Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8529800.5                      17 PI      79        285     1260                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012841187 Xl3.1-IMAGE:8075102.5.5 - 60 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                               Xl3.1-IMAGE:8075102.5.5 CTGCTAGCGTCGCAGAGGGGCGATATATAAGCGCGCAGTTTCGTGTTTCCGGGTTCCTTCAGTCGCTGCTATGGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCATACTGGCAGATTCGTATGGACCAGCTGAGTGTCGGGGATCAGCTCACCCTCTGTAAGGGCGGCTGCGAAGCTATCGTGGATACAGGAACCTCGTTAATCACCGGGCCGGTAGAAGAAGTGGCAGCTTTGCAGAGAGCTATCGGTGCTATCCCACTGATCCGCGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAGGCATTAGATAAAGGATGTTTTTTTTTATTTTTTTTTTTTTTGGTAGATCAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAGCTCCTCTTTCTTAAAGGGGAACTATCGCAAAAATAAAAGTAAAGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATATAATCTATTAAAAATTTTGCATTATTTCTGAAATAATAAAGTTTATATTC
                                                  Xl3.1-CHK-1012723313       GCGTCGCAGAGGGGCGATATATAAGCGCGCAGTTTCGTGTTTCCGGGTTCCTTCAGTCGCTGCTATGGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCATACTGGCAGATTCGTATGGACCAGCTGAGTGTCGGGGATCAGCTCACCCTCTGTAAGGGCGGCTGCGAAGCTATCGTGGATACAGGAACCTCGTTAATCACCGGGCCGGTAGAAGAAGTGGCAGCTTTGCAGAGAGCTATCGGTGCTATCCCACTGATCCGCGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAGGCATTAGATAAAGGATGTTTTxxxxxxTTTTTTTxTTxxTTGGTAGATCAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAGCTCCTCTTTCTTAAAGGGGAACTATCGCAAAAATAAAAGTAAAGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATATAATCTATTAAAAATTTTGCATTATTTCTGAAATAATAAAGTTTATATTCACTAAA
                                                      consensus depths      2     2     2     2     2     2     3     4     3     4     3     5     9    15    17    20    22    28    25    32    26    32    26    32    31    33    37    37    35    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    38    38    38    38    38    38    38    38    38    37    38    37    38    37    37    37    37    37    37    37    37    37    37    36    37    37    37    35    37    38    38    38    38    38    38    37    37    36    37    36    36    36    36    36    36    36    36    36    36    36    36    35    36    35    36    35    36    35    37    31    36    32    36    27    36    32    35    30    36    30    36    29    36    29    35    28    34    24    31    18    27    11    24    10    22    10    21     7    21     7    20     5    17     6    18     6    18     7    18     6    18     5    18     5    18     5    19     6    18     5    17     6    18     6    16     6    16     7    15     7    13     7    13     8    13     8    13    11    14    11    13    11    13    11    13    10    13    11    13    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    14    12    14    12    14    13    14    12    14    13    14    13    14    13    15    15    16    16    17    16    17    16    17    15    18    16    18    17    19    16    19    14    19    17    19    14    20    14    18    14    16     9    11     6    11     5    10     5    10     3    10     3    10     3    11     3    11     3    11     3    11     3    11     3    11     3    11     3    11     3    11     3    11     3    10     2     8     2     6
  5   1   2       e>3                            Xl3.1-IMAGE:8075102.5 CTGCTAGCGTCGTAGAGGGGCGATATATAAGCGCGCAGTTTCGTGTTTCCGGGTTCCTTCAGTCGCTGCTATGGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCCATACTGGCAGATCGTATGGACCAGCTGAGTGTCGGGGGATCAGCTCACCCTCTGTAAGG
  5   1   2       e>3                            Xl3.1-IMAGE:8463405.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGTAAGGCATACTGGCAGATTCGTATGGACCAGCTGAGTGTCGGGGATCAGCTCACCCTCTGTAAGGGCGGCTGCGAAGCTATCGTGGATACAGGAACCTCGTTAATCACCGGGCCGGTAGAAGAAGTGGCAGCTTTGCAGAGAGCTATCGGTGCTATCCCACTGATCCGCGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAGGCATTAGATAAAGGATGTTCTGCAGACTTTTTTTTTTTTTTTGTAGATCAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAGCTCCTCTTTCTTAAAGGGGAACTATCGCAAAAATAAAAGTAAAGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATATAATCTATTAAAAATTTTGCATTATTTCTGAAATAATAAAGTTTATATTCACT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACTAATATTAA
                                                                   SNP                                                                                                 G-----------
