Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 05 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk73g11ex.3                          5 END     3          25       60                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6637447.5                       5 PI      83        568      908                (no blast hit)
     3   0.0    0Xl3.1-xlk126l20ex.5                         4 PI      79          1      897                LIM homeobox 1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 77%

 1012838991 Xl3.1-XL199o03.5.5 - 12 ESTs
                                                                       ........-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL199o03.5.5                   GATGGGAAGAGCCAGTGAGTGGAGCAAACCTGTAGGATCGCCAGCTCCTGTGCCAACCTTCACTACGGCCAAGCTCTCGCTCTCTTCATTGGCACTGCATATGTTCCAGGAGGATTCCTTCTTTTATCGAACTGCTAGTGGGATTTGGACAATAAAGCCAGGGCCAGAAGTTGTTCATGGGCTAGGGGACTTCCTCAGTTGACATTAAGACAAATGAACCAGCCCCCTCCAACCACGCACTGGATACCAAAAGGAGCGGAAAAAGGAAAATAACTGAACTGGCAGCCAAATCGGCAAACCCGAGGTGTGTGTGGAGCCGGTCGGTCGTGATGCCGGGCAATCTAAATCGTCTTGGCTTGTCATTTCTCTAGGAAAACAGATGCACTTTCAGCAGTGACTGCGCTACCTCACAGCATCTCTGATCGGCCCACATCATCTCTCTCCTCTCCTACCTCCTGCTAACGTGGCTTGGGCATCTCCATCAGGACCATAGTGTCTGCCTTCTCTCCTCCTAACCCGTCCCCCTTCCTCCAAAATCCCAAATAACCAAAGACAATGGTTCACTGTGCTGGATGCGAAAGGCCCATTCTGGACCGTTTCTTGTTGAATGTGTTGGACAGGGCCTGGCATGTGAAGTGCGTGCAGTGCTGTGAGTGTAAGTGCAACCTGACCGAGAAATGCTTCTCCAGGGAGGGAAAGCTCTACTGTAAAAACGACTTCTTCAGGCGCTTTGGTACCAAGTGTGCGGGCTGTGCACAGGGGATCTCCCCCAGTGACCTAGTCAGGAGGGCAAGGAGCAAAGTGTTCCACTTGAACTGTTTCACCTGCATGATGTGTAACAAACAGCTCTCCACTGGAGAGGAACTTTATATCATCGACGAGAACAAGTTCGTCTGCAAAGAAGATTACTTTTAACAACAGCACGCTGCCAAAGAAATAGCCTTATCTCAGTAACAGGCAGTGACCCCAGTTTGTCTCCTGAATCTCAAGACCCTTTGCAAGATGACGCTAAAGACTCTGAAAGTGCCAACGTCTCTGATAAGGAGGCTGGGATTAATGAAAACGACGACCAAAACCTTGGGACGAAAAGAAGGGGACCTAGGACCACTATCAAAGCCAAACAGTTGGAGACACTAAAAGCAGCATTTGCAGCGACACCAAAACCGACCCGACACATAAGGGAGCAGCTGGCACAGGAGACTGGTCTCAACATGCGAGTCATCCAGGTCTGGTTCCAGAACCGACGATCCAAAGAGAGAAGAATGAAACAGCTGAGCGCACTGGGGGCCCGGAGACACGCCTTCTTCCGCAGCCCCCGAAGGATGAGACCGTTGGTGGACAGATTAGAACCGGGAGAACTCATCCCCAATGGGCCCTTCGCTTTCTATGGAGATTATCAGAGTGAGTATTATGGTCCTGGCAGCAACTATGACTTTTTCCCACAAGGACCCCCATCATCTCAAGCTCAGACTCCTGTAGATTTGCCATTTGTACCTTCTTCTGGGCCTGCAGGAACGCCACTTGGTGCAATGGATCACCCAATCCCTGGACACCACCCATCTAGTGACGCTCAGCGATTTACTGACATAATGTCCCACCCACCAGGAGACTCTCCAAGCCCAGAGCCCAATTTACCAGGTTCCATGCACTCTATGTCTGCAGAAGTTTTTGGACAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGGAGCAGGTTATGTCAACCATTTGTCACACCCACCAGAAATGAATGAAACTGCAGTGTGGTAGCCTAAGATGGACAAAAACAGAACAAAAAATCAGAAAGGACTGGGTGCAATGG
