCCATCGTCAGAGGGGAATGTGTATAGCTTTAAGCGCTAACTTTGGTTTCGGTGGAATTTGTGCATTAAATGCACGTTTTCATCTA
  5   1   2       bld He1       in                    IMAGE:4407732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACAGGGGGTCCTGATCTTGCACGGACAGTATTAAGCCCCCTTATCATAAAGGACGCACTCGATTTCCTCAACTTCATCCTTAATAAAGAGGAGAAACAATTATGGACGTCATTAGGTGATGCATGGAACAAATCCAGAGCAGAATGGCCGAAAGAGCAGTTTATTCCCCCATATATCCCGCGCTTCAGGAACGGCTGGGAGCCCCCTCTTGTGACCTGTGCTGGGGTGCCAAAGGAACAAGAACTCTCTCTCTTGGCCGAGTCTGTGGCAAACGTTGCAGAGTTTCAGCGGAAACAGGATTTCAACAGTGTGCCAATTGTGTTTTCCAATGTGTCCCGTTAT
  5   1   2      seed Ga18      in                       xlk68p13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTCAACAGTGTGCCAATTGTGTTTTCCAATGTGTCCCGTTATCCACCTTCAGAGGGGAATTTTGAGGAGTGCGGCCAATCAGAGCCCCAGAAATACGCCACGTGCAAGTACGACTTTGTAGCTCGCAACACTAATGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCATCGATGATAAGAAGCAGTGGTGGAAAGTTCGGAACGGAGGTGGGGCAGTTGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAGGCCTCAAGATCACTCTGCAAAGNCAATGGAAGCAGTGTACACTCAAACAATCCAGAAACAGAAGTCCAACTTTATACAAAACCAAGCAGGTCCAATTCCAGAGGCTCCCTCTCCACCACCAAGTCCAGCACCAACATATTCCCCTTTAGTCCCTACTCAGCCGCCATCACTGCCCNNNNNNAGCTCTTTACTGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGGACGTANNNCGGCACAGAAGAAATTTACTGTGCCGNNNNAAANNACACTGGCCGTCCATATTTCTTACAANTCACCNGCAGAGGATGTGAAATCC
  5   1   2       e50                               Xl3.1-xlk66k08ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTACTCAGCCGCCATCACTGCCCGTGGCTAAGCTCTTTACTGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGGACGTAGTGCGGCACAGAAGAAATTTACTGTGCCGCGGCAAAGCACACTGGCCGTCCATATTTCTTACAATTCACCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAGGGATTCAATTCAGTAACTGTCGACAGCCTTGGGGTGCTCACAGGAGCCCAGCTTTTCTCTCTCACTAAAGATGAACTGAAGACTGTGTGTCCGGAAGGCTCAAGGGTGTATAACCAAGTTACAGTACAGAAGGCTGCTATTGAGGAACAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGGCAGGAACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTGGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACCTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGTTTGTATTATTATTAATAACCAGATGTTATTTAAATCCTTTGTGGAACTGATGCCAATTTATTTAAGGATGAGCTTGTCGTGTGGCAGGTGGACTTGGATAATGTAGGGGCAAATCGCTGCTGCTAGAGAGAGAGAGAGATGGGGGGACCCTTGTACTTACACTCAGGGGCTGGTATGTTCAGCACAATGACCTGCTCTGTGTTTGCACCTTTCCTCTAGCAGAGCCAGCGGCCCCCCTATAGTGGCATGTCGTGTGTAAATAGGAACATTATCAGTATTTGCCATGCTGTCCCGTGTAACAGGCT
                                                  Xl3.1-CHK-1012696250                