                                                                   SNP                                                                                                             ------TG----
                                                                   SNP                                                                                                                         A-----------
                                                                   SNP                                                                                                                                     T-----------
                                                                   SNP                                                                                                                                                                         -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                         -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                 ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------GC
                                               BLH ATG      70     269 
                                               BLH MIN      70     215 
                                               BLH MPR      22     215 
                                               BLH OVR      70      79 
                                               CDS MIN      70      37 
                                               EST CLI      62      37 
                                               ORF LNG      70       7 
  5   1   2       e>3                            Xl3.1-IMAGE:8075102.5 CTGCTAGCGTCGTAGAGGGGCGATATATAAGCGCGCAGTTTCGTGTTTCCGGGTTCCTTCAGTCGCTGCTATGGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCCATACTGGCAGATCGTATGGACCAGCTGAGTGTCGGGGGATCAGCTCACCCTCTGTAAGG
                                                  Xl3.1-CHK-1012687233       GCGTCGTAGAGGGGCGATATATAAGCGCGCAGTTTCGTGTTTCCGGGTTCCTTCAGTCGCTGCTATGGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCxxxxxxGGCAGATxxxxxGGACCAGCTGAGxxxxxGGGGATCAGCTCACCCTCTGTAAxGGGGGCT
  5   1   2       bld FaBN 5g                         IMAGE:8078719.5p CTGCTAGCGTCGCAGAGGGGCGATATATAAGCGCGCAGTTTCGTGTTTCCGGGTTCCTTCAGTCGCTGCTATGGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCAGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTANGCATGGGGTACCCCAGGATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTAC
  5   1   2       bld Int2 5g                         IMAGE:8527162.5p CTGCTAGCGTCGTAGAGGGGCGATATATAAGCGCGCAGTTTCGGGTTTCCGGGTTCCTTCAGCCGCTGCTATGGCTTCCGCACCGGTGTGGTCGCTGTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTTGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCTTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCCCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCAGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGGATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCT
  5   1   2       bld Brn1 5g3  in                    IMAGE:6956483.5p                              TCGCGCAGTTTCGTGTTTCCTTGCTCCTTCAGTCGCTGCTATGGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTNGAAGAAATTCACTTCCATACGTCGAGTGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGGATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTggggggggAGCTGCTACTGGGGAGGCACAGACCCCCCATATTACACCGGGAAGACTTTCAGCTACATGAAATGTGGACTCCGTAAAGGGCATACCTGGGCCAGAATTCGTTATGGGGACCAACCCTGAAATGTTCCGGGGGAATCTAGCTTCC
  5   1   2       bld FaBN 5g                         IMAGE:8078154.5p                                 GCGCAGTTTCGTGTTTCCGGGTTCCTTCAGTCGCTGCTATGGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTTAAAGGGCAGCTTTTTGCAGAAGCCGTCAAACACCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCACGATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGAATAATGGAGCAAAGCTAGTGAACAGCAACTTCTTTCCTTTCTATCTGAATCGGATCCCAACACCCAGCCTGGGGGAGAGCTGCTTCTGGGAGGCACGACCCCCATTTTTCCTGGAGACTTAGCTCCTGAATG
  5   1   2       bld Egg3 5g                         IMAGE:6326572.5p                                                       GGACGATTCCCGGGGCTTGGCTTCTTCCCAGAGTGGTCGCTTTTATGTCTCTGTCTCCCTTGTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCATACTGGCAGATTCGTATGGACCAGCTGAGTGTCGGGGAATCAGCTCACCCTCTGTAAGGGCGGCTGCGAAGCTATCGTGGATACAGGAAACCTCGTTTATCACCGGGCCCGGNTAGAAAAAAA