                                                  Xl3.1-CHK-1012723052                         AAGAGCCAGTGAGTGGAGCAAACCTGTAGGATCGCCAGCTCCTGTGCCAACCTTCACTACGGCCAAGCTCTCGCTCTCTTCATTGGCACTGCATATGTTCCAGGAGGATTCCTTCTTTTATCGAACTGCTAGTGGGATTTGGACAATAAAGCCAGGGCCAGAAGTTGTTCATGGGCTAGGGGACTTCCTCAGTTGACATTAAGACAAATGAACCAGCCCCCTCCAACCACGCACTGGATACCAAAAGGAGCGGAAAAAGGAAAATAACTGAACTGGCAGCCAAATCGGCAAACCCGAGGTGTGTGTGGAGCCGGTCGGTCGTGATGCCGGGCAATCTAAATCGTCTTGGCTTGTCATTTCTCTAGGAAAACAGATGCACTTTCAGCAGTGACTGCGCTACCTCACAGCATCTCTGATCGGCCCACATCATCTCTCTCCTCTCCTACCTCCTGCTAACGTGGCTTGGGCATCTCCATCAGGACCATAGTGTCTGCCTTCTCTCCTCCTAACCCGTCCCCCTTCCTCCAAAATCCCAAATAACCAAAGACAATGGTTCACTGTGCTGGATGCGAAAGGNCCATTCTGGACCGTTTCTTGTTGAATGTGTTGGACAGGGCCTGGCATGTGAAGTGCGTGCAGTGCTGTGAGTGTAAGTGCAACCTGACCGAGAAATGCTTCTCCAGGGAGGGAAAGCTCTACTGTAAAAACGACTTCTTCAGGCGCTTTGGTACCAAGTGTGCGGGCTGTGCCCAGGGGATCTCCCCCAGTGACCTAGTCAGGAGGGCAAGGAGCAAAGTGTTCCACTTGAACTGTTTCACCTGCATGATGTGTAACAAACAGCTCTCCACTGGAGAGGAACTTTATATCATCGACGAGAACAAGTTCGTCTGCAAAGAAGATTACTTTTAACAACAGCACGCTGCCAAxxAAATAGCCTTATCTCAGTAACAGGCAGTGACCCCAGTTTGTCTCCTGAATCTCAAGACCCTTTGCAAGATGACGCTAAAGACTCTGAAAGTGCCAACGTCTCTGATAAGGAGGCTGGGATTAATGAAAACGACGACCAAAACCTTGGGACGAAAAGAAGGGGACCTAGGACCACTATCAAAGCCAAACAGTTGGAGACACTAAAAGCAGCATTTGCAGCGACACCAAAACCGACCCGACACATAAGGGAGCAGCTGGCACAGGAGACTGGTCTCAACATGCGAGTCATCCAGGTCTGGTTCCAGAACCGACGATCCAAAGAGAGAAGAATGAAACAGCTGAGCGCACTGGGGGCCCGGAGACACGCCTTCTTCCGCAGCCCCCGAAGGATGAGACCGTTGGTGGACAGATTAGAACCGGGAGAACTCATCCCCAATGGGCCCTTCGCTTTCTATGGAGATTATCAGAGTGAGTATTATGGTCCTGGCAGCAACTATGACTTTTTCCCACAAGGACCCCCATCATCTCAAGCTCAGACTCCTGTAGATTTGCCATTTGTACCTTCTTCTGGGCCTGCAGGAACGCCACTTGGTGCAATGGATCACCCAATCCCTGGACACCACCCATCTAGTGACGCTCAGCGATTTACTGACATAATGTCCCACCCACCAGGAGACTCTCCAAGCCCAGAGCCCAATTTACCAGGTTCCATGCACTCTATGTCTGCAGAAGTTTTTGGACAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGGAGCAGGTTATGTCAACCATTTGTCACACCCACCAGAAATGAATGAAACTGCAGTGTGGTAGCCTAAGATGGACAAAAACAGAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACC
                                                      consensus depths                        3     4     3     4     3     4     3     4     4     4     4     4     4     4     3     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     2     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     6     6     4     6     5     7     5     7     5     7     5     7     4     6     4     6     4     6     4     6     3     4     2     4     3     4     3     4     3     5     2     5     3     5     2     5     2     5     2     4     2     4     2     4     2     4     2     4     2     4     1     4     1     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     3     3     2     3     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     3     5     4     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2       e50                                 Xl3.1-XL199o03.5                   GATGGGAAGAGCCAGTGAGTGGAGCAAACCTGTAGGATCGCCAGCTCCTGTGCCAACCTTCACTACGGCCAAGCTCTCGCTCTCTTCATTGGCACTGCATATGTTCCAGGAGGATTCCTTCTTTTATCGAACTGCTAGTGGGATTTGGACAATAAAGCCAGGGCCAGAAGTTGTTCATGGGCTAGGGGACTTCCTCAGTTGACATTAAGACAAATGAACCAGCCCCCTCCAACCACGCACTGGATACCAAAAGGAGCGGAAAAAGGAAAATAACTGAACTGGCAGCCAAATCGGCAAACCCGAGGTGTGTGTGGAGCCGGTCGGTCGTGATGCCGGGCAATCTAAATCGTCTTGGCTTGTCATTTCTCTAGGAAAACAGATGCACTTTCAGCAGTGACTGCGCTACCTCACAGCATCTCTGATCGGCCCACATCATCTCTCTCCTCTCCTACCTCCTGCTAACGTGGCTTGGGCATCTCCATCAGGACCATAGTGTCTGCCTTCTCTCCTCCTAACCCGTCCCCCTTCCTCCAAAATCCCAAATAACCAAAGACAATGGTTCACTGTGCTGGATGCGAAAGGCCCATTCTGGACCGTTTCTTGTTGAATGTGTTGGACAGGGCCTGGCATGTGAAGTGCGTGCAGTGCTGTGAGTGTAAGTGCAACCTGACCGAGAAATGCTTCTCCAGGGAGGGAAAGCTCTACTGTAAAAACGACTTCTTCAGGCGCTTTGGTACCAAGTGTGCGGGCTGTGCACAGGGGATCTCCCCCAGTGACCTAGTCAGGAGGGCA
