Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 09 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

1% 1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%
Application error: Error while executing statement.
22001 [Microsoft][ODBC SQL Server Driver][SQL Server]String or binary data would be truncated.

Use your browser's 'Back <==' button to return to the previous page, where you may be able to correct the problem.
There may be more error messages further down this page - print, save, or cut&paste these messages if you want to pass them on.
1012069883 Xt7.1-XZT39236.3 - 1785 ESTs .........-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860... ? ? ? ? ? ? ? ? Xt7.1-XZT39236.3 TTGTCCCGCTTTGCCGGGTATATAAAGGCGCACTGGCACTCCGTTCGTGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCATTCCTCCATCTTTGATGCTGGAGCTGGAATTGCACTGAACGATAACTTTGTGAAGCTGGTTTCCTGGTATGATAACGAGTGTGGCTACAGCCACCGTGTTGTGGATCTCATGTGTCACATGGCCTCTAAGGAATAAGCACTTACCTGTCGCCCCACCAACCCCTCTCTGTCACTGAAGGGGCCCAGAGTCACAATCCCATCCTGGTAGTTTGTCTGTGTCACTGTTTCTGTGTTACTAAATAAAACAATGAAACATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Xt7.1-CHK-1008221068 CGCTTTGCCGGGTATATAAAGGCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCATTCCTCCATCTTTGATGCTGGAGCTGGAATTGCACTGAACGATAACTTTGTGAAGCTGGTTTCCTGGTATGATAACGAGTGTGGCTACAGCCACCGTGTTGTGGATCTCATGTGTCACATGGCCTCTAAGGAATAAGCACTTACCTGTCGCCCCACCAACCCCTCTCTGTCACTGAAGGGGCCCAGAGTCACAATCCCATCCTGGTAGTTTGTCTGTGTCACTGTTTCTGTGTTACTAAATAAAACAATGAAACATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA consensus depths 6 7 6 7 8 11 13 21 94 115 144 172 362 396 510 531 532 563 601 621 659 681 697 714 729 744 743 753 735 756 737 764 749 771 765 778 767 783 773 789 775 791 781 800 788 806 795 818 797 822 802 823 800 825 801 829 823 842 829 857 864 889 893 932 900 942 926 959 946 996 974 1044 984 1082 1080 1115 1128 1162 1142 1188 1241 1298 1295 1344 1318 1354 1336 1374 1343 1384 1355 1398 1363 1412 1379 1430 1397 1448 1502 1545 1503 1550 1494 1552 1511 1564 1537 1576 1514 1560 1516 1558 1497 1564 1508 1557 1492 1552 1484 1546 1482 1544 1467 1535 1464 1531 1454 1524 1437 1516 1371 1516 1419 1501 1368 1446 1307 1417 1289 1395 1294 1380 1221 1345 1226 1321 1174 1291 1202 1276 1151 1221 1072 1159 1036 1100 990 1050 981 1039 970 1029 975 1016 952 1001 943 993 944 970 934 964 925 955 891 937 891 935 900 937 902 936 890 930 893 920 881 916 871 915 817 907 854 897 853 884 790 832 702 752 671 730 676 716 241 317 244 259 33 50 10 23 SNP T----------- SNP -------T---- SNP -T---------- SNP -------G---- SNP ----------T- SNP ----------C- SNP ----------G- SNP ---------T-- SNP ----G------- BLH ATG 107 2144 BLH MIN 83 202 BLH MPR 83 202 BLH OVR 107 77 EST CLI 64 61 ORF LNG 107 6 PROTEIN === Ci ==== 8e-071 AAX68527.1 glyceraldhyde 3-phosphate dehydrogenase [Ciona intestinalis] ===================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Sc ==== 1e-124 NP_012483.1 Glyceraldehyde-3-phosphate dehydrogenase 1; Tdh1p [Saccharomyces cerevisiae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PREDICTED = Sp ==== 5e-143 XP_001175520.1 PREDICTED: similar to glyceraldehydephosphate dehydrogenase [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================= PROTEIN === Ce ==== 6e-146 NP_508534.3 this gene has features of an operon and a polycistronic transcript, encodingmai-1: Mitochondrial ATPase Inhibitor family, and three glyceraldehyde3-phosphate dehydrogenases: gpd-2, gpd-3 and a mosaic form of these two GPD.,Glyceraldehyde 3-Phosphate Dehydr =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Dm ==== 2e-146 NP_525091.1 Glyceraldehyde 3 phosphate dehydrogenase 2 CG8893-PB [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================= PREDICTED = Dr ==== 4e-162 XP_684297.1 PREDICTED: similar to glyceraldehyde-3-phosphate dehydrogenase isoform 1 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN -== Hs ==== 1e-164 NP_002037.2 glyceraldehyde-3-phosphate dehydrogenase [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Mm ==== 1e-167 NP_032110.1 glyceraldehyde-3-phosphate dehydrogenase [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Gg ==== 3e-170 NP_989636.1 glyceraldehyde-3-phosphate dehydrogenase [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === ?? ==== 3e-175 NP_001080567.1 glyceraldehyde-3-phosphate dehydrogenase [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PREDICTED = Xl ==== 1e-177 AAH43972.1 similar to glyceraldehyde-3-phosphate dehydrogenase [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Xt ==== 0 CAJ82888.1 glyceraldehyde 3 phosphate dehydrogenase [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== Xt7.1-XZT39236.3 TGA---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------TAA---------------------------------------------------------------------TAG---------------------------------------ATG ORF [ open reading frame ] 0 1 1 TpA FL TTpA012e21.FL-Sanger AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCATTCCTCCATCTTTGATGCTGGAGCTGGAATTGCACTGAACGATAACTTTGTGAAGCTGGTTTCCTGGTATGATAACGAGTGTGGCTACAGCCACCGTGTTGTGGATCTCATGTGTCACATGGCCTCTAAGGAATAAGCACTTACCTGTCGCCCCACCAACCCCTCTCTGTCACTGAAGGGGCCCAGAGTCACAATCCCATCCTGGTAGTTTGTCTGTGTCACTGTTTCTGTGTTACTAAATAAAACAATGAAACATCAAAAAAAAAAAAAAAAAAAAAAAAA 5 1 1 Abd0 FLq IMAGE:7017410.FL-MGC CGAGTGCGACTGGGCTCTCGTGAGTCTTCTAGAGACTTCTCTCATTAAAATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCATTCCTCCATCTTTGATGCTGGAGCTGGAATTGCACTGAACGATAACTTTGTGAAGCTGGTTTCCTGGTATGATAACGAGTGTGGCTACAGCCACCGTGTTGTGGATCTCATGTGTCACATGGCCTCTAAGGAATAAGCACTTACCTGTCGCCCCACCAACCCCTCTCTGTCACTGAAGGGGCCCAGAGTCACAATCCCATCCTGGTAGTTTGTCTGTGTCACTGTTTCTGTGTTACTAAATAAAACAATGAAACATCAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 1 2 11 bld Te1 5g3 in CBWN13725.b1 GGATGCGCTTCTTTTAGCAGCGTTACGGGAACAGCACGTAGGCATTCTAACGGTGTCAGGCTGAGGGGGCGGGGCGCTCTATCTGCTCACGCCACGATTTGTCACTGATTGTTGGTGGGCGGGGTTACATTGTCCCGCTTTGCCGGGTATATAAAGGCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAA 5 1 2 bld Neu TNeu046o07.p1kSP6 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACAGTCTTCCAAGAGTAAGTGAGGTGGTGGCTCAGTCCTGGCCTGGTTCTAGACTGGGTTCCTGCAGCAGAATCTAATCACAGGGGGGATGTTTACAGTTCTCTCCTCTCCCCAGGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACT 5 1 2 bld Te5 in CAAO3606.5p GGTTACATTGTCCCGCTTTGCCGGGTATATAAAGGCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGT 5 1 2 bld Te5 in CAAO8334.5p GGTTACATTGTCCCGCTTTGCCGGGTATATAAAGGCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCACCCCAAATGTCT 5 1 2 bld Te5 in CAAO8496.5p GTTACATTGTCCCGCTTTGCCGGGTATATAAAGGCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTTCGTGT 5 1 2 14 bld Te5 5g3 in CAAO1792.5p ............................................................................................................................TTACATTGTCCCGCTTTGCCGGGTATATAAAGGCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGGCAACTGACAGGAATGGCTTTCCGTGT 5 1 2 14 bld Te5 5g3 in CAAO2209.5p ............................................................................................................................TTACATTGTCCCGCTTTGCCGGGTATATAAAGGCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTG 5 1 2 bld Tad0 5g IMAGE:6985329 AGGCAGGGGGCTGAGTACCGGGGTCCGGAATTCCCGGGGATGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTTCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCNAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCACCTCAATGTCTCCGTTGTGATCTGACCTGCGTCTGTCAAGCTG 5 1 2 10 bld Spl1 5g3 in CABK1540.5p .....................................................................................................................................................CACCTGCGTGCCCTCTTGTGGACCCCTGTTCCCCGTGCCCCCCCCCACACAAGGTGTGGGGTTTGCCCCCTCTATAGTTACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 10 bld Te1 5g3 in CBWN17547.b1 ......................................................................................................................................................ATAAAGGCGCACTGGCAATCTGTTCGTCACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAG 5 1 2 14 bld Te5 5g3 in CAAO9913.5p .......................................................................................................................................................TAAAGGCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCCTCACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAACTGACAGGAATGGCTTTCCGTGTCCCCACCCAAATGT 5 1 2 24 bld Te5 5g CAAO11673.5p ............................................................................................................................................................GCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCT 5 1 2 14 bld Te5 5g3 in CAAO1298.5p ............................................................................................................................................................GCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCNAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAGTATGATGACATCAAGGCT 5 1 2 bld Te5 in CAAO4066.5p GCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGNATCTGACCTGCCGTCTGTCCAAGCCTGCCNAGTATGATGACATCAAGGCTGCCCAT 5 1 2 14 bld Te5 5g3 in CAAO6008.5p ............................................................................................................................................................GCGCACTGGCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGG 5 1 2 bld In60 5g IMAGE:8947652.5p AGACTACCTTAATTCGCCCGAGCACACACGTATTCTAATTCGTCCCGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGATGGCAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTGTGATCTGACCTGCCGTCTGTCAAGCCTGCCAGTATGATGACATCAAGCTGCCATTAGACTGCAGCACTTGGCCCATGAAGGAAATCCTGTAATAACTAGAAGAACTAGTTGTCCCACTGAACTCAATGGGACACTCATTCTCACTCTTTGAAGTCTGGGA 5 1 2 15 bld Met4 5g3 in CUNC503.5p ..............................................................................................................................................................TCGGTCGGATTCCGGGTCGACCACGCGTCCGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGAGTTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCCTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGAGCAGTGTATGTGGTGCAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGACATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCACAACACTGTGGATGGCCCATCTGGCAAGATGTGCAGAGATGAAAGACGTGCCGGTCAGAACATCATCACTGCCTCAACTG 5 1 2 14 bld Met4 5g3 in CUNC570.5p ..................................................................................................................................................................CGGTCGGATTCCCGGGTCGACCCACGCGTCCGCAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACA 5 1 2 14 bld Met2 5g3 in CUNH564.5p ...................................................................................................................................................................CGGTCGGATTCCCGGGTCGACCACGCGTCCGCAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCA 5 1 2 bld In66 5g IMAGE:8962410.5p ACTTTTAATATTTTTGAAGTTTTAATTTTTTAATAATTTCCCGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCAAATGTCTCCGTTGTGATCTGACTGCGTCTGTCAAGCTTGCAAGTATGATGACTCAGCCTGCAATAGACTGCAGCACATGCTCAATGAAAGGGAATCCTGGCATACTCCAGGAGGATCCTAGGT 5 1 2 bld Te5 in CAAO4121.5p GCACTCCGTTCGTCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCCAGTATGATGACATCAAGGCTGC 5 1 2 14 bld Met2 5g3 in CUNH1276.5p ......................................................................................................................................................................TCGGTCGGATTCCGGGTCGACCCACGCGTCCGCCCACGCGTCCGTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCC 5 1 2 14 bld Met2 5g3 in CUNH1520.5p ......................................................................................................................................................................TCGGTCGGATTCCGGGTCGACCCACGCGTCCGAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACAC 5 1 2 chi 1030 5x IMAGE:7028624.5p ACCCCCCCGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAAAGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAAAATTAAGTGGGGCGATGCTGGAGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAGAGAAGGCCGGTTTGCACTTGAAAGGGAGGTGGCTAACGTGGTCATTATTCTCTGCCCCCCTCCATCTAGATGGCCCCCATGGTTTGGTTGGTTGGGGGTTAAACCAAGGGACAAATAATGATAAACTACTCCGTCCCCGGATAGTTACAGAAAAAGTAAATTCTTGGTAAATAAACAAATAGGGTGCTGGGGATTTCCTCTCTTTGGTCAAATAGGGGTAAATTACAAATGGGATAAAACAATTAGTTGGGGGATATTCCTGCTGGAAGGGGAGGAAACTAGGAATAGGAGAAACTATATCCAAGTTAANATAATTTGCGCTTGTTCTTCAAAACAATGAAGCGGAANACACGCCACAATAAAACAGGAGAAGGAGATAGTGAGACTACAGGGGAGTGGCCCTCAACTAATTACGGAGGGGGGGGATGATAAGCAACATATGGTTGGGAAAAAAAAAAATTTCAGAATGGACATTTGATAAAAATGAGGCACGCCCCGGGGAGATTAGAAAAAAAACAGACTTTATATAAAATTAATGTATGTATGATACCATCGTGTATTTTTTGTGACAGGATCTTCAAAAATAATAGTAGAATTTATTGTACACTATTGTAAAAAATAAGTGTTCATACTTCCTTCGCGTAATAGTAACGTCAGATAATTGTGAGGCATAGAATATAGATAATCTAGGGCGGTGAGGGGTGAGGAGTTTATTTTCAAGTGTGTGATGGACNCATNTAGACATGAGAAAGGGGGAGTTCTCTGTAGATAGGGTATGGGTATGTTAGTAAGATGGTGAGATAGATTAGCACGTTTCATCGTGACAGAAACCAATAGCAGNGCGTATAGAGTAAGAAGATACGCAAAAGATATCGAGAGGTAGNATGCCCATTTTCAAAGAAA 5 1 2 10 bld Te1 5g3 in CBWN2735.b1 .........................................................................................................................................................................ATGGGGTTACTGTATTAGTGGCTAAGGATGGGATGGTGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAG 5 1 2 bld BrSp 5g3 in EC2BBA21BB01.g1 CCGGGGAACTCTGCAACAGGGCACAGAAACGAGTGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTC 5 1 2 10 bld Tail 5g3 in CBSW11888.b1 ...........................................................................................................................................................................ATTCGCTCGACCCACGCGCTCCGCAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCA 5 1 2 bld Abd0 5g3 in IMAGE:7000072 CTTGGACTTGACAGTTCGGCCGGAATTCCCGGGATGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGGCTTCCGTGTNCCCCACCCAATGTCTCCGTTGTGGATCTGNACTGCCGTCTGTCCAGCCTGCCAGTATGAGACA 5 1 2 24 bld Met2 5g CUNH570.5p ............................................................................................................................................................................CGGTCGGATTCCCGGGTCGACCCACGCGTCCGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAGCCTGCCAAGTATGATGAC 5 1 2 bld BrSp 5g3 in EC2BBA10BA02.g1 GGGACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAG 5 1 2 bld BrSp 5g EC2BBA10BB05.