  5   1   2       bld Ov1  5g                         IMAGE:6317096.5p                                                                CCACGCGTCCGCTTCCGCACCGGTGTGGTCGCTGTTATGTCTCTGCTGCCTTGTGTTACAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTGGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCTAGGATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGAGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGGGACTCGTAAGGGATACTTGGCAGATTCGTATGGAACAACCTGAATTGTCCGGGGAATTCAGCTCAACCCTTCTGTAAAGGGGCGGGCTGGTGAAAGACTC
  5   1   2       bld Egg3 5g                         IMAGE:6869419.5p                                                                CCCGGGGCATGGCTTCCTACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTTGTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTggggggggAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCATACTGGCAGATTCGTATGGACCAACTGAGTGTCGGGGAATCACCTCACCCTCCTGTAAGGCCGGCTGCGAAGCCTATCGGTGGATAACAGGGAACCTCGGTTAAATCACCGGGGCCCGGTaaaaaaaaaGGGGGCCGCCTTTTGT
  5   1   2       bld Spl  5g3  in                    IMAGE:8463405.5p                                                                 GNTGCTATGGCTTCCGCTCCGGTGTGGTCGCTGCTGTGTCTCTGCTGCCTCCTGTTTCATCCAGGCTCCTCGCTCGTCAGGATCCCGCTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAGATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCAGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGCTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAACCCGAACACCAGCTTGTGGGGGAGCTGCTACTGG
  5   1   2       bld Egg3 5g                         IMAGE:6324832.5p                                                                   TCCCGGGGGCTTCCGCCCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTTGTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGNTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCATACTGGGCAGATTCGTATGGACCAGCTGAGTTGTCGGGGATCAGCTCACCCTCTGTAAGGCCGGCTGCGAGCTATCGTGGATCAGGACCTCGTTATCACCGGCCGGTAGAGAAGTGGCGCTTGCAAGAGCTATCGTGCTATCCCCTGATCCGCGNAAAGAAAGATCTCTGTGAAAATCCATCGCTCCTGTATCACTTCCAT
  5   1   2       bld Ga16 5g                              DN828613.5p                                                                     CTATGGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCNTACGTCNAGTGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCANAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACNATTCTTCCAAATCCTCCACCTATGTGAATNACGGCACTGCGTTCGCCATCCAATATGGCAATGGGA
  5   1   2       bld Egg3                            IMAGE:6869342.5p                                                                      GATTCCCGGGGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTTGTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCCTggggggggAGCTGCTACTGGGGAGGCACAGAACCCACATATTACACTGGGAAACTTCAGCTACATGAATGTGACTCGGAAGGCATACTGGCAGATTCGTATGGACCAGCTGAATGGTCGGGGATCCGCTCACCCTCTGGAAGGGCGGGCTGCCCAAACTATCGGGGGAAACAAGGAACCTCCTTAAATCACCgggggccgggaaaaaaaaggggggggctttggccaaaaaaaCTAATCGGGGGCCTATCCCCACTGGGATCCCCCCGGGAAAAAA
  5   1   2       bld Kid  5g                         IMAGE:7008313.5p                                                                       ATGGCTTCCGCACCGGTGTGGTCGTTGTTATGTCTCTGCTGCCTTGTGTTACAGCCAGGCTCTTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATTGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGGTCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGCTACCCCAGAATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCANAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCCAGACACCAGCCTGGGGGAGAGCTGCTACTGGGAGGCCA
  5   1   2       bld FaBN      in                    IMAGE:8075102.5p                                                                         GGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCAGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGGATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGAGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAA
  5   1   2       bld DMZ                                  xl334a13.5p                                                                         GGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGCTACCCCAGAATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAG
  5   1   2       bld DMZ                                  xl272k24.5p                                                                         GGCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGCTACCCCAGAATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATC
  5   1   2       bld Oo1                             IMAGE:6857697.5p                                                                          GCTTCCGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGTGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGGATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATATGGACAAAGCTAGGGACGCACCTCTTCCTTCTATCGATCGGATCCAACCCCAGCTGGGGGGAGCTGCTACTGGGAGACAGACCCACATATTCACTGGAGATTCAGCTACTGAATGTGACTCGTAAGCATACTGGCAGATCGTATGGACCACCTGAGTGTCCGGGGACAACCTCACCTCTGTAAGGGCGGCTGCCAAACTATCTTGTAACCGGGAACTCGTATCACCGGCGGAAAAAATGCACTTGCAAAACATCGGTATCCATGTCGGGGAAAATGATCTCGGAAAACCACGCTCTGGACAGT
  5   1   2       bld Kid                             IMAGE:7009273.5p                                                                          GCTTCCGCACCGGTGTGGTCGCTGTTATGTCTCTGCTGCCTTGTGTTACAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGCTACCCCAGAATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCANAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGC
  5   1   2       bld Oo1                             IMAGE:6639735.5p                                                                               CGCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGTGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGGATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCANAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTggggggggAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCATACTGGCAGATTCGTATGGACCAGCTGAGTGTCGGGGATCAGCTCACCCTCTGTAAAGGGGGCTGCTGAAATATTATCGATGAATACAAGCAACTTCATTAATCACCCGGGCCGGGTAAAAAGAATAGGCAGCTTTTTTCATAGAGCGGATCGGTGGCTATCCCCACCTGATCCCGCGGAGGAGGAAAATGAATCCTCCTCGGAATAATAATACCATCCGCTTTCCTGGTAGTCAAGGTTTTCACAATTTG
  5   1   2       bld Oo1                             IMAGE:6637989.5p                                                                                GCACCGGTGTGGTCGCTTTTATGTCTCTGCTGCCTCTTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGTGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGGATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCATACTGGCAGATTCGTATGGACCAGCTGAGTGTCGGGGATCAGCTCACCCTCTGTAAGGGGCGCCTGCGAAAACTATCGGTGGATACCGGGAAACCTCGTTAAATCACCGGGGCCCGGC
  5   1   2       bld Egg3                            IMAGE:3378428.5p                                                                                     CCGGGGGTCGCTTTTATGTCTCTGCTGCCTTGTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTA
  5   1   2       bld Ooc2                            IMAGE:3746381.5p                                                                                      TGTGGTCGCTTTTATGTCTCGTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGTGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACACATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATGTGGCAGTAAAAGGGCAGCTCATTGCGGAAGCCGACACACAGCCTGGTATGACATTTGTAGCAGCCAAATTTGATGGTATCTTATGCATGGGCTACCCCAGAATCTCTGTGGATGGAGTCCCTNCTGTGTTTGACGATATCATGGAGCAGAAGCTAGTGGACAGCTACCTCTTCTCTTTCTATTCTGATCGGAATGCAGAC
  5   1   2      seed Ov1                             IMAGE:8329853.5p                                                                                      GTGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCC
  5   1   2       chi Egg3                            IMAGE:6326444.5p                                                                                       TCACAAAATAGTATGTCTCTGCTGCCTCCTGCTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTAGAAGAAATTCACTTCCATACGTCGAGTGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGGACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGCGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGGATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCATACTGGCAGACTCGTATGGACCAGCTGAGTGTCGGGGATCAGCTCACCCCTCTGTAAGGGGGGCTGCGAAGCTATCGTGGACACAGGAACCTCGCTAATCACCGGGCCGGTAGAAGAAGTGGCGGCTTTGCAGAGAGCTATCGGGAGCGATCCCACTGATCCGTGGAGAGAATATGAACCTCCGGCGATAATATCCCCATCGGCTTCCCTGGGCATCAGCTTTCACATTTCGGAAGGTCCGGGTTATTATCCCCCCTGGACAGGGGGAAACAAACATA
  5   1   2       bld Ov1                             IMAGE:8330237.5p                                                                                       TGTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCANAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCCACATATACACTGGAGACTCAG
  5   1   2       bld Ooc2                            IMAGE:3746380.5p                                                                                        GTGGTCGCTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTTGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGTGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTANNGCATGGGTACCCCAGAATCTCTGTCGAT