  5   1   2       e50                               Xl3.1-xlk73g11ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTTCCTAAGGCCAGCTATCCAACCTTCACCTTAATGTGTCAGACCCCAACTGGCACAAAAAATGGGCAGCTAGAAGGAAATTCTGAAGACTCTCATGGGCGCTTTGGTACCAAGTGTGCGGGCTGTNCAGGGGATCTCCCCCAGTGACCTAGTCAGGAGGGCAAGGAGCAAAGTGTTCCACTTGAACTGTTTCACCTGCATGATGTGTAACAAACAGCTCTCCACTGAGAGGAACTTTAATATCATCGACGAGAACAAGTTCGTCTGCAAAGAAGATTACTTAAACACAGCAACGCTGCCAAAGAAAATAGCCTTATCTCAGTAACAGGCAGTGACCCCAGTTTGTCTCCTGAATCTCAAGACCCTTTGCAAGATGACGCTAAAGACTCTGAAAGTGCCAACGTCTCTGATAAGGAGGCTGGGATTAATGAAAACGACGACCAAAACCTTGGGACGAAAAGAAGGGGACCTAGGACCACTATCAAAGCCAAACAGTTGGAGACACTAAAAGCAGCATTTGCAGCGACACCAAAACCGACCCGACACATAAGGGAGCAGCTGGCACAGGAGACTGGTCTCAACATGCGAGTCATCCAGGTCTGGTTCCAGAACCGACGATCCAAAGAGAGAAGAATGAAACAGCTGAGCGCACTGGGGGCCCGGAGACACGCCTTCTTCCGCAGCCCCCGAAGGATGAGACCGTTGGTGGACAGATTAGAACCGGGAGAACTCATCCCCAATGGGCCCTTCGCTTTCTATGGAGATTATCAGAGTGAGTATTATGGTCCTGGCAGCAACTATGACTTTTTCCCACAAGGACCCCCATCATCTCAAGCTCAGACTCCTGTAGATTTGCCATTTGTACCTTCTTCTGGGCCTGCAGGAACGCCACTTGGTGCAATGGATCACCCAATCCCTGGACACCACCCATCTAGTGACGCTCAGCGATTTACTGACATAATGTCCCACCCACCAGGAGACTCTCCAAGCCCAGAGCCCAATTTACCAGGTTCCATGCACTCTATGTCTGCAGAAGTTTTTGGACAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGGAGCAGGTTATGTCAACCATTTGTCACACCCACCAGAAATGAATGAAACTGCAGTGTGGTAGCCTAAGATGGACAAAAACAGAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCATGTCAAGGTTTCCTATGGTGT
                                               BLH MIN     908     188                   
                                               BLH MPR     380     188                   
                                               BLH OVR     555     405                   
                                               CDS MIN     555     188                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 3e-070     NP_492696.1 abnormal cell LINeage LIN-11, lin-11 protein (45.8 kD) (lin-11) [Caenorhabditiselegans] ----------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 8e-039     NP_001071755.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ag ---- 4e-053     XP_309513.3 AGAP011134-PA [Anopheles gambiae str. PEST] ================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 5e-054     NP_572505.1 CG11354-PA [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Sp ==== 1e-061     NP_999810.1 Lim homeodomain transcription factor 1 [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 0          NP_571291.1 LIM homeobox protein 1 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Gg ---- 0          NP_990744.1 domesticus (clone 2.3 kB) lim-1 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bt ---- 1e-150     NP_001098917.1 LIM homeobox protein 1 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Cf ---- 1e-150     