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATG 5 1 2 bld BrSp 5g3 in EC2BBA12AE02.g1 GGGACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCC 5 1 2 bld BrSp 5g3 in EC2BBA12AH05.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCC 5 1 2 bld BrSp 5g3 in EC2BBA13DC11.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAAACTGTGGATGGCCCA 5 1 2 bld BrSp 5g3 in EC2BBA14AB06.g1 GGGACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCC 5 1 2 bld BrSp 5g3 in EC2BBA14CA08.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGC 5 1 2 bld BrSp 5g3 in EC2BBA14DF08.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCAT 5 1 2 bld BrSp 5g3 in EC2BBA15AB04.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGC 5 1 2 bld BrSp 5g3 in EC2BBA15CE05.g1 GGGACTCTGCAACAGGGCACAGAAACGAGTGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTG 5 1 2 bld BrSp 5g3 in EC2BBA16DB09.g1 GGGACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCAT 5 1 2 bld BrSp 5g3 in EC2BBA16DH08.g1 GGGACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTCGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAAACTGTGGATGGCCCATCTGGCAAGCTGTGG 5 1 2 bld BrSp 5g3 in EC2BBA17BE05.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATG 5 1 2 bld BrSp in EC2BBA17CD01.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATC 5 1 2 bld BrSp 5g3 in EC2BBA17CH07.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGC 5 1 2 bld BrSp 5g EC2BBA19AH09.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCGAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCACCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGG 5 1 2 bld BrSp 5g3 in EC2BBA19BA07.g1 GGGACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCCTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGGACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGT 5 1 2 bld BrSp 5g3 in EC2BBA20AH02.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCCTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGC 5 1 2 bld BrSp 5g3 in EC2BBA21BA01.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTT 5 1 2 bld BrSp 5g EC2BBA21BF05.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGC 5 1 2 bld BrSp 5g3 in EC2BBA21CC01.g1 GGGACTCTGCAACAGGGCACAGAAACGAGTGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGT 5 1 2 bld BrSp 5g3 in EC2BBA23BB10.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCGTCTGGCAAGCTGTGGAGAGATGGCAGAGGT 5 1 2 bld BrSp 5g3 in EC2BBA23BG01.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGC 5 1 2 bld BrSp 5g3 in EC2BBA23DB04.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCAC 5 1 2 bld BrSp 5g EC2BBA23DC10.g1 GGGACTCTGTAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAG 5 1 2 bld BrSp 5g3 in EC2BBA24CH11.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTG 5 1 2 bld BrSp 5g3 in EC2BBA24DE10.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCT 5 1 2 bld BrSp 5g EC2BBA26AA09.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGC 5 1 2 bld BrSp 5g3 in EC2BBA26CC03.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATC 5 1 2 bld BrSp 5g3 in EC2BBA27AA04.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCCTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGG 5 1 2 bld BrSp 5g3 in EC2BBA27BF02.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACT 5 1 2 bld BrSp 5g3 in EC2BBA27DB09.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCAC 5 1 2 bld BrSp 5g3 in EC2BBA28AG04.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACT 5 1 2 bld BrSp 5g3 in EC2BBA28BF08.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGTAGGTGCCTATCGTGTCATTATCTCTGCCCCC 5 1 2 bld BrSp 5g3 in EC2BBA28DB01.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGGCAGCTGTGGAGAGGTGGC 5 1 2 bld BrSp 5g3 in EC2BBA29BG03.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGACTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGG 5 1 2 bld BrSp 5g3 in EC2BBA29DB12.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTTATCAATGACAACTTTGGCAT 5 1 2 bld BrSp 5g3 in EC2BBA30AH01.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCT 5 1 2 bld BrSp in EC2BBA30DD12.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCA 5 1 2 bld BrSp 5g3 in EC2BBA31CA09.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAAACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAG 5 1 2 bld BrSp 5g3 in EC2BBA32CD04.g1 GGGACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGG 5 1 2 bld BrSp 5g EC2BBA32DD05.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCA 5 1 2 bld BrSp 5g3 in EC2BBA32DF03.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTG 5 1 2 bld BrSp 5g EC2BBA32DG08.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCT 5 1 2 bld BrSp 5g EC2BBA32DH06.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTC 5 1 2 bld BrSp 5g EC2BBA33DG01.g1 GGGACTCTGCAACAGGGCACAGAAACGAGTGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCA 5 1 2 bld BrSp 5g3 in EC2BBA34BC12.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCC 5 1 2 bld BrSp 5g3 in EC2BBA34CH12.g1 GGGACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCA 5 1 2 bld BrSp 5g3 in EC2BBA35BD10.g1 GGGACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCT 5 1 2 bld BrSp 5g3 in EC2BBA7CB08.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCA 5 1 2 bld BrSp 5g3 in EC2BBA8AC08.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCCACCCCAAATGTCTCCGTTGTGGATCTTGACCTGCCGTCTGTCCA 5 1 2 bld BrSp 5g3 in EC2BBA9AB08.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCAT 5 1 2 bld BrSp 5g3 in EC2BBA9AC01.g1 GGGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGC 5 1 2 bld In66 5g IMAGE:8964123.5p ATTTTTTTAACAAATACTTTTTATAAAATCGTCCGTTGATACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCACCCAAATGTCTCCGTTGTGATCTGACTGCGTCTGTCAGCCTGCCAGTATGATGACATCAGCTGCATTAGACTGCAGCACATGCCCATGAGGATCTGTAATACACAGAAGACAGTGTCTCACTGACTCCATGTGAACCTCATTCCCTCATCTTTGAATGGCTTGGGA 5 1 2 10 bld Limb 5g3 in CBSU2110.fwd ...............................................................................................................................................................................TCCGCGGACGCGCTGGGGGCGGACGCGCTGGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACGGGAATGG 5 1 2 10 bld Tail 5g3 in CBSW10804.b1 ...............................................................................................................................................................................GCGGACGCGTGGCAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACC 5 1 2 bld BrSp 5g3 in EC2BBA30DG10.g1 GGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGATGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCG 5 1 2 bld 1030 5g IMAGE:7029105.5p GCACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGGACACTTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAAAAAGACTGGTGGATGGGCCCATCTGGGCAANCTGTGGAAGAGATGGCAAAAGTGCCCGGTCAGAACATCATCCCTGGCCCTCAACTGGGGGCAACAAAAGGCTGTTTGGGGAAAATCATCCCCTGGACCTGAAATGGGCAAACTGGACCAGGAAAGGGCTTTTCCGGTGGTCCCCCAACCCCCAATGGGCCCCCGTTGGGGG 5 1 2 10 bld Tbd1 5g3 in CBXT20354.b1 ................................................................................................................................................................................CGACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTTTTGATAGCGGCAAATGCGACGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCATGGCCGATTCAAGGGAACAGTGAAGGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAATCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCAGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGAGAACTCTCTTCAAGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACTGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCT 5 1 2 bld HeRe 5g3 in EC2CAA10AD03.g1 GACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGC 5 1 2 bld HeRe 5g3 in EC2CAA10BF06.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAGGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAAAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACTAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGC 5 1 2 bld HeRe 5g3 in EC2CAA13CD05.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTCGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGG 5 1 2 bld HeRe 5g3 in EC2CAA16AA12.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACCGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCA 5 1 2 bld HeRe 5g3 in EC2CAA19AF10.g1 GACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGGCAGCTGTGGAGAGATGGCAGAGGTGCCGGTC 5 1 2 bld HeRe 5g3 in EC2CAA19DH03.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATG 5 1 2 bld HeRe 5g3 in EC2CAA20CC11.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCC 5 1 2 bld HeRe 5g3 in EC2CAA25CC01.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAAGTGCCGGTCAGAACATCA 5 1 2 bld HeRe 5g EC2CAA25CG05.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACC 5 1 2 bld HeRe 5g3 in EC2CAA33AH01.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCCTCACTGGTGCAGCAAAGGCTGTTGGGAAAGTCA 5 1 2 bld HeRe in EC2CAA33BB12.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGC 5 1 2 bld HeRe 5g3 in EC2CAA34DC03.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGGGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGC 5 1 2 bld HeRe 5g3 in EC2CAA36DG10.g1 GACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTC 5 1 2 bld HeRe 5g3 in EC2CAA37BC12.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACACCATCCCTGCC 5 1 2 bld HeRe 5g3 in EC2CAA3AC06.g1 GACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAAACTGTGGATGGCCCATCTGGCAAGCTGT 5 1 2 bld HeRe 5g3 in EC2CAA40AH10.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGACTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCGAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGC 5 1 2 bld HeRe 5g3 in EC2CAA40CF05.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGG 5 1 2 bld HeRe 5g3 in EC2CAA44BD02.g1 GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAGTCAATGACC 5 1 2 bld HeRe 5g3 in EC2CAA4CB06.g1 GACTCTGCAACAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCTACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGG 5 1 2 bld 1030 5g IMAGE:7091216.5p AACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGGCACCCAGAGACTGTGGATGGCCATCTGGCAGCTGTGNAAGATGGCAAAGTGCCGTCAN 5 1 2 bld 1030 5g IMAGE:7093195.5p GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAAGGACTGATGACTACCGTCCATGCCTTTCCTGCCACCCAGAAGACTGTGGATGGCCT 5 1 2 bld 1030 5g IMAGE:7028948.5p GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAAGGACTGATGACTAACGTCCATGCCTTCACTGCCACCCAAAAAACTGTGGATGGCCCCTCTGGCAAGCTGTGGGAAAGAATGCAAAAGTGGCCGGTCAAAAACATCATCCCTGGGCTCAACTGGTGCAACAAAAGGCTGTTTGGGAAAAATCATTCCCTGGAGCTGAAAGGGCAAACTGACAGGGAATG 5 1 2 bld 1030 5g IMAGE:7026456.5p GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGGATGGCCCATCTGGCAAGCTGTGGAAAGATGGCAAAAGTGCCGGTCAAAACATCATCCCTGCCTCAACTGGTGCAACAAAGGCTGGTGGGGAAATCATCCCCGAACTGAAGGGCAAAACTGAAAGGAAATGGCTTTTCCGTGTCCCCACCCCAAAATGTCCTCCCGTTGTGGGATATGAAACCTGCCCGTTCTGGTCCAAGAGCCTGGCCAAGGATGGAATGAACATCCAAGGGCGGGGCCCTTTTAAAAAATCGCCCGACACATTGGA 5 1 2 chi 1030 5x IMAGE:7027741.5p GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAAGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCACTGTATGTGGTGGAATCTACTGGAGTCTTCATAACCAAAGAGAAGGCCGGTTTTGCACTTGAAGGGAGGTGCCAAGCGGGTCAATTATCTACTGCCCCCATCAGACTGAAGCCCCCATAGTTTGTATGTTGGGGGGGAAACCATTGACAAAGTAAGAATAACTCCTCTTCACCGTTGTTCTCGCAACGCAATGCTTGCCAAAACACGACTTGGCCTGGGATTCCTTCTCGCAAAAAGGTTAATCAAATGGAACAACCTTTTTGGGCAATCCCTGTTAAAGGCACATGTATGAAATTAATCAATCACGAGGGCCTTTTCCACTGGCTATCCTATAAAAGAAATAGGTGGTGAATAGGAACCACATCTCGGGGCTGATGCCTGGTTTTGTATAAAGATTGTACCAAAAAATTGGCCCGGGATTCAGAAAACAGTTGCAATCCCGCGTTGCCGTACAAACCTGGGGGGAGCTTTATCATAAAGGCTCCGTTCTGGCGGAGAAAAGGTTTGCATCACTTCTGAGAAACCTTGTAAATATGTGGCTCAATTAATGAAATCTATGGTAATATGGATTTGT 5 1 2 bld 1030 5g IMAGE:7028508.5p GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCACTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGACAACTCTCTTTACGTTGCCAACAACGCATTCCTGCAAAACCAACTGCCTTGGCTCCCCCTTTGCAAAGGTTTATCAATAGACACACTTTTGGCCATCCCGAGATGGATCTGAACGCCCTACCTTATTCTTGCCCTTTCAATGCCCACCCCCGAAAAAACCTGTGCGATTGGGCCCATCTCTGGGCTAAGCCCCGCGTAAAAAAAAAGGGCCTAAAAGGTTCCCCGGTTATAGAATATATACGCGCCCCTTGGCCTCATAATATTGCCCTTGCTCTTTAATAGCGGCCGACTGTGCGTAAAAAATTATCCTCCTTCCCGGGAAATCTTTAGAAAGAGGGATTACAAAATATAGTTCTTTTGCGCTAAAAGGGGGGATTTATATTCCCATGTGGGGCCCCCCCCCAAACTAG 5 1 2 bld 1030 5g IMAGE:7091448.5p GACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCAN 3 -1 2 bld Tail CBSW1618.g1 TCGCGATCTAGAACTAGCAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCC 5 1 2 bld 1030 5g IMAGE:7030555.5p ACTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAAAAGTGCCGGTCAAANCATCATCCCTGCCTCAACTGGTGCAGCAAAAGCTGTTGGGGNAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAAAGGGTTTTCCGTGTCCCCACCCCAAATGTCTCCCGTTGGGGATTTGAACCTGCCGTCTGTCCCAAGCTGCCAAGTATGATGAACTCCAGGGCTGCCCTTTAAAACTGCAGCCAATTGGCCCCCAATGAAGGGGAATCCCTGGAAATACCACA 5 1 2 bld 1030 5g IMAGE:7094207.5p GCTCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCATTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAAGGACTGATGACTACCGTCCATGCCTTCACTGCC 5 1 2 bld TpA 5g TTpA016e19.p1kSP6 CCCGGGGCCCGGGGCAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATG 5 1 2 bld BrSp 5g3 in EC2BBA34BD11.g1 GGGGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCA 5 1 2 bld BrSp 5g3 in EC2BBA7CC02.g1 GGGGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCGTCCCTGCCTCAACTGGTGC 5 1 2 bld BrSp 5g3 in EC2BBA9CG09.g1 GCAACATGGGCACTGAAACGAGTGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGAATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGGCCCATCTGCAAGCTGTGG 5 1 2 bld HeRe 5g3 in EC2CAA37BC07.g1 GCTGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGCGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAAAAGACTGTGGATGGCCCATCTG 5 1 2 bld TbA 5g TTbA070b15.p1kSP6 CCCGGGGCCCGGGGCAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCTGCCAAGTATGATGA 5 1 2 bld BrSp 5g3 in EC2BBA15BH11.g1 GGGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCA 5 1 2 bld HeRe 5g3 in EC2CAA34CG08.g1 GGCAACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATC 5 1 2 14 bld Te3 5g3 in CAAM5026.5p .......................................................................................................................................................................................TGCTTTTCCAATGTAGTGTGTTTGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCC 5 1 2 bld TpA 5g3 in TTpA012o03.p1kSP6 TTCCCCGGGCAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGAACAGGTTGTCTCCACTGACTTTCATGGTGACACTCATTCCTCCATCTTTGATGCTGGAGCTGGAATTGCACT 5 1 2 bld Te5 in CAAO5703.5p AACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCAAGTATGATGACATTCAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGA 5 1 2 12 bld Tad5 5g3 in XZT45585.5p .........................................................................................................................................................................................AACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCCATTAGACTGCAGCACATGGCCCAATGAAGGGAATC 5 1 2 bld TbA 5g3 in TTbA076h03.p1kSP6 ACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCCTCACTGGTGCAG 5 1 2 14 bld Brn4 5g3 in CAAL22584.5p ..........................................................................................................................................................................................ACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAATGTCTCCGTTGTGGATCTGAACTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCC 5 1 2 14 bld Brn4 5g3 in CAAL6039.5p ..........................................................................................................................................................................................ACAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCCTCACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGT 5 1 2 10 bld Tail 5g3 in CBSW11408.b1 ..........................................................................................................................................................................................GCAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAA 5 1 2 bld Tad0 5g IMAGE:6982134 GGAATTCCGGGATCGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCACTGGTGCAGCNAGGCTGTTGGGAAGTCTCCCTGAGCTGATGGCAACTGACGGAATGGCTTTCGTGTCCCACCCAATGTCTCCGTGTGGTCTGACTGCGTCTGTCAGCTNGCAGATGATGACTCAGTGCA 5 1 2 bld Tad0 5g IMAGE:6983696 CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAGCCTTGCAAGTATGATAAA 5 1 2 bld Neu0 5g ? NISC_ng25f10.y1 CAAGGCACTGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCACTGTATGTGGCGGAATCTACTGGAGTCTTCACAACCAAAGAGAACGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGCATGGACTGATGACTACCGTCCATGCCTTCACTGCCA 5 1 2 bld TbA 5g TTbA040p08.p1kSP6 CCCCGGGCAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAAGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGG 5 1 2 bld TbA 5g TTbA071m24.p1kSP6 CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCCGTTGTGGATCTGACCTGCCGTCTGTCNCAGCCTGCCAAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATGGCC 5 1 2 24 bld Brn4 5g CAAL21342.5p ...........................................................................................................................................................................................CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAAGTCATCTCTGAGCTGAATGGCAAACTGACAGGAATGGC 5 1 2 bld Te5 in CAAO9026.5p CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACAGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAAGCCTGCCNAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATG 5 1 2 bld Te5 CAAO9427.5p CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCNAGCCTGCCAAGTATGATGACNATCAGGCTGCCATTAAGACTGCAGCACATGG 5 1 2 10 bld Thy1 5g3 in CBST13346.fwd ...........................................................................................................................................................................................CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAAGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCTAATGTC 5 1 2 10 bld Limb 5g3 in CBSU2142.fwd ...........................................................................................................................................................................................CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCC 5 1 2 20 bld Spl2 5g CBSS7663.fwd ...........................................................................................................................................................................................CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTC 5 1 2 10 bld Tail 5g3 in CBSW11765.b1 ...........................................................................................................................................................................................CAGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTC 5 1 2 10 bld Tail 5g3 in CBSW12045.b1 ...........................................................................................................................................................................................CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGT 5 1 2 10 bld Tail 5g3 in CBSW3301.b1 ...........................................................................................................................................................................................CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTT 5 1 2 10 bld Te1 5g3 in CBWN5823.b1 ...........................................................................................................................................................................................CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGA 5 1 2 10 bld Eye 5g3 in CCAX2578.b1 ...........................................................................................................................................................................................CAGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAAT 5 1 2 14 bld Gas6 5g3 in ANBT199.5p ............................................................................................................................................................................................CGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 14 bld Gas6 5g3 in ANBT2887.5p ............................................................................................................................................................................................CGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAATGTCTCCGTTGTGGATCTGACCCTGCGTCTGTCCAAGCCTGCCCAGTATGATGACATCAAGGCTGCCCATAAGACTGCAGCACATGGCCCAATGAAGGGAATC 5 1 2 14 bld Brn4 5g3 in CAAL7366.5p ............................................................................................................................................................................................AGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCAT 5 1 2 14 bld Te3 5g3 in CAAM7370.5p ............................................................................................................................................................................................AGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGNGATGGCTTTCCGTGTCCC 5 1 2 12 bld Tad5 5g3 in XZT22091.5p ............................................................................................................................................................................................CGGACGCGTGGGCGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCC 5 1 2 22 bld Tad5 5g XZT29553.5p ............................................................................................................................................................................................AGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATCATCCCTGCCTCAACTGGTGCA 5 1 2 10 bld Spl2 5g3 in CBSS2178.fwd ............................................................................................................................................................................................TCCGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAGCCCTGCCAGTATGATGACATCAAG 5 1 2 20 bld Tail 5g CBSW1705.b1 ............................................................................................................................................................................................AGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCA 5 1 2 10 bld Tail 5g3 in CBSW4887.b1 ............................................................................................................................................................................................AGGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCG 5 1 2 10 bld Tbd1 5g3 in CBXT16618.b1 ............................................................................................................................................................................................AGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGGCCCATCTGGCAAGCTGTGGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTC 5 1 2 20 bld Tbd1 5g CBXT16771.b1 ............................................................................................................................................................................................AGGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGA 5 1 2 bld Neu0 5g3 in NISC_ng20g07.y1 GGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGG 5 1 2 bld Tad0 5g3 in NISC_no01a10.y1 GCGATCAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGT 5 1 2 bld Tad0 5g3 in NISC_no12a04.y1 GGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACC 3 -1 2 bld Brn4 CAAL6303.3p TCTAGAACTAGCGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCAAGTATGATGACATCAAGGCTGCC 5 1 2 12 bld Tad5 5g3 in XZT41515.5p .............................................................................................................................................................................................GGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGA 5 1 2 10 bld Tail 5g3 in CBSW1050.b1 .............................................................................................................................................................................................GATTCGTCGACCCCGCGTCCGTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCC 5 1 2 10 bld Tail 5g3 in CBSW10957.b1 .............................................................................................................................................................................................GGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGG 5 1 2 10 bld Tail 5g3 in CBSW1161.b1 .............................................................................................................................................................................................GGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAGC 5 1 2 10 bld Tail 5g3 in CBSW5221.b1 .............................................................................................................................................................................................GGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCCTCACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGGCAACTGACGGGAA 5 1 2 10 bld Tail 5g3 in CBSW550.b1 .............................................................................................................................................................................................GGGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCC 5 1 2 10 bld Tail 5g3 in CBSW7665.b1 .............................................................................................................................................................................................GGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCA 5 1 2 10 bld Tail 5g3 in CBSW8193.b1 .............................................................................................................................................................................................GGGCACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTC 5 1 2 bld Tad0 5g3 in IMAGE:6983017 CCGGGATAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATNCCTGAGCTGAATGGCAACTGACGGAATGGGCTTCGTGTCCCACCCAATGTCTCCGTGTGGACTGACTGCGTCTGTCAAGCTGCCAGTATA 5 1 2 bld BrSp 5g3 in EC2BBA19DH02.g1 CACATGAAAACGAGTGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCC 5 1 2 bld TbA 5g TTbA012o17.p1kaSP6 GCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGTCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATG 5 1 2 14 bld Brn4 5g3 in CAAL18379.5p ..............................................................................................................................................................................................GGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACA 5 1 2 14 bld Brn4 5g3 in CAAL19637.5p ..............................................................................................................................................................................................GGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCCAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGGATACACA 5 1 2 24 bld Brn4 5g CAAL8157.5p ..............................................................................................................................................................................................GGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCCAGTATGATGACATNCAG 5 1 2 14 bld Met5 5g3 in CACX639.5p ..............................................................................................................................................................................................GGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACA 5 1 2 10 bld Bone 5g3 in CBTC6671.fwd ..............................................................................................................................................................................................GGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAAGGGAGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTTGTTGTTG 5 1 2 10 bld Tail 5g3 in CBSW1636.b1 ..............................................................................................................................................................................................GGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCC 5 1 2 10 bld Tail 5g3 in CBSW3599.b1 ..............................................................................................................................................................................................GGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACG 5 1 2 20 bld Te1 5g CBWN9432.b1 ..............................................................................................................................................................................................GGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAG 5 1 2 10 bld Eye 5g3 in CCAX2281.b1 ..............................................................................................................................................................................................GGCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCA 5 1 2 bld Tad0 5g3 in IMAGE:6983041 CCGGGATAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAAATGGCAACTGACGGGAATGGCTTTTCGTGTCCCCCACCCAATGT 5 1 2 bld TbA 5g TTbA053b10.p1kSP6 GCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGNAATACACAGAAGAACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCATTC 5 1 2 bld TbA 5g TTbA078i08.p1kSP6 CAGAAACGAGAGGGGTTGATAACTAAACCAATGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGATTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGACCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGACTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAANGCTGCCATTAAGACTGCAGCACATG 5 1 2 bld Te5 in CAAO5391.5p GCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGAC 5 1 2 14 bld Met5 5g3 in CACX1265.5p ...............................................................................................................................................................................................GCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTCGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCCAAGCCTGCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACAT 5 1 2 14 bld Met5 5g3 in CACX824.5p ...............................................................................................................................................................................................GCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGNGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCCGTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCCAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAANGGAAATCTGNAATACACA 5 1 2 20 bld Tbd1 5g CBXT714.b1 ...............................................................................................................................................................................................GCACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTC 5 1 2 bld Tad0 5g3 in IMAGE:6983256 CACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAAGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGGCTTTCCGTGTCCCCACCCCCAAATGTCCTCCGTTGTGGGATCTGAACCTGCCCGTCTGTCCCAAGCCCTGGCCAAGTATGGATGAACCATCAAGGCCTGCCCATTTAAGAACTTGCCAGCCACATGGGGCCCCAATTGAAAGGGGAAATCC 5 1 2 bld Neu0 5g IMAGE:6995654 CACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCCATTAAGACTGCAGCACATGGNCCCAATGAAGGGAATCCTGGAATACACAGAAAGACCAAGGTTGTCTCCCACTGGACTTTCAATGGTGAACACTCATTTCCTCCCATCTN 5 1 2 bld Abd0 5g IMAGE:7018227 CACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGNGAAGTCATTCCTGAGCTGAATGGCAAC 5 1 2 bld TbA 5g TTbA022k21.p1kSP6 CACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACAGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAAGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAANGCTGCCATTAAGACTGCAGCACAT 5 1 2 bld TbA 5g TTbA035g04.p1kSP6 CACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAAACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAAAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGC 5 1 2 bld TbA 5g3 in TTbA046i23.p1kSP6 CACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACAGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGC 5 1 2 bld TbA 5g3 in TTbA077m09.p1kSP6 CACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGNCAAGGTCATCAATGACAACTTTGGCATCCTGAANGGACTGATGACTACCGTCCATGCCTT 5 1 2 14 bld Te3 5g3 in CAAM10153.5p ................................................................................................................................................................................................CACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCCTGCGTCTGTCC 5 1 2 bld TpA 5x3 out TTpA001g22.p1kSP6 ACGGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCGAAATGACTGTCAAGATTGGAATCAATGGATTTGGGCGCATCAGGTGCCTGATGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCATTGCTATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCTCCCCACAGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAATGGGGCGATGCTGGTGCAATGTATGTGGTGAGAATACTATCTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAATGGAGGTGCCAAACGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTGGTTGTGTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGATGTCAGCAACGCGTCCTGCACAACCAACTGCCTGACTCCTCTTGCGAACGTCATCAGTGACAACTTTAGCATCCTGGAGGGACGTGATGACTA 5 1 2 bld Tad0 5g3 in IMAGE:6982234 GGATGAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGAGGAACCGGCTGGAGTCATCACTACCAAAGAGAAGGATGGTTTGCACATTAAGGTATGAGCCAAGTCTGATATTATATCCCCCCCCTAAACGGACGCACCAATGTATGTTGGTGTGCTGAGTCTATATCAATATGAACCCTTTTCCCCATCTGTCCACCCACATTCTGCAGCACCTAATAACTCTTACCTCCGTCCCTAACCCACAACTATATTGCTTTCTTCTCGTAACGCAGCAATGCTTCCCCCCTATACCTTACTGTCACAGCTTCAAATTTCATGTGTTTTCCATTTACTTTTGATTCAACTAAACACCCTTTTATACATTTACTCTCCTTGCCCCCTCCAGTCAATAGCTATCCACCCCACCCTACCTACTCTTACTACTCTCCTTTTCCCTCACTACTTATAATTAAAGAGATCGCAGCACAACGCATCTCCACCTCCCCTCTCTC 5 1 2 chi Tad0 5x IMAGE:6984746 ACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAACGCCGGTTTGCACTTGAAGGGAGGTGCCAAGATGTGCATCTTATCCGCCCCCTCAACTGATGCCCCCATGATGGCAGACGGATGTTTACATGATTAATGTCGCCTAACTATTCATGATGCCTCAATATCGCTGATTCTTACCTGCTCTATGCCACTGACATAAGGGGTGCTATTTATATTCTGTCCCATGCATTAGCACCTTTCATGTAGCCGCTTATCAACCGGCTTCCATGAGGCCGGTGCCCATTGAAACTTTTACTATTCACTCTGTGTCATAAGCACCCTTCCCATGGTTCTCTCTTCTGTTTGCTCCAAAATGCCATTACCCTAGGCAACACGTCCAATCTCTTGTTTTACTTCCCCTCCCAACTTTCAT 5 1 2 bld Neu 5g TNeu048f13.p1kSP6 CACANAAACGAGNAGGGTTGATAACTAAACCAAGTGACACCAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCANNAGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGC 5 1 2 bld TpA 5g3 in TTpA071k10.p1kSP6 CCCGGGGCCCGGGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAAAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGAAAACTGACACGAATGGCTTTCCGTGTCCCCACCCCAAATGTCT 5 1 2 bld TbA 5g3 in TTbA075l05.p1kSP6 CAGAAACGAGATGGGGTTGATAACTAAACCAAGTGACACCAAAATGACCGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCCGCTGTTTTAAGCGGCAAATGCGAAGTCGTCGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAAGTGCCGGTCAGAACATCATCCCTGCCTTCACTGGTGC 5 1 2 12 bld Tad5 5g3 in XZT64033.5p .................................................................................................................................................................................................ACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGC 5 1 2 bld In66 5g IMAGE:8963181.5p TCGGAAGGAGGGGGTTGATAACTCATTTCCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGACATCATCCCTGCCTCAACTGTGCAGCAAGCTGTTGGAAAGTCATCCCTGAGCTGATGCAGACTGACGGCATGACTTTTCTTCGTCGTCACCCCACCAGATCTCCTCTGTGAGCATAATCAGCTGCTGTGACCTGCTGACAATTATGAAATCATACGCTGTCGCTATGACTGCGCACATTGGCCCATGAGGAATCTGGAATCGAGAACAGTGTTCCTTGACTCAATGGACCATCCCACTTAGCTGACTGATGCTGACGATCTTGACGTTCGGTATCATGTCAGCCT 5 1 2 10 bld Limb 5g3 in CBSU5838.fwd .................................................................................................................................................................................................GCAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATTAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCC 5 1 2 10 bld Limb 5g3 in CBSU9726.fwd .................................................................................................................................................................................................ACAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAAGCCTGGCAAGTATGATGACATCAANG 5 1 2 10 bld Tail 5g3 in CBSW516.b1 .................................................................................................................................................................................................ACAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACC 5 1 2 10 bld Tbd1 5g3 in CBXT3698.b1 .................................................................................................................................................................................................GCAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTTTTGATAGCGGCAAATGCGACGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCATGGCCGATTCAAGGGAACAGTGAAGGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAATCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCAGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGAGAACTCTCTTCAAGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACTGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTG 5 1 2 bld TpA 5g3 in TTpA006m04.p1kSP6 CAGAAACGAGAGGGGTTGATAACTAAACCAATTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACAT 5 1 2 bld Tad0 5g IMAGE:6981738 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCCTGCAAAGGTCATCAATGACAACTTTTGGCATCCTTGGAGGGGACGATGAACTACCGTCATGCCTTCACTGGCACCCAAAAAAACGGGGAAAGGGCCATCCGGCAAACTGTGGAAAAAAAGGAAAAAAGTCCGGGTAAAAAAAAAACCCCTGGCCCCCCACGGGGGGGGAAAAAGGGGGTGTGGGGAAAAAATCCCCCCCCCCCCAATGGGGGGAACTCCCCGGGAGGGGGGGTTTTTTTGTGTCTCCCCCCCCCCCCACAAAAAAACTCCCTCTTGGGGATATAAAATAAAACACCCCCGTTGTTCTCACCCCACCGCGCCCAAAAAAGATAAGATAAAATAAAAAAGGGGGGCGGGGCCCCCTTTATTAAAAGAGCTCCCACCGAGATGCGCCCTTCCAACAAGAGAGAGG 5 1 2 bld Tad0 5g IMAGE:6984757 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGNGAAGTCATCCCTGAGCTGAATGGCAACTGACGGGATGGCTTTCGTGTCCCACCCAATGTCTCCGTGTGGTCTGACTGCGTCTGTCAGCTGCCAGTATATACTCAGCTGCATAA 5 1 2 bld Abd0 5g IMAGE:7016151 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGNCAAGGCTGTTGGGGAAGTCATCCCTGAGCTGAATGGCAACTGACAGGAATGGCTTTCGTGT 5 1 2 bld Abd0 5g IMAGE:7018169 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATG 5 1 2 bld TpA 5g TTpA036i13.p1kSP6 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAANGGAATCCTGGAATACACAGAAGAACAGGTTGTCTCCACTGACTTTCATGGTGACACTCATTC 5 1 2 bld TpA 5g TTpA049h19.p1kSP6 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTTCAGGGAACAGTGTGTGTTGAGAAT 5 1 2 bld TbA 5g3 in TTbA006l13.p1kaSP6 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAAGCTGCCA 5 1 2 bld TbA 5g3 in TTbA016l17.p1kSP6 CAGAAACGAGAGGGGTTGATAACTAAACCAATTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAANGCTGCCATTAGACTGCAGCACATGGCCCAAT 5 1 2 bld TbA 5g3 in TTbA042c06.p1kSP6 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 bld TbA 5g3 in TTbA054l10.p1kSP6 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATNCANGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 bld TbA 5g3 in TTbA059a03.p1kSP6 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 bld HdA 5g3 in THdA019j15.p1kSP6 CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATG 5 1 2 14 bld Brn2 5g3 in CAAJ12573.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCCAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACAT 5 1 2 24 bld Brn2 5g CAAJ6486.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGGTGAGTTGCAGTTTCACTTTACTCACTGAACTTTTATATTTAATGGAACAACATATAATGCTGTGTATATATCTACAGCAAACTGACAGGGATGGCTTTCCGTGTCCC 5 1 2 14 bld Brn3 5g3 in CAAK9784.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGT 5 1 2 14 bld Brn4 5g3 in CAAL10818.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCC 5 1 2 24 bld Brn4 5g CAAL11611.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCA 5 1 2 14 bld Brn4 5g3 in CAAL20805.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGTGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCCAAGTA 5 1 2 14 bld Brn4 5g3 in CAAL20822.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGT 5 1 2 14 bld Brn4 5g3 in CAAL21450.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATG 5 1 2 14 bld Brn4 5g3 in CAAL22029.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCCAGTATGATGACATCAAGGCTGCCA 5 1 2 14 bld Brn4 5g3 in CAAL22566.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACAT 5 1 2 14 bld Brn4 5g3 in CAAL5394.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCC 5 1 2 14 bld Brn4 5g3 in CAAL6617.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCCTCACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTTCGTGTCCCCACCCAAATGTC 5 1 2 14 bld Brn4 5g3 in CAAL6654.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCCAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACA 5 1 2 14 bld Brn4 5g3 in CAAL9162.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGT 5 1 2 14 bld Te5 5g3 in CAAO11389.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTTCGTGTCCCCACCCCCAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACA 5 1 2 bld Te5 in CAAO7724.5p CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGNGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTG 5 1 2 14 bld Te5 5g3 in CAAO9974.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCGAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAAGCTGTTGNGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGG 5 1 2 10 bld Mus1 5g3 in CABH2466.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCCTGCGTCTGTCCAGCCTGCCCAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGCAATC 3 -1 2 bld Ovi1 in CABI8315.3p CCGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCC 5 1 2 14 bld Met5 5g3 in CACX1370.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTAACAGGAATGGCTTTCCGTGTCCCCA 5 1 2 14 bld Met5 5g3 in CACX522.