  5   1   2       bld Ga12      in                         XL196f23.5p                                                                                          GGTCGCTGTTATGTCTCTGCTGCCTTGTGTTACAGCCAGGCTCTTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATATTAGGCATGGGGTACCCTAGGATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGA
  5   1   2       bld Egg3                            IMAGE:6868450.5p                                                                                             GATTCCCGGNGTCTCTGCTGCCTCCTGTTCAGCCAGGCTCCTCGCTCGTCTGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGTGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGCTACCCCAGAATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTggggggggAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCCGCTACATGAATGTGACTCGTAAGGCATACTGGCAGATTCGTATGGACCACCTGAGTGTCGGGGATCAGCTCACCCCTCTGTAAGGGGCGGCTGCGAAAGCTATCGTTGGACACAGGAACCCTCGTTAATCACCGGGGCCGGGTaaaaaaaaGGGGCGGGCTTTTGCAGAAAAGCTATCCGGGGGCTATCCCACGTGATC
  5   1   2       bld Ga15      in                       XL401d03ex.5p                                                                                               CTTTTATGTCTCTGCTGCCTCCTGTTCCAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGT
  5   1   2       bld Ga12      in                         XL144k03.5p                                                                                                        GCTCTGCTGCCTTGTGTTACAGCCGGCTCTTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATATGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATATTAGGCATGGGGTACCCTAGGATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCT
  5   1   2       bld Ov1                             IMAGE:6318049.5p                                                                                                        CTCTGCTGCCTTGTGTTACAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTGGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCTAGGATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGNGGGAGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCATACTGGCAGATTCGTATGGACCAGCTGAGTGTCGGGGATCAGCTCACCCTCTGTAANGGGCGCTGTGAAGCTATCGTGGATACAGGAACCTCGTTAATCACCGGGCCCGNTAGAAGAAGTGGCAGCTTTGCAGAGAGCTATCGGTGCTATCCCACTGATCCGCCGGAGAGTATATGAATCCTCTGNGGATAATATCCCCATCGN
  5   1   2       bld Ov1                             IMAGE:6318156.5p                                                                                                        CTCTGCTGCCTTGTGTTACAGCCAGGCTCCTCGCTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTGGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTCGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTTGTAGCAGCCAAATTTGATGGTATCTTAAGCATGGGGTACCCCAGGATCTCTGGGGGAGGGAGTCCCTCCCTGTGCTTGAACGATATAATGGGAGCAAAAGCTAGGGGAACAGCAACCACTACGTCTTTCCTATCTAGAATCGGGAATCCCAGAAAACCCAGGCCTGTGGGGGAAGAGACTGCTAACTGGGCGAGGGAGCCGGAcccccccccATTATTAACACTGTGGAAAACTCCCAGCGTGACATGGAAAGGGGGAACCTCCGAAAGGCCATAACTGGGCACGAAATTTTGAAGTGGACCTCCTCTGGAAGGGGTCGGGGGGAATCCAGGTTCCGGCCCGCGTGTAAGCgggggggctgggggACACCTCATTCGGCGGCGTGCACGGGGAGCCTCACGCAAAAAACACACAACGCGTCCGCTAATAAACAAAACGGAGCACGCTCTTTCGCGGGACGAAGGCAAGCGGCGGGGGGTGTACTCCCACTGGGAGTCGCCCGCGGAGACAACAAACAGGGAGTCCCCACCGGCGGGGGTAAGAAAGTCGCACCCAGGCGCGTCGGGGGGGTGCTGGTCAGAAGGGCCCCCACGCCTCACGGCGAGAGCGCCGAGGAGAGTGGAN
  5   1   2       bld Int2                            IMAGE:8527841.5p                                                                                                         CTCTGCTGCCTCCTGTTCAGCCAGGCTCCTCGTTCGTCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGTGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCCACATATACACTGGAGACTCAGCTACATGATGTGACTCTAGGCATATGCAGATCGTATGACAGCTGATGTCGGGATACTCACCTCGTAGGCGCTGGAGCTATCTGACCAGACTCGTATCCGGNCGTAAGATGCACTGCAAACTCGGCTCATGTCTG
  5   1   2       bld Ooc2                            IMAGE:3745369.5p                                                                                                                                      GGAATTCCCAGGATCCCACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTAAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGATATAGCCTGCTGGTTGCACCACAAATGCGATTCTTTCAAATACTTCACCTATGTGAATAACGGCACAGCG
  5   1   2       bld Ooc2      in                    IMAGE:3745273.5p                                                                                                                                                      CACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCAGTCCACTGCTCCTTCTGGGATATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCAGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATNTGATGGTATCTTAGGCATGGGGTACCCCAGGATCTCTGTGGATGGAGTCCCTCCTGTGTNTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGGATCCAGACACCCAGCCTGGGGGG