XP_852897.1 PREDICTED: similar to LIM homeobox protein 1 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 3e-151     NP_032524.1 LIM homeobox protein 1; LIM homeo box protein 1 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Hs ---- 3e-151     NP_005559.2 LIM homeobox protein 1 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Xl ---- 0          NP_001084128.1 homeobox protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xt ---- 0          NP_001093698.1 LIM homeobox 1 [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL199o03.5.5                                                   TAG---------------------------------------------------------------------------------------------------------------------TAA---------------------ATG---TAG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------TAG------------------------------------------------TGA------------------------------------------------------------------------------------------TAA---------------------------------------------------------ATG---------------------------------------------------------------------------TGA---TAA------------------ATG---------------------------TAA---------------------------------------------------------------TGA------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------ATG------------------TAG------ATG---------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       e50                                 Xl3.1-XL199o03.5                   GATGGGAAGAGCCAGTGAGTGGAGCAAACCTGTAGGATCGCCAGCTCCTGTGCCAACCTTCACTACGGCCAAGCTCTCGCTCTCTTCATTGGCACTGCATATGTTCCAGGAGGATTCCTTCTTTTATCGAACTGCTAGTGGGATTTGGACAATAAAGCCAGGGCCAGAAGTTGTTCATGGGCTAGGGGACTTCCTCAGTTGACATTAAGACAAATGAACCAGCCCCCTCCAACCACGCACTGGATACCAAAAGGAGCGGAAAAAGGAAAATAACTGAACTGGCAGCCAAATCGGCAAACCCGAGGTGTGTGTGGAGCCGGTCGGTCGTGATGCCGGGCAATCTAAATCGTCTTGGCTTGTCATTTCTCTAGGAAAACAGATGCACTTTCAGCAGTGACTGCGCTACCTCACAGCATCTCTGATCGGCCCACATCATCTCTCTCCTCTCCTACCTCCTGCTAACGTGGCTTGGGCATCTCCATCAGGACCATAGTGTCTGCCTTCTCTCCTCCTAACCCGTCCCCCTTCCTCCAAAATCCCAAATAACCAAAGACAATGGTTCACTGTGCTGGATGCGAAAGGCCCATTCTGGACCGTTTCTTGTTGAATGTGTTGGACAGGGCCTGGCATGTGAAGTGCGTGCAGTGCTGTGAGTGTAAGTGCAACCTGACCGAGAAATGCTTCTCCAGGGAGGGAAAGCTCTACTGTAAAAACGACTTCTTCAGGCGCTTTGGTACCAAGTGTGCGGGCTGTGCACAGGGGATCTCCCCCAGTGACCTAGTCAGGAGGGCA
                                                  Xl3.1-CHK-1012698734                         AAGAGCCAGTGAGTGGAGCAAACCTGTAGGATCGCCAGCTCCTGTGCCAACCTTCACTACGGCCAAGCTCTCGCTCTCTTCATTGGCACTGCATATGTTCCAGGAGGATTCCTTCTTTTATCGAACTGCTAGTGGGATTTGGACAATAAAGCCAGGGCCAGAAGTTGTTCATGGGCTAGGGGACTTCCTCAGTTGACATTAAGACAAATGAACCAGCCCCCTCCAACCACGCACTGGATACCAAAAGGAGCGGAAAAAGGAAAATAACTGAACTGGCAGCCAAATCGGCAAACCCGAGGTGTGTGTGGAGCCGGTCGGTCGTGATGCCGGGCAATCTAAATCGTCTTGGCTTGTCATTTCTCTAGGAAAACAGATGCACTTTCAGCAGTGACTGCGCTACCTCACAGCATCTCTGATCGGCCCACATCATCTCTCTCCTCTCCTACCTCCTGCTAACGTGGCTTGGGCATCTCCATCAGGACCATAGTGTCTGCCTTCTCTCCTCCTAACCCGTCCCCCTTCCTCCAAAATCCCAAATAACCAAAGACAATGGTTCACTGTGCTGGATGCGAAAGGNCCATTCTGGACCGTTTCTTGTTGAATGTGTTGGACAGGGCCTGGCATGTGAAGTGCGTGCAGTGCTGTGAGTGTAAGTGCAACCTGACCGAGAAATGCTTCTCCAGGGAGGGAAAGCTCTACTGTAAAAACGACTTCTTCAGGCGCTTTGGTACCAAGTGTGCGGGCTGTGCCCAGGGGATCTCCCCCAGTGACCTAGTCAGG