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACAT 5 1 2 14 bld Met5 5g3 in CACX928.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCNAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAA 5 1 2 22 bld Tad5 5g XZT23241.5p ..................................................................................................................................................................................................CCACGNNCGTCCGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCC 5 1 2 12 bld Tad5 5g3 in XZT25005.5p ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGT 5 1 2 10 bld Bone 5g3 in CBTC2151.fwd ..................................................................................................................................................................................................CAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTNCACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAAATGGCAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGNATCTGACCTGCCGTCTGTCC 5 1 2 10 bld Bone 5g3 in CBTC2807.fwd ..................................................................................................................................................................................................CAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTNCACTGGTGCAGCANAGGCTGT 5 1 2 20 bld Bone 5g CBTC4539.fwd ..................................................................................................................................................................................................CAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGNGAAAGTCATCCCTGAGCTGAAT 5 1 2 10 bld Bone 5g3 in CBTC586.fwd ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATT 5 1 2 10 bld Bone 5g3 in CBTC7426.fwd ..................................................................................................................................................................................................CAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAAGTGCCGGTCAGAACATCATCCCTGCCCTCACTGGTGCAGCAAAGGCT 5 1 2 20 bld Bone 5g CBTC7777.fwd ..................................................................................................................................................................................................CAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTT 5 1 2 10 bld Bone 5g3 in CBTC798.fwd ..................................................................................................................................................................................................CAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGG 5 1 2 10 bld Bone 5g3 in CBTC9753.fwd ..................................................................................................................................................................................................CAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAACTGACA 5 1 2 10 bld Thy1 5g3 in CBST4977.fwd ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCC 5 1 2 10 bld Thy1 5g3 in CBST5238.fwd ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTG 5 1 2 10 bld Limb 5g3 in CBSU1424.fwd ..................................................................................................................................................................................................CAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGTAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCT 5 1 2 10 bld Tail 5g3 in CBSW11449.b1 ..................................................................................................................................................................................................CAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGAC 5 1 2 20 bld Tail 5g CBSW4440.b1 ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGA 5 1 2 10 bld Tail 5g3 in CBSW5697.b1 ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACA 5 1 2 10 bld Tail 5g3 in CBSW6309.b1 ..................................................................................................................................................................................................CAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCAC 5 1 2 10 bld Tail 5g3 in CBSW6347.b1 ..................................................................................................................................................................................................CAGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAA 5 1 2 10 bld Te1 5g3 in CBWN13612.b1 ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGA 5 1 2 10 bld Tbd1 5g3 in CBXT11127.b1 ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCC 5 1 2 10 bld Tbd1 5g3 in CBXT14317.b1 ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGT 5 1 2 10 bld Eye 5g3 in CCAX4285.b1 ..................................................................................................................................................................................................CAGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCT 5 1 2 bld Neu 5g TNeu045a08.p1kSP6 CAGAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGG 5 1 2 bld TbA 5g TTbA076l20.p1kSP6 CAGAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTNCACTGGTGCAG 5 1 2 bld TbA 5g TTbA079g10.p1kSP6 CAGAACGATAGGGGTTGATAACTAGACCACTTGACACCCACATGACTGTCAGGATTGGAATCAATGGATTTGGCCGCATCGGACACCTGGTGACCCGCGCTGCTGTTTTAAGCGGAAAATGCTAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGAACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCGATCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAAGCTGCCATTAATACTGCAGCACAT 5 1 2 14 bld Brn4 5g3 in CAAL10178.5p ...................................................................................................................................................................................................AGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTC 5 1 2 24 bld Brn4 5g ? CAAL19564.5p ...................................................................................................................................................................................................AGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCCATGAAGGGAATCCT 5 1 2 10 bld Liv1 5g3 in CAAR2693.5p ...................................................................................................................................................................................................AGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAAGCTGCCA 5 1 2 20 bld Tail 5g CBSW5756.b1 ...................................................................................................................................................................................................AGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATC 5 1 2 10 bld Tail 5g3 in CBSW986.b1 ...................................................................................................................................................................................................AGAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGT 5 1 2 10 bld Eye 5g3 in CCAX8731.b1 ...................................................................................................................................................................................................AGAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCAT 5 1 2 chi Abd0 5x3 in IMAGE:6999114.b GGATCGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACANTTAAGTGGGGGCGAATGCTGGTGCAGTGGTATGTGGGGGGAATCTTACTGGAATCCTTTCCAAACCCAAAAAAAAAAGGCCGGGTTTCCACCTTTAAAGGGAGGGGGCCCCAAGGGGGTTTATTTTTCTCGCCCCCCCCCCGAAGAAAACCCCCCCTTTTTTTTTTTTTGGGGGGGGGAACCCCCCCAAAAAAAAAAAAAACCCCCTTCCCCGGTTGGCAAAAAAAAAATTTTTTTGAAAAAAAAAAAGGGGGGGGCCCCCTCCTTGGGGGGGGGGGCCCAAAAAAAATTTTTTTTTCTCTGGGAAGAAAAAAAAAAAAAAAAAAAGTTTTTTTTTTTTCCCCCCCAAAAAAAAAAAAAGGGGGGGGCCCCCCCCCCCCGAGG 5 1 2 bld Tad0 5g3 in NISC_no13c06.y1 GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCA 5 1 2 bld TpA 5g TTpA049e20.p1kaSP6 AAACGAGAGGGGTTGATAACTAAACCAAGCTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACG 5 1 2 14 bld Met4 5g3 in CUNC654.5p ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCCAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGA 5 1 2 12 bld Gas7 5g3 in XZG28978.5p ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCC 5 1 2 22 bld Tad5 5g XZT19269.5p ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGC 5 1 2 22 bld Tad5 5g XZT28551.5p ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCCTCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCCTGTCCCCACCCCAAATGTC 5 1 2 12 bld Tad5 5g3 in XZT37432.5p ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTTGAAGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTC 5 1 2 22 bld Tad5 5g XZT66491.5p ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCCATGAAGGGAATCCTGGAATACACA 5 1 2 10 bld Bone 5g3 in CBTC11149.fwd ....................................................................................................................................................................................................GAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAACTGACAGGAATGGCTTTCGTGTCCCACCCCCAATGTCTCCGTTGTGGATCTGACCTGNCGTCTGTCC 5 1 2 10 bld Bone 5g3 in CBTC11265.fwd ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCC 5 1 2 20 bld Bone 5g CBTC1423.fwd ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCC 5 1 2 10 bld Bone 5g3 in CBTC2326.fwd ....................................................................................................................................................................................................CGGACGCGATGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGT 5 1 2 10 bld Spl2 5g3 in CBSS2990.fwd ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCT 5 1 2 10 bld Tail 5g3 in CBSW11080.b1 ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAAACGGCAACTGACAGGAATGGCTTTCCGTGTCC 5 1 2 10 bld Tail 5g3 in CBSW1252.b1 ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACAT 5 1 2 10 bld Tail 5g3 in CBSW564.b1 ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTG 5 1 2 10 bld Tail 5g3 in CBSW6794.b1 ....................................................................................................................................................................................................GAAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCT 5 1 2 20 bld Te1 5g CBWN4281.b1 ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTG 5 1 2 10 bld Tbd1 5g3 in CBXT10557.b1 ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGC 5 1 2 10 bld Tbd1 5g3 in CBXT5789.b1 ....................................................................................................................................................................................................GAAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAAGGCTGCCATTAAGACTGCAGCA 5 1 2 bld Abd0 5g IMAGE:7017580 GAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGGAAGTCATCCCTGAGCTGAATGCAAACTGACGGGAATGGCTTTCGTGTCCC 5 1 2 bld Gas 5g TGas027d11.p1kSP6 AAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTNTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATG 5 1 2 bld TpA 5g3 in TTpA049b08.p1kaSP6 AAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATC 5 1 2 bld TbA 5g TTbA077n14.p1kSP6 AAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCAGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATCGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGNCACGCATCCTG 5 1 2 bld TbA in TTbA078g24.p1kSP6 ACGAGAGGGGTTGATAAGTAAAACAGGTGATTTCAAAATGACTGTCAAGATTGCAATCAATGGATTTGGCCTCAACGGCCGCCTGGTGACCCGCGCTGGTGTTTTAAGAGGCAAATGAAAAGTCGTTGCGATCAATGACCCCTTCATTGACTTGAACTACATGGCTTACATGTTCGAATATGACTCCTCCCACTGCCGATTCAAAGGAACAGTGTGTGTTGAGAATGGCAAGTCTGGTTATGCAATGGCAAGGCACTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCACTGAATGTGGAGTAATCTACTGGAGTCTTCACAACCGATGAGAAGGCCTGATTGCACTTGAACGGACGTGCCAAACGTGTCATTATCTCTGCCCCCTCAACTGATACCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGATCAGCAACGCATCCTGCACAATCAACTGCCTGGCGCCTCTTGCTGATGTCATCAATGACAACTTTGGCATCCTGTACGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCACAAGAC 5 1 2 10 bld Mus1 5g3 in CABH6560.5p .....................................................................................................................................................................................................GAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGGATGGCTTTCCGTGTCCCCACCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCAAGTATGATGACCATCAGGCTG 5 1 2 bld Gas8 5g st82e09.5p AAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAG 5 1 2 10 bld Bone 5g3 in CBTC7583.fwd .....................................................................................................................................................................................................AAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGGATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAA 5 1 2 20 bld Bone 5g CBTC9828.fwd .....................................................................................................................................................................................................AAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAAATGGCAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTC 5 1 2 20 bld Limb 5g CBSU4322.fwd .....................................................................................................................................................................................................AAACTAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCG 5 1 2 10 bld Tail 5g3 in CBSW4050.b1 .....................................................................................................................................................................................................AAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAA 5 1 2 10 bld Tbd1 5g3 in CBXT4352.b1 .....................................................................................................................................................................................................AAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAAT 5 1 2 10 bld Eye 5g3 in CCAX5239.b1 .....................................................................................................................................................................................................AAACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGT 5 1 2 bld TpA FL in TTpA012e21.p1kSP6 AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCATTCCTCCATCTTTGATGCTGGAGCTGGAATTGCACTGAACGATAACTTTGTGAAGCTGGTTTCCTG 5 1 2 bld TpA 5g TTpA012f11.p1kSP6 AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCATTCCTCCATCTTTGATGCTGGAGCTGGAATTGCACTGAACGATAACTTTGT 5 1 2 bld Abd0 5g IMAGE:7016655 AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTN 5 1 2 bld TpA 5g TTpA031c02.p1kSP6 AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGGCAGCTGTGG 5 1 2 bld TpA 5g3 in TTpA036j02.p1kSP6 AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAANGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGNAATCCTGGAATACACAGAAGAACAGGTTGTCTCCACTGACTTCAATGGTGACACTCATTCCTCCCATCTTGATGCT 5 1 2 bld TbA 5g3 in TTbA015a13.p1kSP6 AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTAAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAANGGAATCCTGGAATACACAGAAGACCAGGTTGTCTCCACTGAC 5 1 2 bld HdA 5g3 in THdA051p02.p1kSP6 AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 14 bld Brn4 5g3 in CAAL10343.5p ......................................................................................................................................................................................................AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGT 5 1 2 24 bld Brn4 5g CAAL10497.5p ......................................................................................................................................................................................................AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCCATG 5 1 2 14 bld Brn4 5g3 in CAAL19069.5p ......................................................................................................................................................................................................AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGAACTGCCGTCTGTCCAAG 5 1 2 14 bld Brn4 5g3 in CAAL19754.5p ......................................................................................................................................................................................................AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGGCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGA 5 1 2 14 bld Brn4 5g3 in CAAL20485.5p ......................................................................................................................................................................................................AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGAC 5 1 2 14 bld Brn4 5g3 in CAAL20860.5p ......................................................................................................................................................................................................AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTG 5 1 2 14 bld Brn4 5g3 in CAAL5595.5p ......................................................................................................................................................................................................AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGNGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCA 5 1 2 14 bld Brn4 5g3 in CAAL9407.5p ......................................................................................................................................................................................................AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGG 5 1 2 14 bld Te5 5g3 in CAAO606.5p ......................................................................................................................................................................................................AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAAGTGCCGGTCAGAACATCATCNCTGCCCTCACTGGTGCAG 5 1 2 bld Tad5 in XZT3779.5p AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAAGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCCTGGATACACA 5 1 2 bld In62 5g IMAGE:8954610.5p GAGATGGGGGTTGATAACTAAACCAAGTGGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGGTAAGTGCAGTGGGGCTTATTCAGCTTGGGACATAGAGCCTAAAGCAAACTGTCTCCCCCCTCACCCTGTATGAGTGACCTTTATCCTTGGCCAAATGACCTTAATGGAAATTATACCCCCCCCAAACAATGTAGTCTCTCTAAAAATAGTGTGAACAAGCTTGTACATAAAAACCCTGCTTTGTGCAAGTTTTCATAACTTAATTTACTTTTTTGTAGTATGTGCTACTGGTATCCTAAACTAAAAACTGCCATTTATGATACGTCACCCCTGGAATCATAGGATTCCAGTTGCACACAAACAGCCGAAGTCAACACTATAACATGC 5 1 2 10 bld Tail 5g3 in CBSW5713.b1 ......................................................................................................................................................................................................AACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACA 5 1 2 bld Tad0 5g3 in NISC_no15f01.y1 ACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGG 5 1 2 bld Tad0 5g3 in NISC_no20a05.y1 ACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGT 5 1 2 14 bld Brn3 5g3 in CAAK11456.5p .......................................................................................................................................................................................................ACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGA 5 1 2 14 bld Brn4 5g3 in CAAL20673.5p .......................................................................................................................................................................................................CGGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGAACTGCCGTCTGTCCAAGCCTGCCAAGTATGATGAC 5 1 2 14 bld Brn4 5g3 in CAAL6105.5p .......................................................................................................................................................................................................ACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACA 5 1 2 12 bld Tad5 5g3 in XZT55590.5p .......................................................................................................................................................................................................ACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACAT 5 1 2 bld In66 5g IMAGE:8965890.5p ACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTGTGATCTGACCTGCCGTCTGTCAGCTGCCAGTATGATGACATCAGCTGCATAGACTGCAGCACATGACCATGAGGATCTGAATACACAGAGACAGGTGTCTCCACTGACTTCAATGTGACCTCAATCCTCCAATCATGGAGTGGCGTGGACCTGGAATTGCACCTGGAACCGCAGTTTA 5 1 2 20 bld Bone 5g CBTC7004.fwd .......................................................................................................................................................................................................GCGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAACTGACA 5 1 2 10 bld Tail 5g3 in CBSW2104.b1 .......................................................................................................................................................................................................ACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCC 5 1 2 10 bld Tail 5g3 in CBSW5163.b1 .......................................................................................................................................................................................................GCGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAA 5 1 2 10 bld Tail 5g3 in CBSW8174.b1 .......................................................................................................................................................................................................ACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCT 5 1 2 10 bld Tail 5g3 in CBSW9642.b1 .......................................................................................................................................................................................................ACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCG 5 1 2 10 bld Tbd1 5g3 in CBXT4968.b1 .......................................................................................................................................................................................................ACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTTTTGATAGCGGCAAATGCGACGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCATGGCCGATTCAAGGGAACAGTGAAGGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAATCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCAGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGAGAACTCTCTTCAAGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACTGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGA 5 1 2 10 bld Tbd1 5g3 in CBXT9077.b1 .......................................................................................................................................................................................................ACGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTG 5 1 2 bld Tad0 5g IMAGE:6985253 CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATNCCTGAGCTGAATGGCAACTGACGGGAATGGCTTCCGTGTCCCATCCCAATGTCTCCGTGTGATCTGACTGCGTCTGTCCAGCTGCCAGTTGATGACTCA 5 1 2 bld Gas1 5g3 in IMAGE:6989775 CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCCTCACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCCACCCAATGTCTCCGTTGTGGATCTGNNACTGCGTCTGTCCAGCCTGCNAGTATGATGACTCAGGCTGC 5 1 2 bld Abd0 5g3 in IMAGE:6998971.b CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCNAACTGACGGGAATGGCTTTCCGTGTCCCCACCTCAATGTCTCCGTTGTGGATCTGACT 5 1 2 bld Abd0 5g IMAGE:7017031 CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTTGGGAAGTCATCCCTGAGCTGA 5 1 2 bld Abd0 5g IMAGE:7017611 CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGAAACTGACAGGAATGGC 5 1 2 bld Brn4 5x in CAAL18108.5p CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCCAGTATGATGACATCAAGGCTGCCATAAGACTGCAGCACATGCCCC 5 1 2 24 bld Brn4 5g CAAL20879.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAGGGCTGCCA 5 1 2 24 bld Brn4 5g ? CAAL22419.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGCCAAACTGACA 5 1 2 14 bld Brn4 5g3 in CAAL6739.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCA 5 1 2 14 bld Brn4 5g3 in CAAL8977.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCC 5 1 2 14 bld Brn4 5g3 in CAAL9115.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAGCCTGNCAAGTATGATGACATCAAGGCTGCCA 5 1 2 14 bld Brn4 5g3 in CAAL9249.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATG 5 1 2 14 bld Brn4 5g3 in CAAL9854.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCC 5 1 2 14 bld Te3 5g3 in CAAM9402.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTC 5 1 2 bld Te5 5g3 in CAAO13003.5p CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCCA 5 1 2 14 bld Met5 5g3 in CACX1269.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTTCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCCAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATG 5 1 2 14 bld Met5 5g3 in CACX1418.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAG 5 1 2 14 bld Met5 5g3 in CACX729.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGNGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAAGGAATCCTGGAATACACA 5 1 2 12 bld Tad5 5g3 in XZT29493.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGNCAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTG 5 1 2 22 bld Tad5 5g XZT31883.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGA 5 1 2 12 bld Tad5 5g3 in XZT38189.5p ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAG 5 1 2 bld In60 5g IMAGE:8951922.5p TGGGGTTTAGATTAACTAAACCAAGTGACACCAAAATTGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCACCCCAAATGTCTCGTGTGATCTGACCTGCCGTCTGTCCAAGCCTGCAGTATGATGACATCAGCTGCATTAGACTGCAGCACATGCATGAGTATCTGATACACAGAAGACAGTTGTCTCCACTGACTCAATGGGTGAACC 5 1 2 10 bld Spl2 5g3 in CBSS4261.fwd ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATAACATCAA 5 1 2 10 bld Tail 5g3 in CBSW11714.b1 ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAG 5 1 2 10 bld Tail 5g3 in CBSW2800.b1 ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGA 5 1 2 10 bld Tail 5g3 in CBSW2811.b1 ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATG 5 1 2 10 bld Tail 5g3 in CBSW6099.b1 ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGT 5 1 2 10 bld Tbd1 5g3 in CBXT20631.b1 ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCG 5 1 2 10 bld Tbd1 5g3 in CBXT3926.b1 ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTTTTGATAGCGGCAAATGCGACGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCATGGCCGATTCAAGGGAACAGTGAAGGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAATCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCAGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGAGAACTCTCTTCAAGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACTGGAATGGCTTTCCGT 5 1 2 10 bld Tbd1 5g3 in CBXT4438.b1 ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTTTTGATAGCGGCAAATGCGACGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCATGGCCGATTCAAGGGAACAGTGAAGGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAATCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCAGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGAGAACTCTCTTCAAGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACTGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGT 5 1 2 10 bld Tbd1 5g3 in CBXT6884.b1 ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTTTTGATAGCGGCAAATGCGACGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCATGGCCGATTCAAGGGAACAGTGAAGGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAATCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCAGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGAGAACTCTCTTCAAGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACTGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATC 5 1 2 10 bld Tbd1 5g3 in CBXT7281.b1 ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAA 5 1 2 10 bld Eye 5g3 in CCAX4264.b1 ........................................................................................................................................................................................................CGAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATG 5 1 2 bld Abd0 5g3 in IMAGE:6999518 GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGGACCATGACAAAAAAGATAACTCTCTTCAGGTTGTCAGCAACGCATCCTGCCAAAACAAATGGCCTGGTCCCTTTTGGAAAAGGTCTCCAAGGAAAACTTTGGATCCTGGAAGGAAAGGAAAAAAACGGTCCATTGCTTTTTGGGCCCCAAAAAAATTGGGAGGGCCCCCTTGAAACCCGGGAAAAAAGGAAAAAGTCCGGAAAAAAATTTCCCTCCCCCATGGGGCGCAAAAGGGGTGTGAAAAATCCCCCCTATAAAGAGAAAAAAGGAGAAGTTTTTTTTTCCCCCCCAATTTTTTGGG 5 1 2 bld TpA 5g3 in TTpA019d01.p1kSP6 AGAGGGGTTGATAACTAAACCAAGNTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGACCAGGTTGTCTCCACTGACTTNCATGGTGACACTCATTCCTCCATCTTTGATGCTGGAGCTGGAATTGCACTGA 5 1 2 bld TpA 5g3 in TTpA051d12.p1kSP6 AGAGGGGTTGATAACTAAACCAAGGTGACACCTAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGATCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCATCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAATGTATGAGGTGGAATCTACTGGAGTCTTCACAACCGAAGAGAACGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCATCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGACGGACTGATGACTACCGTCCATGCCTTCACTGCCAC 5 1 2 14 bld Met4 5g3 in CUNC687.5p .