  5   1   2       bld Oo1                    IMAGE:6638988-IMAGp.IMAGp                                                                                                                                                      CACTGAAGAAATTCACTTCCATACGTCGAGTGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCT
  5   1   2       bld Egg6                   IMAGE:4434512-IMAGp.IMAGp                                                                                                                                                      CACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCAGACACCCAGCCTGGGGGGGAGCTGCTACTGGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGC
  5   1   2       bld Lu1                    IMAGE:4632667-IMAGp.IMAGp                                                                                                                                                      CACTGAAGAAATTCACTTCCATACGTCGAGCGATGTCCGATACAGACAAGGATTCACTGAAGCTGAGTGGAAATGAAGCAGCCACCAAATATTCTGCCTTTCCCAAAAGCAACAATCCCACCCCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAA
  5   1   2       bld Ooc1      in                     Ooc1-db25a11.y1                                                                                                                                                                                                                                                              GGGTCGACCCACGCGTCCGCAGAGACCCTGCTGAATTATTTAGATGCACAGTACTATGGGGAGATTAGCATCGGAACTCCTCCTCAGCCATTCACTGTGGTGTTTGACACGGGATCCTCTAACCTCTGGGTGCCCTCGGTCCACTGCTCCTTCTGGGACATTGCCTGCTGGTTGCACCACAAATACGATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCAGTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATCTTAGGCATGGGGTACCCCAGAATCTCTGTCGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTATCTGAATCGGAATCCA
  5   1   2       bld DMZ                                  xl310g03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCTTCCAAATCCTCCACCTATGTGAATAACGGCACAGCGTTTGCCATCCAATATGGCANTGGGAGCCTGACTGGTTACCTGAGCAAGGACACTGTAACGATCGGAGATTTGGCAGTAAAAGGGCAGCTTTTTGCGGAAGCCGTCAAACAGCCTGGTATTACATTTGTAGCAGCCAAATTTGATGGTATATTAGGCATGGGGTACCCTAGGATCTCTGTGGATGGAGTCCCTCCTGTGTTTGACGATATAATGGAGCAAAAGCTAGTGGACAGCAACCTCTTCTCTTTCTAT
  5   1   2       e>3                            Xl3.1-IMAGE:8463405.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGTAAGGCATACTGGCAGATTCGTATGGACCAGCTGAGTGTCGGGGATCAGCTCACCCTCTGTAAGGGCGGCTGCGAAGCTATCGTGGATACAGGAACCTCGTTAATCACCGGGCCGGTAGAAGAAGTGGCAGCTTTGCAGAGAGCTATCGGTGCTATCCCACTGATCCGCGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAGGCATTAGATAAAGGATGTTCTGCAGACTTTTTTTTTTTTTTTGTAGATCAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAGCTCCTCTTTCTTAAAGGGGAACTATCGCAAAAATAAAAGTAAAGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATATAATCTATTAAAAATTTTGCATTATTTCTGAAATAATAAAGTTTATATTCACT
                                                  Xl3.1-CHK-1012689605                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCATACTGGCAGATTCGTATGGACCAGCTGAGTGTCGGGGATCAGCTCACCCTCTGTAAGGGCGGCTGCGAAGCTATCGTGGACACAGGAACCTCGTTAATCACCGGGCCGGTAGAAGAAGTGGCAGCTTTGCAGAGAGCTATCGGTGCTATCCCACTGATCCGCGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAGGCATTAGATAAAGGATGTTxTxxxGACTTTTTTTTTTxxTTxGTAGATCAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAGCTCCTCTTTCTTAAAGGGGAACTATCGCAAAAATAAAAGTAAAGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATATAATCTATTAAAAATTTTGCATTATTTCTGAAATAATAAAGTTTATA
  3   1   2       bld Spl                             IMAGE:8464796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTTTTTTTTTCTGAGCTAATGGTGCCAAGCGTTTGGACTCACACGTTCATTGAGCAATGTGTTTAGCAGGTCCCGATTCGCGAGATCCTCNGGTTGAGAAAAGAGCAAAGTAGGGCAGCACTTTCTCTTTATTGAATCGGATCAGACACCAGCTGGGGGAGCTGTACTGGAGGCACAGACCCACATATACACTGAGACTTCAGCTACATGAATGGACTCGTAAGGCATACTGGCAGATTCGTATGGACCAGCTGAGTGTCGGGGATCAGCTCACCCTCTGTAAGGGCGGCTGCGAAGCTATCGTGGACACAGGAACCTCGTTAATCACCGGGCCGGTAGAAGAAGTGGCAGCTTTGCAGAGAGCTATCGGTGCTATCCCACTGATCCGTGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTAGACCCACAACTTAATAAAGACCCCATAAAGTG