  5   1   2       bld Ga18 5g                           xlk161e12ex.5p      GCGAGANAGTTCGGATGGGAAGAGCCAGTGAGTGGAGCAAACCTGTAGGATCGCCAGCTCCTGTGCCAACCTTCACTACGGCCAAGCTCTCGCTCTCTTCATTGGCACTGCATATGTTCCAGGAGGATTCCTTCTTTTATCGAACTGCTAGTGGGATTTGGACAATAAAGCCAGGGNCAGAAGTTGTTCATGGGCTAGGGGACTTCCTCAGTTGACATTAAGACAAATGAACCAGCCCCCTCCAACCACGCACTGGATACCAAAAGGAGCGGAAAAAGGAAAATAACTGAACTGGCAGCCAAATCGGCAAACCCGAGGTGTGTGTGGAGCCGGTCGGTCGTGATGCCGGGCAATCTAAATCGTCTTGGCTTGTCATTTCTCTAGGAAAACAGATGCACTTTCAGCAGTGACTGCGCTACCTCACAGCATCTCTGATCGGCCCACATCATCTCTCTCCTCTCCTACCTCCTGCTAACGTGGCTTGGNNATCTCCATCAGGACCATAGTGTCTGCCTTCTCTCCTCCTAACCCGTCCCCCTTCCTCCAAAATCCCAAATAACCAAAGACAATGGTTCACTGTGCTGGATGCGAAAGGNCCATTCTGGACCGTTTCTTGTTGAATGTGTTGGACAGGGCCTGNNATGTGAAGTGCGTNCAGTNNTGTGAGTNTANGTNCAANCTGACCGAGANTGCTTCTCCAGGGNGGGAAAGCTCTACTGTAAAACGACTTCTNCNNGCNCTTTNGTA
  5   1   2      seed DMZ  5g3  in                         xl287a01.5p       CGAGACAGTTCGGATGGGAAGAGCCAGTGAGTGGAGCAAACCTGTAGGATCGCCAGCTCCTGTGCCAACCTTCACTACGGCCAAGCTCTCGCTCTCTTCATTGGCACTGCATATGTTCCAGGAGGATTCCTTCTTTTATCGAACTGCTAGTGGGATTTGGACAATAAAGCCAGGGCCAGAAGTTGTTCATGGGCTAGGGGACTTCCTCAGTTGACATTAAGACAAATGAACCAGCCCCCTCCAACCACGCACTGGATACCAAAAGGAGCGGAAAAAGGAAAATAACTGAACTGGCAGCCAAATCGGCAAACCCGAGGTGTGTGTGGAGCCGGTCGGTCGTGATGCCGGGCAATCTAAATCGTCTTGGCTTGTCATTTCTCTAGGAAAACAGATGCACTTTCAGCAGTGACTGCGCTACCTCACAGCATCTCTGATCGGCCCACATCATCTCTCTCCTCTCCTACCTCCTGCTAACGTGGCTTGGGCATCTCCATCAGGACCATAGTGTCTGCCTTCTCTCCTCCTAACCCGTCCCCCTTCCTCCAAAATCCCAAATAACCAAAGACAATGGTTCACTGTGCTGGATGCGAAAGGCCCATTCTGGACCGTTTCTTGTTGAATGTGTTGGACAGGGCCTGGCATGTGAAGTGCGTGCAGTGCTGTGAGTGTAAGTGCAACCTGACCGAGAAATGCTTCT
  5   1   2       bld DMZ                                  xl268d03.5p        GACAGTTCGGATGGGAAGAGCCAGTGAGTGGAGCAAACCTGTAGGATCGCCAGCATCCTGATGCCAACCTTCACTACGGCCAAGCTCTCGCTCTCTTCATTGGCACTGCNTATGTTCCAGGAGGATTCCTTCTTTTATCGAACTGCTAGTGGGATTTGGACAATAAAGCCAGGGCCAGAAGTTGTTCATGGGCTAGGGGACTTCCTCAGT
  5   1   2       bld Ga18      out                     xlk164a10ex.5p             AGTTCGGATGGGAAGAGCCAGTGAGTGGAGCAAACCTGTAGGATCGCCAGCTCCTGTGCCAACCTTCACTACGGCCAAGCTCTCGCTCTCTTCNTTGGNACTGCATATGTTCCAGGAGGATTCCTTCTTTTATCGAACTGCTAGTGGGATTTGGACAATAAAGCCAGGGNCAGAAGNTGTTCATGGGCTAGGGGACTTNCTCNGNTGANATTAAGAC
  5   1   2       bld Ga12 5g3  in                         XL199o03.5p                                                                                                                                          TCTTTTATCGAACTGCTAGTGGGATTTGGACAATAAAGCCAGGGCCAGAAGTTGTTCATGGGCTAGGGGACTTCCTCAGTTGACATTAAGACAAATGAACCAGCCCCCTCCAACCACGCACTGGATACCACAAGGAGCGGAAAAAGGAAAATAACTGAACTGGCAGCCAAATCGGCAAACCCGAGGTGTGTGTGGAGCCGGTCGGTCGTGATGCCGGGCAATCTAAATCGTCTTGGCTTGTCATTTCTCTAGGAAAACAGATGCACTTTCAGCAGTGACTGCGCTACCTCACAGCATCTCTGATCGGCCCACATCATCTCTCTCCTCTCCTACCTCCTGCTAACGTGGCTTGGGCATCTCCATCAGGACCATAGTGTCTGCCTTCTCTCCTCCTAACCCGTCCCCCTTCCTCCAAAATCCCAAATAACCAAAGACAATGGTTCACTGTGCTGGATGCGAAAGGCCCATTCTGGACCGTTTCTTGTTGAATGTGTTGGACAGGGCCTGGCATGTGAAGTGCGTGCAGTGCTGTGAGTGTAAGTGCAACCTGACCGAGAAATGCTTCTCCAGGGAGGGAAAGCTCTACTGTAAAAACGACTTCTTCAGGCGCTTTGG