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCCGCCATCACTGCCCGTGGCTAAGCTCTTTACTGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGGACGTAGTGCGGCACAGAAGAAATTTACTGTGCCGCGGCAAAGCACACTGGCCGTCCATATTTCTTACAATTCACCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAGGGATTCAATTCAGTAACTGTCGACAGCCTTGGGGTGCTCACAGGAGCCCAGCTTTTCTCTCTCACTAAAGATGAACTGAAGACTGTGTGTCCGGAAGGCTCAAGGGTGTATAACCAAGTTACAGTACAGAAGGCTGCTATTGAGGAACAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGGCAGGAACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTGGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACCTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGTTTGTATTATTATTAATAACCAGATGTTATTTAAATCCTTTGTGGAACTGATGCCAATTTATTTAAGGATGAGCTTGTCGTGTGGCAGGTGGACTTGGATAATGTAGGGGCAAATCGCTGCTGCTAGAGAGAGAGAGAGATGGGGGGACCCTTGTACTTACACTCAGGGGCTGGTATGTTCAGCACAATGACCTGCTCTGTGTTTGCACCTTTCCTCTAGCAGAGCCAGCGGCCCCCCTATAGTGGCATGTCGTGTGTAAATAGGAACATTATCAGTATTTGCCATGCTGTCCCGTGTAACAGGCTTTGTAC
  5   1   2       add Ga18      in                       xlk66k08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTTGGTAGCGATGAGNNCTCAAGATCACTCTGCNNNNNNATGGAAGCAGTGTACACTCAAACAATCCAGAAACAGAAGTCCAACTTTATACAAAACCAAGCAGGTCCAATTCCAGAGNCTCCCTCTCCACCACCAAGTCCAGCACCAACATATTCCCCTTTAGTCACTACTCAGCCGCCATCACTGCCCNTNNNNAGCTCTTTACTGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGGACGTAGNGCGGCACAGAAGAAATTTACTGTGCCGNNCANNNNNACTGGCCGTCCATATTTCTTACAATTCACCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAGNGATTCAATTCAGTAACTGTCGACAGCCTTGGGGTGCTCACAGGAGCCCAGCTTTTCTCTCTCACTAAAGATGAACTGAAGACTGTGTGTCCGGAANNTCAAGGGTGTATAACCAAGTTACAGTGCAGAAGNNTGCTATTGAGGAANAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGGCAGGANNGGGTAAACATGGCTGCCAGTGANTCNNGGAGTGGAATCATTTGATGAAGGGAANAGTCACTGAGTCCAGTGCTNANTTCCCTGAGANGTTNNTCCGGTGCATGGNNTTNGAGGGGTGANC
  5   1   2      seed Ov1                             IMAGE:6316483.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGACTACTCAGCCGCCATCACTGCCCGTGGCTAAGCTCTTTACTGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGGACGTAGTGCGGCACAGAAGAAATTTACTGTGCCGCGGCAAAGCACACTGGCCGTCCATATTTCTTACAATTCACCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAGGGATTCAATTCAGTAACTGTCGACAGCCTTGGGGTGCTCACAGGAGCCCAGCTTTTCTCTCTCACTAAAGATGAACTGAAGACTGTGTGTCCGGAAGGCTCAAGGGTGTATAACCAAGTTACAGTACAGAAGGCTGCTATTGAGGAACAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGGCAGGAACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTAGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACCTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGGTTGGATTATTAATTAATAACCAGATGTTATTTAAAATCCTTTGTGGAACTGATGCCAATTTATTTAAAGGATG
  5   1   2       bld Ov1                    IMAGE:6316483-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTACTCAGCCGCCATCACTGCCCGTGGCTAAGCTCTTTACTGCCGGACCAATCAGTCGACAGAGCAGCGTGTCCAGTGACAGCGGAGGAGGAGGAATTGTCCGAGAGCAACATGGCTTCCAGCAGCTTCCAGCCAATCGCAGGAAATCTCAGATGGAGGAAGTGCAGGATGAACTAATCCACAGACTCACCATCGGACGTAGTGCGGCACAGAAGAAATTTACTGTGCCGCGGCAAAGCACACTGGCCGTCCATATTTCTTACAATTCACCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAGGGATTCAATTCAGTAACTGTCGACAGCCTTGGGGTGCTCACAGGAGCCCAGCTTTTCTCTCTCACTAAAGATGAACTGAAGACTGTGTGTCCGGAAGGCTCAAGGGTGTATAACCAAGTTACAGTACAGAAGGCTGCTATTGAGGAACAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGGCAGGAACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTAGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACCTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTG
  3   1   2      skin Ga18      in                       xlk66k08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TNAGTCNNNAGAGNAGNNNNNTCNAGNNNCAGCNGANGNNNAGGAATNNNCNAGANNAACANNNNNNCNAGCANNTTCNANCCNATNGCAGGNAATCTCAGATGGAGNNAGTGCAGGATGANCTANTCCACAGNCTCACCATNGGACGTAGTNNGGCACAGAAGAAATTTACTGTNNCGCGNNAAAGNACACTGGCCGTCCATATTTCTTACAATTCACCGNCAGAGGATGTGAAATCCTGGTTACAGGCCAAGGGATTCAATTCAGTANCTGTCGACAGCCTTGGGGTGCTCACAGGANNCCAGCTTTTCTCTCTCACTAAAGATGAACTGAAGACTGTGTGTCCGGAAGGCTCAAGGGTGTATANCCAAGTTACAGTGCAGAAGGCTGCTATTGAGGAACAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGGCAGGAACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTGGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGTCTGTATTATTATTAATAACCAGATGTTATTTAAATCCTTTGTGGAACTGATGCCAATTTATTTAAGGATGAGCTTGTCGTGTGGCAGGTGGACTTGGATAATGTAGGGGCAAATCGCTGCTGCTAGAGAGAGAGAGAGATGGGGGGACCCTTGTACTTACACTCAGGGGCTGGTATGTTCAGCACAATGACCTGCTCTGTGTTTGCACCTTTCCTCTANNAGANCANNGNNCCCCCTATAGTGGCATGTCGTGTGTAAATAGGAACATTATCAGTATNNNCATGCTGTCCCGTGTAACAGGCTTTGNNNCNNNCNNCCNNTTCACT
  3   1   2       bld Ga18      in                       xlk68p13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCCANCANNNTCNANCNANNGCAGGAATNNTNAGANGGAGNAAGTGCAGGNNNACTTATNNNNAGNCNCNNNTCGGNCGTANNNGGCANAGAAGAAATTTACTGTGCCGCGNCAAANNNNNCTGGNCGTCCATNTTTCTTACAATTNACCGNCAGAGGATGTGAANTCCTGGTNACAGGCCAAGGGATTCAATTCAGTNACTGTCGACAGNCTTGGGGTGCTCACAGGAGNCCAGCTTTTCTCTCTCNCNAAAGATGNACTGAAGACTGTGTGTCCGGAAGGCTCAAGGGTGTATANCCAAGTTACAGTACAGAAGGCTGCTATTGAGGAACAAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGTCAGGAACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTGGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGTTTGTATTATTATTAATAACCAGATGTTATTTAAATCCTTTGTGGAACTGATGCCAATTTATTTAAGGATGAGCTTGTCGTGTGGCAGGTGGACTTGGATAATGTAGGGGCAAATCGCTGCTGCTAGAGAGAGAGAGAGATGGGGGGACCCTTGTACTTACACTCAGGGGCTGGTATGTTCAGCACAATGACCTGCTCTGTGTTTGCACCTTTCCTCTANNAGACCAGCGGCCCCCCTATAGTGGCATGTCGTGTGTAAATAGGAACATTATCAGTATTTNNATGCTGTCCCGTGTAACAGGCTTTGTACCAGGNCCCCCACTTTCACTTGGTTNCNATAAATAA
  5   1   2       bld Tbd7      in                         XL051b21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTTACAATTCACCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAGGGATTCAATTCAGTAACTGTCGACAGCCTTGGGGTGCTCACAGGAGCCCAGCTTTTCTCTCTCACTAAAGATGAACTGAAGACTGTGTGTCCGGAAGGCTCAAGGGTGTATAACAAGTTACAGTGCAGAAGGCTGCTATTGAGGAACAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGTCAGGAACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTGGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACCTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGTT
  3   1   2       add Ga18                             rxlk107g01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GNAGAGGATGTGAANNCCTNGTTNCAGGCNAAGGGATTCAATTCAGNNNCTGTCGACAGCCTNNGGNNNNTCACAGGAGNCCAGCTTTTCTCTCTCACTAAAGATGAACTGAAGACTGTGTGTCCGNNAGGCTCAAGGGTGTATANCCAAGTTACAGTACAGAAGGCTGCTATTGAGGAACAAAGTGGGGGTTCAGAGCTGCATGAGATCATGAAGAAACGTCAGGAACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTGGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTNNTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGTTTGTATTATTATTAATAACCAGATGTTATTTAAATCCTTTGTGGAACTGATGCCAATTTATTTAAGGATGAGCTTGTCGTGTGGCAGGTGGACTTGGATAATGTAGGGGCAAATCGCTGCTGCTAGAGAGAGAGAGAGATGGGGGGACCCTTGTACTTACACTCAGGGGCTGGTATGTTCAGCACAATGACCTGCTCTGTGTTTGCACCTTTCCTCTANNAGACCAGCGGCCCCCCTATAGTGGCATGTCGTGTGTAAATAGGAACATTATCAGTATNTNNATGCTNTCCCGTGTAACAGNCTTTNTACCANNCNNCCNNTTCNC
  3   1   2       bld Tbd7      in                         XL051b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACGGGTAAACATGGCTGCCAGTGACTCCGGAGTGGAATCATTTGATGAAGGGAACAGTCACTGAGTCCAGTGCTAATTCCCTGAGATGTTGCTCCGGTGCATGGATTTGGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACCTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGTTTGTATTATTATTAATAACCAGATGTTATTTAAATCCTTTGTGGAACTGATGCCAATTTATTTAAGGATGAGCTTGTCGTGTGGCAGGTGGACTTGGATAATGTAGGGGCAAATCGCTGCTGCTAGAGAGAGAGAGAGATGGGGGGACCCTTGTACTTACACTCAGGGGCTGGTATGTTCAGCACAATGACCTGCTCTGTGTTTGCACCTTTCCTCTAGCAGAGCCAGCGGCCCCCCTATAGTGGCATGTCGTGTGTAAATAGGAACATTATCAGTATTTGCCATGCTGTCCCGTGTAACAGGCTTTGTACCAGGACCCCCACTTTCACTGGTTTCTATAAATAAAACATANCTGTAAAT
  5   1   2       bld Egg1                               PBX0018B12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGAGGTGCTCCGGTGCATGGATTTGGAGGGGTGATCCTAGAGCAAGAGAGAGAGAATTGTACCTGACGGGCTCCTGAGATCTATTGCCGTTGGACTATCCAGTGTGAGTGATGCTGCGGCTGCTTTATTGCTTATTTAAAGGGACTATTTAATGAGACTTTTCTAGAATGACTTGATTCTGCTTTATACTGTTTGTATTATTATTAATAACCAGATGTTATTTAAATCCTTTGTGGAACTGATGCCAATTTATTTAAGGATGAGCTTGTCGTGTGGCAGGTGGACTTGGATAATGTAAGGGCAAATCGCTGCTGCTagagagagagagagaTGGGGGGACCCTTGTACTTACACTCAGGGGCTGGTATGTTCAGCACAATGACCTGCTCTGTGTTTGCACCTTTCCTCTAGCAGAGCCAGCGGCCCCCCTATAGTGGCATGTCGTGTGTAAATAGGAACATTATCAGTATTCGCCATGCTGTCCCGTGTAACAGGCTTTGTACCATGACCCCCACTGTCACTTGGTTTCTATAAATAAAACATATC
  3   1   2       bld He1       in                    IMAGE:4407732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAATGACTTGATTCTGCTTTATACTGTTTGTATTATTATTAATAACCAGATGTTATTTAAATCCTTTGTGGAACTGATGCCAATTTATTTAAGGATGAGCTTGTCGTGTGGCAGGTGGACTTGGATAATGTAGGGGCAAATCGCTGCTGCTAGAGAGAGAGAGAGATGGGGGGACCCTTGTACTTACACTCAGGGGCTGGTATGTTCAGCACAATGACCTGCTCTGTGTTTGCACCTTTCCTCTAGCAGAGCCAGCGGCCCCCCCTATAGTGGCATGTCGCCTGTAAATAGGAACATTATCAGTATTTGCCATGCTGTCCCGTGTAACAGGCTTTGTACCAGGACCCCCACTTTCACATGGTTTCTATAAATAAAACATATCTGTAAATAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)