  3   1   2       bld Spl  5g3  in                    IMAGE:8463405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATCTCGTCGATGAGTCCTCTGTGTTGACGATATATGGAGCAAAGCTAGTGACAGCACCTCTTCTCTTTCTATCTGATCGGAATCCAGACACCCAGCCTGGGGGGAGCTGCTACTGGAGGCACAGACCCCACATATTACACTGGAGACTTCAGCTACATGAATGTGACTCGTAAGGCATACTGGCAGATTCGTATGGACCAGCTGAGTGTCGGGGATCAGCTCACCCTCTGTAAGGGCGGCTGCGAAGCTATCGTGGACACAGGAACCTCGTTAATCACCGGGCCGGTAGAAGAAGTGGCGGCTTTGCAGAGAGCTATCGGTGCTATCCCACTGATCCGTGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCCCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTTCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTAGACCCACAACTTACGAAAACGCGCAAGC
  3   1   2       bld Brn1 5g3  in                    IMAGE:6956483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGAGAATCTTTCCGGCTTACCAGGAAATGGTGATCTTCGTTAAGGCCATACCTGGCCAGAATTTCGTATGGACCCAGCTGAAGTGTCCGGGGATTCAGCTCCACCTTCTGTAAGGGGGGCTTGCGAAGCTATCGTGGATACAGGACCCTCGTTAATCACCGGGCCGGTAGAAGAAGTGGCAGCTTGCCAGAGAGCGATCGGTGCTATCCCACTGATCCGCGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAAGGCATTAGATAAAGGATGTCTGCAGACTTTTTTTTTAGACTAATCTTAATTGGTGGATAAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAACTCCCCTTTGTAAAGGGGAACTATTGCAAAAATGTAATACGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATACAATCTATTAAAAAATGAATATCGT
  3   1   2       bld Ga15      in                       XL401d03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGAATGTGACTCGNAAGGCATACTGGCAGATTCGTANGGACCAGCTGAGTGTCGGGGATCAGCTCAGCCTCTGTAAGGGCGGCTGCGAAGCTATCGTGGATACAGGAACCTNGTTAATCACCGGGCCGGTAGAAGAAGTGGCGGCTTTGCAGAGAGCTATCGGTGCTATCCCACTGATCCGCGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTAGACCCACAACT
  3   1   2       bld Ga12      in                         XL144k03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGGCTGCGAAGCTATCGTGGATACAGGAACCTCGTTAATCACCGGGCCGGTAGAAGAAGTGGCAGCTTTGCAGAGAGCGATCGGTGCTATCCCACTGATCCGCGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTACCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCNGACAATTGTAATCATGTATAGAATGTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTAGACCCACAACTT
  3   1   2       bld FaBN      in                    IMAGE:8075102.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAACCTCGTTATCACCCGGGCCGGTAGAAGAAGTGGCAGCTTTGCAGAGAGCTATCGGTGCTATCCCACTGATCCGCGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCAGGTATACTCCCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACACCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAGGCATTAGATAAAGGATGGTTTTTTTTTTAGACTAATATTAACTTGGTAGATCAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAGCTCCTCCTTCTTAAAGGGGAACCATCGCAAAAATAAAAGTAAAGCTTCCTCAAACTGAAGTAAGACACTTTCTCCATATCATCCGATACATCAAATCAAGTTATATCACCATATCACTCGG
  3   1   2      seed Ooc2      in                    IMAGE:3745273.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGTGGCAGCTTTGCAGAGAGCTATCGGTGCTATCCCACTGATCCGCGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCAGGTATACTCCCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACACCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAGGCAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ga12      in                         XL196f23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCGCGGAGAGTATATGATCCTCTGTGATAATATCCCATCGCTTCCNGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTAAA
  5   1   2       bld Egg1                               PBX0041F07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGATAATATCCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAAATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAA
  5   1   2       bld Egg1                               PBX0041E06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCGGGTATACTCTCTGACTGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTTCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTAAAGAATGTTTATTTATCGGAGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTA
  3   1   2       bld Ov1                             IMAGE:8327860.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCATCGCTTCCTGTCATCAGCTTCACATTTGGAGGTCAGGTATACTCCCTGACAGGGGAACAGTATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTTTCCATTAAACGACTAACACCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAGGCATTAGATAAAGGATGGTTTTTTTTTAGACTAATATTAATTGGTAGATCAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAGCTCCTCTTTCTTAAAGGGGAACCATCGCAAAAATAAAAGTAAAGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATATAATCTATTAAAAATTTTGCATTATTTCTGAAATAATAAAGTTTATATTCACTAAAAAAAAAAAAAAAG
  3   1   2       add Ga18      in                      xlk166g05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACGCGTCCGATGTCCTAAAAATATCAAAGNCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTNNGNNNAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTNNACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGNTTTCTCTTTTATAGGGCTCTTAGCCNNNANCNNTAATA