  5   1   2       bld Ga18 5g                           xlk128o11ex.5p                                                                                                                                                                                                                                                                                                           TGCAGCCAAATCGGNAAACCCGAGGTGTGTGTGGAGCCGGTCGGTCGTGATGCCGGGCAATCTAAATCGTCTTGGCTTGTCATTTCTCTAGGAAAACAGATGCACTTTCAGCAGTGACTGCGCTACCTCACAGCATCTCTGATCGGCCCACATCATCTCTCTCCTCTCCTACCTCCTGCTAACGTGGCTTGGNNATCTCCATCAGGACCATAGTGTCTGCCTTCTCTCCTCCTAACCCGTCCCCCTTCCTCCAAAATCCCAAATAACCAAAGACAATGGTTCACTGTGCTGGATGCGAAAGNNCCATTCTGGACCGTTTCTTGTTGAATGTGTTGGACAGGGCCTGNNATGTGAAGNGCGTGCAGTGCTGTGAGTGTAAGTGCAACCTGACCGAGAAATGCTTCTCCAGGGAGGGAAAGCTCTACTGTAAAAACGACTTCTTCAGGCGCTTTGGTANCAAGTGTGCGGNCTGTNCCAGGGGGNTCTCCCCCAGTGACCTAGTCAGGAGGGCAAGGNGNAAAGNGTTCCACTTGAACTGTTTNNCCTGCATGATGTNNNNNAANNGCTCT
  5   1   2       add Ga18 5x   ?                        xlk60b24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                     GNTACCTCACAGCATCTCTGATCGGCCCACATCATCTCTCTCCTCTCCTACCTCCTGCTAACGTGGCTTNNNNTCTCCATCAGGACCATAGTGTCTGCCTTCTCTCCTCCTAACCCGTCCCCCTTCCTCCAAAATCCCAAATAACCAAAGACAATGGTTCACTGTGCTGGATGCGAAAGGNCCATTCTGGACCGTTTCTTGTTGAATGTGTTGGACAGGGCCTGGNATGTGAAGTGCGTGCAGTGCTGTGAGTGTAAGTGCAACCTGACCGAGAAATGCTTCTCCAGGGAGGGAAAGCTCTACTGTAAAAACGACTTCTTCAGGCGCTTTGGTACCAAGTGTGCGGGCTGTGCAGGGGATCTCCCCCAGTGACCTAGTCAGGAGGGCAAGGAGCAAAGTGTTCCACTTGAACTGTTTCACCTGCATGATGTGTAACANACAGCTCTCCACTGGNGNNNAACTTTATATCATCGACGAGAACAAGNTCGTCTGCAAAGAAGATTACTTAAACAACAGCNNNNNNCCAAAGAAAATAGCCTTATCTCAGTNACAGGCAGTGANCCCAGNTTGTCTCCTGAATCTCAAGACCCTTTGCAAGATGACGCTAAAGACTCTGAAAGTNCCNACGNCTCTNA
  3  -1   2       bld Bla2                            IMAGE:7296020.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTGGACAGGGCCTGGCATGTGAAGTGCGTGCAGTGCTGTGAGTGTAAGTGCAACCTGACCGAGAAATGCTTCTCCAGGGAGGGAAAGCTCTACTGTAAAAACGACTTCTTCAGGCGCTTTGGTACCAAGTGTGCGGGCTGTGCCCAGGGGATCTCCCCCAGTGACCTAGTCAGGAGGGCAAGGAGCAAAGTGTTCCACTTGAACTGTTTCACCTGCATGATGTGTAACAAACAGCTCTCCACTGGAGAGGAACTTTATATCATCGACGAGAACAAGTTCGTCTGCAAAGAAGATTACTTTTAACAACAGCACGCTGCCAAAGAAAATAGCCTTATCTCAGTAACAGGCAGTGACCCCAGTTTGTCTCCTGAATCTCANGACCCTTTGCAAGATGACGCTNAAGACTCTGAAAGTGCCAACGTCTCTGATAANGANGCTGGGATTAATGAAAACGACGACCAAACCTTGGGACAAAAGAAGGGGACCTAGGACCACTATCAAGCCAAACAGTTGGAGACACTAAAGCAGCATTGCAGCGACACAAACCGACCGACCATAAGGAGCACTGGACGGAGATGTCTCACATGCAGTCTCCAGTCTGGTCAGAACGACATCCAAAAGAGATGAAACTGACGCCTGGGGCCGAACCGCTCTCGCACCCGAGATAACGTGTGACGATAACGAATCTCCATGGCTCCTCAGAATAAATATTAGCTGCCATA
  5   1   2       e50                               Xl3.1-xlk73g11ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTTCCTAAGGCCAGCTATCCAACCTTCACCTTAATGTGTCAGACCCCAACTGGCACAAAAAATGGGCAGCTAGAAGGAAATTCTGAAGACTCTCATGGGCGCTTTGGTACCAAGTGTGCGGGCTGTNCAGGGGATCTCCCCCAGTGACCTAGTCAGGAGGGCAAGGAGCAAAGTGTTCCACTTGAACTGTTTCACCTGCATGATGTGTAACAAACAGCTCTCCACTGAGAGGAACTTTAATATCATCGACGAGAACAAGTTCGTCTGCAAAGAAGATTACTTAAACACAGCAACGCTGCCAAAGAAAATAGCCTTATCTCAGTAACAGGCAGTGACCCCAGTTTGTCTCCTGAATCTCAAGACCCTTTGCAAGATGACGCTAAAGACTCTGAAAGTGCCAACGTCTCTGATAAGGAGGCTGGGATTAATGAAAACGACGACCAAAACCTTGGGACGAAAAGAAGGGGACCTAGGACCACTATCAAAGCCAAACAGTTGGAGACACTAAAAGCAGCATTTGCAGCGACACCAAAACCGACCCGACACATAAGGGAGCAGCTGGCACAGGAGACTGGTCTCAACATGCGAGTCATCCAGGTCTGGTTCCAGAACCGACGATCCAAAGAGAGAAGAATGAAACAGCTGAGCGCACTGGGGGCCCGGAGACACGCCTTCTTCCGCAGCCCCCGAAGGATGAGACCGTTGGTGGACAGATTAGAACCGGGAGAACTCATCCCCAATGGGCCCTTCGCTTTCTATGGAGATTATCAGAGTGAGTATTATGGTCCTGGCAGCAACTATGACTTTTTCCCACAAGGACCCCCATCATCTCAAGCTCAGACTCCTGTAGATTTGCCATTTGTACCTTCTTCTGGGCCTGCAGGAACGCCACTTGGTGCAATGGATCACCCAATCCCTGGACACCACCCATCTAGTGACGCTCAGCGATTTACTGACATAATGTCCCACCCACCAGGAGACTCTCCAAGCCCAGAGCCCAATTTACCAGGTTCCATGCACTCTATGTCTGCAGAAGTTTTTGGACAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGGAGCAGGTTATGTCAACCATTTGTCACACCCACCAGAAATGAATGAAACTGCAGTGTGGTAGCCTAAGATGGACAAAAACAGAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCATGTCAAGGTTTCCTATGGTGT
                                                  Xl3.1-CHK-1012706157                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAGGCCAGCTATCCAACCTTCACCTTAATGTGTCAGACCCCAACTGGCACAAAAAATGGGCAGCTAGAAGGAAATTCTGAAGACTCTCATGGGCGCTTTGGTACCAAGTGTGCGGGCTGTNCAGGGGATCTCCCCCAGTGACCTAGTCAGGAGGGCAAGGAGCAAAGTGTTCCACTTGAACTGTTTCACCTGCATGATGTGTAACAAACAGCTCTCxxxxGAGAGGAAxxTTxATATCATCGACGAGAACAAGTTCGTCTGCAAAGAAGATTACTxAAxxACAGCAACGCTGCCAAAGAAAATAGCCTTATCTCAGTAACAGGCAGTGACCCCAGTTTGTCTCCTGAATCTCAAGACCCTTTGCAAGATGACGCTAAAGACTCTGAAAGTGCCAACGTCTCTGATAAGGAGGCTGGGATTAATGAAAACGACGACCAAAACCTTGGGACGAAAAGAAGGGGACCTAGGACCACTATCAAAGCCAAACAGTTGGAGACACTAAAAGCAGCATTTGCAGCGACACCAAAACCGACCCGACACATAAGGGAGCAGCTGGCACAGGAGACTGGTCTCAACATGCGAGTCATCCAGGTCTGGTTCCAGAACCGACGATCCAAAGAGAGAAGAATGAAACAGCTGAGCGCACTGGGGGCCCGGAGACACGCCTTCTTCCGCAGCCCCCGAAGGATGAGACCGTTGGTGGACAGATTAGAACCGGGAGAACTCATCCCCAATGGGCCCTTCGCTTTCTATGGAGATTATCAGAGTGAGTATTATGGTCCTGGCAGCAACTATGACTTTTTCCCACAAGGACCCCCATCATCTCAAGCTCAGACTCCTGTAGATTTGCCATTTGTACCTTCTTCTGGGCCTGCAGGAACGCCACTTGGTGCAATGGATCACCCAATCCCTGGACACCACCCATCTAGTGACGCTCAGCGATTTACTGACATAATGTCCCACCCACCAGGAGACTCTCCAAGCCCAGAGCCCAATTTACCAGGTTCCATGCACTCTATGTCTGCAGAAGTTTTTGGACAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGGAGCAGGTTATGTCAACCATTTGTCACACCCACCAGAAATGAATGAAACTGCAGTGTGGTAGCCTAAGATGGACAAAAACAGAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCATGTCAAGGTTTCCTATGGTGTACAGAA
  5   1   2       add Ga18      out                      xlk73g11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTTCCTAAGGCCAGCTATCCAACCTTCACCTTAATGTGTCAGACCCCAACTGGCACAAAAAATGGGCAGCTAGAAGGAAATTCTGAAGACTCTCATGGGCGCTTTGGTACCAAGTGTGCGGGCTGTNCAGGGGATCTCCCCCAGTGACCTAGTCAGGAGGGCAAGGAGCAAAGTGTTCCACTTGAACTGTTTCACCTGCATGATGTGTAACAAACAGCTCTCCACTGGAGANGAACTTTATATCATCGACGAGAACAAGTTCGTCTGCAAAGAAGATTACTTAAACAACAGCNANNNNCCAAAGAAAATAGCCTTATCTCAGTAACAGGCAGTGACCCCAGTTTGTCTCCTGAATCTCAAGACCCTTTGCAAGATGACGCTAAAGACTCTGAAAGTGCCAACGNCTCTGATAAGGAGGCTGGGATTAATGAAAACGACGACCAAAACCTTGGGACGAAAAGAAGGGGANCTAGGACCACTATCAAAGCCAAACAGTTGGAGACACTAAAAGCAGCATTTNCAGCGACACCAAAACCGACCCGACACATAAGGGAGCATCTGGCACAGGAGANTGGNCTCAACATGCGAGTCATCCAGGTCTNGNTNNCAGAACCGACGATCCAAAGAGAGAAGAATGAAACAGCTGAGCNNACTGGGGGCCCNG