  5   1   2       bld Ga18      in                      xlk166g05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGTCCTAAAAATATCAAAGGCTGGTCGCACCGTCTGCCTCAGTGGCTTCTTGGGCCTTGACATTCCTCCTCCAGCCGGGCCCCTCTGGATTATTGGAGATGTTTTTATTGGCCAATATTACACTGTTTTTGACCGTGCTAACGACCGCGTGGGTTTTGCTAAAGCAAAGTAATCTCCCTCTTCTCCCTTTAAAGGTCTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAAGGCATTAGATaaaaaaaaaa
  3   1   2      shim Egg6                            IMAGE:4434512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAAAATATCAAAAGGCTGGTGGCACCTTCTCCTCAAGTGCTTTTTTGGCCCTGACATTCCTCCTCCAGCCCGGCCCCTTTTGGATTATTGAAGATGTTTTATTTGCCCAATATTACACTGTTTTTGACCGTGCTAACACCCGCGTGGGTTTTGCTAAAGCAAAGTAATCTTCCTCTTCTCCCTTTAAAGGTGTATTTCTCCATTAAACGACTAACCCCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCTCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGACCTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAAGGCATTAGATAAAGGATGTCTGCAGACTTTTTTTTTTTTTTTTAGACTAATCTTAATTGGTGGATAAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAACTCCCCTTTGTAAAGGGGAACTATTGCAAAAATAAATGTAATACGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATACAATCTATTAAAAAATCTGTATC
  5   1   2       bld Egg4      in                    IMAGE:3744053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAATTCCTAACACCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAGGCATTAGATAAAGGATGtttttttttAGACTAATATTAATTGGTAGATCAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAGCTCCTCTTTCTTAAAGGGGAACTATCGCAAAAATAAAAGTAAAGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATATAATCTATTAAAAATTTTGCATTATTTCTGAAAT
  5   1   2       bld Egg4                   IMAGE:3744053-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAACACCACAAAATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAGGCATTAGATAAAGGATGtttttttttAGACTAATATTAATTGGTAGATCAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAGCTCCTCTTTCTTAAAGGGGAACTATCGCAAAAATAAAAGTAAAGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATATAATCTATTAAAAATTTTGCATTATTTCTGAAATAATAAAGTTTATATTCACTaaaaaaaaaaaaaaa
  3   1   2       bld Ooc1      in                     Ooc1-db25a11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATCAACCTGCCCTAAAATGCATTGAAGCATAATGTTCCCTTAGTCTGCACTGCTGACAATTGTGAATCATGTATAGAATGTTCATTCATCGGCGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAAGGCATTAGATAAAGGATGTCTGCAGACTTTTTTTTTTTTTTAGACTAATCTTAATTGGTGGATAAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAACTCCCCTTTGTAAAGGGGAACTATTGCAAAAATAAATGTAATACGCTTCCTCAGACTGAAGTAAGAAATTTTCTAAATACAATCTATTAAAAAATCTGTATCGTTTCTGAAATAATAAAGTTTATCTTCACTATTCCTCAAAAAAAAAA
  3   1   2       add Lu1                             IMAGE:4632667.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCTCCCCTGCTGCCAATTGTGAATCATGTAAAGAATGTTTATTTACCGGTGCCTAGATTTCTCTTTTATAGGGCTCTAAGACCCCCAACTTTAATAAAATGACCCCGCACTAAAAAGGCATTATATAAAGGATGTCTGCAAACTTTTTTTTTTTTTTTTAGACTAATCTTAATTGGTGGATAAATTAACTTCAACCTCATGTTTCGGTAGTACTGGTACTTAANCTCCCCAAAAAAAAAAAGAACTACCCCCAAAAAAAAAAAAATACGCTTCCTCAAAAAAAAGTAAGAAACTTTCTAAATACAATCTATTAAAAAATCTGTATCGAAACAGAAATAATAAAGTTTATCTTCACTA
  5   1   2       bld Ga18      in                      xlk125k04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGTGAATCATGTATAGAATGTTTATTTATCGGTGCCTAGATTTCTCTTTTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAAGGCATTAGATAAAGGATGTCTGCAGACtttttttttttttttAGACTAATCTTAATTGGTGGATAAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAACTCCCCTTTGTAAAGGGGAACTATTGCAAAAATAAATGTAATACGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATACAATCTATTAAAAAATCTGTATCGTTTCTGAAATAATAAAGTTTATCTTCACTaaaaaaaaaa
  3   1   2       bld Egg4      in                    IMAGE:3744053.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTATAGGGCTCTTAGACCCACAACTTTAATAAAATGACACCGCACTTAAAGGCATTAGATAAAGGATGTTTTTTTTTAGACTAATATTAATTGGTAGATCAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAGCTCCTCTTTCTTAAAGGGGAACTATCGCAAAAATAAAAGTAAAGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATATAATCTATTAAAAATTTTGCATTATTTCTGAAATAATAAAGTTTATATTCACTAAA
  3   1   2      shim Ga18      in                      xlk125k04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ANNNGTGGATAAATTAACTTAAATTTGATGTTTCGGTAGTACTGGTCCTTTAACTCCCCTTTGTAAAGGGGAACTATTGCAAAAATAAATGTAATACGCTTCCTCAAACTGAAGTAAGAAACTTTCTAAATANA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)