  3  -1   2       bld Bla2      out                   IMAGE:7296468.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCAGGAGGGCAAGGAGCAAAGTGTTCCACTTGAACTGTTTCACCTGCATGATGTGTAACAAACAGCTCTCCACTGGAGAGGAACTTTATATCATCGACGAGAACAAGTTCGTCTGCAAAGAAGATTACTTAAACAACAGCAACGCTGCCAAAGAAAATAGCCTTATCTCAGTAACAGGCAGTGACCCCAGTTTGTCTCCTGAATCTCAAGACCCTTTGCAAGATGACGCTAAAGACTCTGAAAGTGCCAACGTCTCTGATAAGGAGGCTGGGATTAATGAAAACGACGACCAAAACCTTGGGACGAAAAGAAGGGGACCTAGGACCACTATCAAAGCCAAACAGTTGGAGACACTAAAAGCAGCATTTGCAGCGACACCAAAACCGACCCGACACATAAGGGAGCAGCTGGCACAGGAGACTGGTCTCAACATGCGAGTCATCCAGGTCTGGTTCCAGAACCGACGATCCAAAGAGAGAAGAATGAAACAGCTGAGCGCACTGGGGGCCCGGAGACACGCCTTCTTCCGCAGCCCCCGAAGGATGAGACCGTTGGTGGACAGATTAGAACCGGGAGAACTCATCCCCAATGGGCCCTTCGCTTTCTATGGAGATTATCAGAGTGAGTATTATGGTCCTGGCAGCAACTATGACTTTTTCCCACAAGGACCCCCATCATCTCAAGCTCAGACTTCCTGTAGATTTGCCATTTGTA
  3   1   2      seed DMZ  5g3  in                         xl287a01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGAAAAGAAGGGGACCTAGGACCACTATCAAAGCCAAACAGTTGGAGACACTAAAAGCAGCATTTGCAGCGACACCAAAACCGACCCGACACATAAGGGAGCAGCTGGCACAGGAGACTGGTCTCAACATGCGAGTCATCCAGGTCTGGTTCCAGAACCGACGATCCAAAGAGAGAAGAATGAAACAGCTGAGCGCACTGGGGGCCCGGAGACACGCCTTCTTCCGCAGCCCCCGAAGGATGAGACCGTTGGTGGACAGATTAGAACCGGGAGAACTCATCCCCAATGGGCCCTTCGCTTTCTATGGAGATTATCAGAGTGAGTATTATGGTCCTGGCAGCAACTATGACTTTTTCCCACAAGGACCCCCATCATCTCAAGCTCAGACTCCTGTAGATTTGCCATTTGTACCTTCTTCTGGGCCTGCAGGAACGCCACTTGGTGCAATGGATCACCCAATCCCTGGACACCACCCATCTAGTGACGCTCAGCGATTTACTGACATAATGTCCCACCCACCAGGAGACTCTCCAAGCCCAGAGCCCAATTTACCAGGTTCCATGCACTCTATGTCTGCAGAAGTTTTTGGACAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGGAGCAGGTTATGTCAACCATTTGTCACACCCACCAGAAATGAATGAAACTGCAGTGTGGTAGCCTAAGATGGACAAAAACAGAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCAT
  3   1   2       bld Ga12 5g3  in                         XL199o03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAACAGTTGGAGACACTAAAAGCAGCATTTGCAGCGACACCAAAACCGACCCGACACATAAGGGAGCAGCTGGCACAGGAGACTGGTCTCAACATGCGAGTCATCCAGGTCTGGTTCCAGAACCGACGATCCAAAGAGAGAAGAATGAAACAGCTGAGCGCACTGGGGGCCCGGAGACACGCCTTCTTCCGCAGCCCCCGAAGGATGAGACCGTTGGTGGACAGATTAGAACCGGGAGAACTCATCCCCAATGGGCCCTTCGCTTTCTATGGAGATTATCAGAGTGAGTATTATGGTCCTGGCAGCAACTATGACTTTTTCCCACAAGGACCCCCATCATCTCAAGCTCAGACTCCTGTAGATTTGCCATTTGTACCTTCTTCTGGGCCTGCAGGAACGCCACTTGGTGCAATGGATCACCCAATCCCTGGACACCACCCATCTAGTGACGCTCAGCGATTTACTGACATAATGTCCCACCCACCAGGAGACTCTCCAAGCCCAGAGCCCAATTTACCAGGTTCCATGCACTCTATGTCTGCAGAAGTTTTTGGACAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGGAGCAGGTTATGTCAACCATTTGTCACACCCACCAGAAATGAATGAAACTGCAGTGTGGTAGCCTAAGATGGACAAAAACAGAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCATGTCAAGGTTTCCTATGGTGTACAGAACT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)