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAGACCAAGTGACACCAGAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAATGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGAGCA 5 1 2 12 bld Tad5 5g3 in XZT18765.5p .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCC 5 1 2 12 bld Tad5 5g3 in XZT31400.5p .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATG 5 1 2 10 bld Bone 5g3 in CBTC420.fwd .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTA 5 1 2 20 bld Spl2 5g CBSS2378.fwd .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGAACTGCCGTCTGTCCAG 5 1 2 10 bld Spl2 5g3 in CBSS2478.fwd .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGNCAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACNCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAAGTGCCNGTCAGAACATCATCCCTGCCTCAACTNNGTGCAGCAAGGCT 5 1 2 10 bld Tail 5g3 in CBSW11592.b1 .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCAC 5 1 2 10 bld Tail 5g3 in CBSW3163.b1 .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGG 5 1 2 10 bld Tail 5g3 in CBSW5747.b1 .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTGTCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCC 5 1 2 10 bld Tail 5g3 in CBSW6666.b1 .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCAC 5 1 2 bld Tail in CBSW7422.b1 GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCC 5 1 2 bld Tail in CBSW8409.b1 GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCG 5 1 2 10 bld Tbd1 5g3 in CBXT16750.b1 .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGT 5 1 2 10 bld Tbd1 5g3 in CBXT2371.b1 .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGA 5 1 2 20 bld Tbd1 5g CBXT5914.b1 .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAAGGCTGCCATTAAGACTG 5 1 2 10 bld Tbd1 5g3 in CBXT7152.b1 .........................................................................................................................................................................................................GAGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGC 5 1 2 bld TpA 5g3 in TTpA009f08.p1kSP6 AGAGGGGTTGATAACTAAACCAAGTGATACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGACCAGGTTGTCTCCACTGACTT 5 1 2 bld TpA 5g TTpA041d23.p1kSP6 AGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCT 5 1 2 bld TpA 5g TTpA070d11.p1kSP6 AGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGNCAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCT 5 1 2 bld TpA 5g TTpA072l07.p1kSP6 AGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCAACCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACTCATCCCTGCCTCAACTGGTGCAGCATAGGCTGTTGGGATAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAT 5 1 2 bld TbA 5g3 in TTbA008b20.p1kSP6 AGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTTCAATATGAC 5 1 2 bld TbA 5g3 in TTbA012j24.p1kbSP6 AGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACAGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCA 5 1 2 bld TbA 5g TTbA015d12.p1kSP6 AGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 bld TbA 5g3 in TTbA032g09.p1kSP6 AGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 bld HdA 5g3 in THdA027a24.p1kaSP6 AGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGT 5 1 2 bld In54 5g IMAGE:8947143.5p AGGGGTTTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGAATGCTTTCCGTGTCCCACCTCAAATGTCTTCCGTTGTGATCTGACCTGCGTCTGTCCAGCTTGCAGTATGATGAACTCAGCTGCATTAGACTGCAGCACATGACATGAGTATCTGAATACACGAAAGACAGTGCTCACTGACTCAATGTGACTCATCTCAATCTGATGCTGGGACCTGGATGCACTGGAACGAATAACCTTTGTCGAC 5 1 2 10 bld Tail 5g3 in CBSW5325.b1 ..........................................................................................................................................................................................................CGTCCGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGC 5 1 2 10 bld Tail 5g3 in CBSW7571.b1 ..........................................................................................................................................................................................................AGAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCC 5 1 2 bld Tad0 5g IMAGE:6983854 GAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCAAAGT 5 1 2 14 bld Brn4 5g3 in CAAL20406.5p ...........................................................................................................................................................................................................GAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCNAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCC 5 1 2 24 bld Met5 5g CACX1339.5p ...........................................................................................................................................................................................................GAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACA 5 1 2 12 bld Tad5 5g3 in XZT40988.5p ...........................................................................................................................................................................................................GAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAAGCCTGCCAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAGGGGAATCCTGGAATACACAGAAGAC 5 1 2 22 bld Tad5 5g XZT41641.5p ...........................................................................................................................................................................................................GAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAG 5 1 2 22 bld Tad5 5g XZT45704.5p ...........................................................................................................................................................................................................GAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGACCAGGTTGT 5 1 2 bld Gas8 5g3 in st24h12.5p GAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGC 5 1 2 10 bld Bone 5g3 in CBTC4426.fwd ...........................................................................................................................................................................................................GAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAG 5 1 2 10 bld Tail 5g3 in CBSW801.b1 ...........................................................................................................................................................................................................GAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATC 5 1 2 10 bld Tail 5g3 in CBSW8430.b1 ...........................................................................................................................................................................................................GAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACC 5 1 2 10 bld Tbd1 5g3 in CBXT8211.b1 ...........................................................................................................................................................................................................GAGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTTTTGATAGCGGCAAATGCGACGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCATGGCCGATTCAAGGGAACAGTGAAGGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAATCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCAGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGAGAACTCTCTTCAAGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACTGGAATGGCTTTCCGTGTC 5 1 2 14 bld Brn4 5g3 in CAAL18638.5p ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCTTCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGC 5 1 2 24 bld Brn4 5g ? CAAL20478.5p ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCCAGGCTGCCATTAAGACTGCAGCACA 5 1 0 chi Brn4 5x in CAAL21070.5p AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGTAGGTGGCTCCGTTCATCTGCATTTTTGTGTTCTAGAGTATAAAATGCTCGGGAATTAACCCCTCCCACTCTCCGCAGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACAGTCTTCCAAGAGTAAGTGAGGTGGTGGCTCAGTCCTGGCCTGGTTCTAGACTGGGTTCCTGCAGCAGAATCTAATCACAGGGGGGATGTTTACAGTTCTCTCCTCTCCCCAGGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTGTAAGTAGTTACACCCCCCCCCCCCCCATAACATTTGGCTTTCTATATCTAGAATTCACCCTGGACTTTTTTTTTTTAATTTTTACCTGCAGTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGGTAAGTGTGGGGTAAAAATGGGCGTTCCTTTAAAGGGGAAGCGAACTACCACAATGCTACAGGCTGTCTGCAAGCTTCT 5 1 2 14 bld Brn4 5g3 in CAAL23456.5p ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGGAATCCTGGAATACACA 5 1 2 14 bld Brn4 5g3 in CAAL5892.5p ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACAT 5 1 2 14 bld Brn4 5g3 in CAAL6822.5p ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGTCTGCCAAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATG 5 1 2 14 bld Brn4 5g3 in CAAL8878.5p ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATA 5 1 2 14 bld Brn4 5g3 in CAAL9740.5p ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAANGGAATCCTGGAATACA 5 1 2 24 bld Te5 5g CAAO1302.5p ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCCAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACAC 5 1 2 bld Te5 in CAAO8061.5p AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCCAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCCAGCCTGCCAAGTATGATGACATCAAAGCTGCCATTAAGACTGCAGCACATG 5 1 2 bld Te5 in CAAO9207.5p AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATG 5 1 2 14 bld Met5 5g3 in CACX1053.5p ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGA 5 1 2 24 bld Met5 5g CACX957.5p ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAAT 5 1 2 14 bld Met2 5g3 in CUNH1288.5p ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTTCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTC 5 1 2 10 bld Bone 5g3 in CBTC1338.fwd ............................................................................................................................................................................................................GGAGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAG 5 1 2 10 bld Bone 5g3 in CBTC6010.fwd ............................................................................................................................................................................................................GGNGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGANCAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTC 5 1 2 10 bld Thy1 5g3 in CBST8730.fwd ............................................................................................................................................................................................................TCCGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCAT 5 1 2 10 bld Tail 5g3 in CBSW4005.b1 ............................................................................................................................................................................................................AGGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAANGCTGCCATTAAG 5 1 2 bld Neu0 5g3 in IMAGE:6991907 GGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAAGCTGTTGGAAAAGTCATCCCTGAGCTGAATGGCAACTGACAGGAATGGCTTTCCCGTGTCCCACCCCCAATGTCTCCGTTGTGGATCTGAACTGNCGTCTGTCCAAGCCTGCAAGTATGATGACATCNAGGCTGACCATTAAGACTGCAGCACATGGGCCCAATGGAGGGGAATCCTGGAATACACAGAAAGACCAGGGTTGGTCTCCACGGACTTCCAATGGGTGGACCCTCCATTCCTCCCATCCTTTGAAGGCCG 5 1 2 bld Neu0 5g IMAGE:6993188 GGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTTCCTTTGTGGATCTGGACCCTGCCGTCTTGTCCAAGCCCTGCGCAAGGTATTGATGGACTTCCAAGGGCTTGCCCATTTAAGAACTGGCCAGCACAATGGGCCCCCAATG 5 1 2 bld Abd0 5g IMAGE:7016506 GGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAACTGACAGGAATGGGCTTCGTG 5 1 2 bld Brn4 out CAAL23160.5p GGGTTGATACACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGT 5 1 2 12 bld Tad5 5g3 in XZT43269.5p .............................................................................................................................................................................................................GGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAAGGAATCCTGGAATACAC 5 1 2 bld Gas8 5g st83e09.5p GGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGANGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTG 5 1 2 10 bld Bone 5g3 in CBTC5702.fwd .............................................................................................................................................................................................................GGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCCTCACTGGTGCAGCAAAGGCTGTTGNGAAAGTCATCCCTGAGCTGAATGCAAACTGACAGGAATGGCTTTCCGTGT 5 1 2 20 bld Bone 5g CBTC6795.fwd .............................................................................................................................................................................................................GGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCAAATGTCTCCGT 5 1 2 20 bld Limb 5g CBSU2614.fwd .............................................................................................................................................................................................................GGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTG 5 1 2 10 bld Tail 5g3 in CBSW11294.b1 .............................................................................................................................................................................................................GGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCT 5 1 2 10 bld Tail 5g3 in CBSW4457.b1 .............................................................................................................................................................................................................GGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCC 5 1 2 10 bld Tbd1 5g3 in CBXT618.b1 .............................................................................................................................................................................................................GGGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCA 5 1 2 bld Abd0 5g3 in IMAGE:6999913.b CGGATGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTG 5 1 2 bld Abd0 5g IMAGE:7002628 GATTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCAAATGTCTCGN 5 1 2 bld Abd0 5g IMAGE:7002821 GAGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGGCAACTGACGGGAATGGCTTCCGTGTCCCACCCCAAN 5 1 2 bld Neu 5g TNeu024n17.p1kSP6 GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCANAACATCATCCCTGCCTCAACTGGTGC 5 1 2 bld TpA 5g3 in TTpA069o18.p1kSP6 GGGTTGATAACTAAACCAAGTGACACCAACATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGACGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGC 5 1 2 bld TbA 5g3 in TTbA027a04.p1kSP6 GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 14 bld Brn2 5g3 in CAAJ14795.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCA 5 1 2 bld Brn3 in CAAK6061.5p GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACAC 5 1 2 14 bld Brn4 5g3 in CAAL11223.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCCAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGGATCCTG 5 1 2 14 bld Brn4 5g3 in CAAL11414.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACAGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAAGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCC 5 1 2 14 bld Brn4 5g3 in CAAL11933.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACA 5 1 2 14 bld Brn4 5g3 in CAAL12181.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATC 5 1 2 14 bld Brn4 5g3 in CAAL18588.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACAT 5 1 2 24 bld Brn4 5g CAAL21412.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACAT 5 1 2 14 bld Brn4 5g3 in CAAL22133.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCCGTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCCAGTATGATGACATCAAGGCTGCCATAAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAG 5 1 2 14 bld Brn4 5g3 in CAAL22773.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCCTGCCAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 14 bld Brn4 5g3 in CAAL23304.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGGCAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGGCAAGTATGATGACATCAAGGCTGCCATTAGACTGCAGCACATGGCCCAATGAAGGGAATCCCTGGATACACAG 5 1 2 24 bld Brn4 5g CAAL23305.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCT 5 1 2 24 bld Brn4 5g CAAL6300.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATG 5 1 2 14 bld Brn4 5g3 in CAAL7866.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAAGCCTGCCAAGTATGATGACATCCAAGCTGCCATTAAGACTGCAGCACATGGCCCAT 5 1 2 14 bld Brn4 5g3 in CAAL9529.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCNCAGTATGATGACATCAAGGCTG 5 1 2 bld Te5 in CAAO12443.5p GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCNCAGTATGATGAC 5 1 2 bld Te5 CAAO3790.5p GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACAGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCC 5 1 2 bld Te5 in CAAO7685.5p GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCA 5 1 2 14 bld Met5 5g3 in CACX1206.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAAATGGCAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCNAGGCTGCCATTAAGACTGCAGCACA 5 1 2 14 bld Met5 5g3 in CACX1240.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATGGCCC 5 1 2 14 bld Met5 5g3 in CACX1328.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGG 5 1 2 14 bld Met5 5g3 in CACX1466.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCA 5 1 2 22 bld Tad5 5g XZT67597.5p ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAANGGAATCCTGGAATACACAG 5 1 2 10 bld Bone 5g3 in CBTC5018.fwd ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATG 5 1 2 20 bld Spl2 5g CBSS9174.fwd ..............................................................................................................................................................................................................CTCCGGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTT 5 1 2 10 bld Tail 5g3 in CBSW885.b1 ..............................................................................................................................................................................................................GGGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTGTCCC 5 1 2 bld TpA 5g3 in TTpA022a21.p1kaSP6 GTTGATAACTAAACCAAGTGACACCACAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCAGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCAGTCAGAACATCATCCCTGCCTCAACTGGTGCATCAAA 5 1 2 bld Tad0 5g IMAGE:6986107 GGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAACTGACGGGATGGCTTCCGTGTCTCCCCCAAATGTCTCCTTGTGGACTGACTGCGTC 5 1 2 bld Abd0 5g3 in IMAGE:6999388 GGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCCACTGCCTGGGCTCTTCTGCAAAGGTCATCAATGACCACTTTGCCATCCTGGAAGGACTGAAGACTACCGTCCATGCTTTCACTGGCACCCAAAAGAATGGGGAATGGCCATTCTGCCAACCTGGAAAAAATGGCAAAGGTCCGGTCAAAATTTTCCCGCCCCACTGGGGACAAAGGTTGTTGGAATTTCTCCGACTTATGGGAATGAGGGGAGGGTTTTCGGTCCCCCCCAAAATCCTTTTGGAAAACCACCCCCCCCCCCCCCCCAAAAAAAAACAGGG 5 1 2 bld Abd0 5g IMAGE:7016082 GATTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTAGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGNCAACTGACAGGAATGGCTTTCCGTGTCCC 5 1 2 12 bld Tad5 5g3 in XZT28964.5p ...............................................................................................................................................................................................................GGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCA 5 1 2 bld Gas8 5g st106l19.5p GGTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCNNCAACGCATCCTGCACAACCAANTGCCTGGCTCCTCTTGNAAANGTCNTCAATGACNNCTTTGNNATCNTG 5 1 2 chi Tad0 5x IMAGE:6983525 GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATNNAGTGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACACCAAAGAGAAAGGCGGTTNGCACTTGAAAGGAGGTGCCAGCGTGTCATTATCTCTGCCCCTACACTGAAGCCCCCTGTTTTGTTGTGGGGTGAAACCTGGAAAAAATGAAAACTTCTTCCCTTGTTAAAAACCATCCGGCAAACAAATGGCTGGTCCCCTTGGAAAGGCATCAAAAAACTTTTGGTCTCGGGGGTATAAGAAACCTCCCTCCTTCCCGCCCCCCAAAAAATGGGAGGGCCCTCGGGACGTGGGAAAAGGAGAAAGGGGGGAGAAAATTCCCCCTCCCCAAGGGGGAAAAGGGGTGGAAAAACCCCCAAAAA 5 1 2 bld Neu0 5g3 in IMAGE:6991871 GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATAAAAN 5 1 2 bld Neu0 5g3 in NISC_ng16a11.y1 GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCC 5 1 2 14 bld Brn2 5g3 in CAAJ15739.5p ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAAT 5 1 2 24 bld Brn4 5g CAAL11010.5p ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCC 5 1 2 14 bld Brn4 5g3 in CAAL18456.5p ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACAT 5 1 2 24 bld Te5 5g CAAO6598.5p ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGC 5 1 2 10 bld Bone 5g3 in CBTC10886.fwd ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGT 5 1 2 10 bld Bone 5g3 in CBTC11162.fwd ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACNATCANGCTGCCATTAAGACTGCAGCACATGGC 5 1 2 10 bld Limb 5g3 in CBSU1334.fwd ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCTGCCAAGTATGA 5 1 2 10 bld Limb 5g3 in CBSU4642.fwd ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAAGCCTGCAAGTATGATGA 5 1 2 10 bld Tail 5g3 in CBSW11276.b1 ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 10 bld Tail 5g3 in CBSW5548.b1 ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAA 5 1 2 10 bld Te1 5g3 in CBWN10480.b1 ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCG 5 1 2 10 bld Te1 5g3 in CBWN11235.b1 ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGA 5 1 2 10 bld Tbd1 5g3 in CBXT19190.b1 ................................................................................................................................................................................................................GTTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTTTTGATAGCGGCAAATGCGACGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCATGGCCGATTCAAGGGAACAGTGAAGGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAATCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCAGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGAGAACTCTCTTCAAGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACTGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAA 5 1 2 bld Tbd0 5g IMAGE:6976790 GTTGATAACTAAACCAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAAGCTGTTGGGGAAAGTCATCCCCTGAGCTGAATGGCAAACTGACAGGAATGGGCTTTCGTGTCCCCACCCCCAATGTCTCCCGTTGTGGGATCTGACCTGCCGTTCTGTCCCAAGCCTGCCCAAGTATGATGACATCAAGGCTGCCCTTTAAAACTGCACCACATGGCCCCAAATGAAGGGT 5 1 2 bld TpA 5g TTpA064m07.p1kSP6 TTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACA 5 1 2 bld TbA 5g3 in TTbA068n22.p1kSP6 TTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGAACAGGTTGTCTCCACTGACTTTCATGGTGACACTCATTCCTCCATCTTTGATGCT 5 1 2 bld HdA 5g3 in THdA035c11.p1kaSP6 TTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 14 bld Brn4 5g3 in CAAL11182.5p .................................................................................................................................................................................................................TTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCCAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGG 5 1 2 10 bld Tail 5g3 in CBSW5399.b1 .................................................................................................................................................................................................................GTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCC 5 1 2 10 bld Tail 5g3 in CBSW7614.b1 .................................................................................................................................................................................................................TTGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTC 5 1 2 24 bld Brn4 5g CAAL20865.5p ..................................................................................................................................................................................................................TGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTC 5 1 2 20 bld Bone 5g CBTC3185.fwd ..................................................................................................................................................................................................................TGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGG 5 1 2 10 bld Bone 5g3 in CBTC5094.fwd ..................................................................................................................................................................................................................TGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAGCCTGCCA 5 1 2 10 bld Bone 5g3 in CBTC7227.fwd ..................................................................................................................................................................................................................TGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTC 5 1 2 10 bld Limb 5g3 in CBSU4717.fwd ..................................................................................................................................................................................................................TGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAAGCCTGCCAAGTATGATG 5 1 2 30 bld Tail 5x3 out CBSW1359.b1 ..................................................................................................................................................................................................................TGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCC 5 1 2 10 bld Tail 5g3 in CBSW9688.b1 ..................................................................................................................................................................................................................TGATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCC 3 -1 2 bld Mus1 in CABH6117.3p GATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGNCCAATGAAGGGGATCCTGGAATACACAG 5 1 2 10 bld Bone 5g3 in CBTC1183.fwd ...................................................................................................................................................................................................................GATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTAT 5 1 2 10 bld Bone 5g3 in CBTC4343.fwd ...................................................................................................................................................................................................................GATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAAA 5 1 2 10 bld Limb 5g3 in CBSU2088.fwd ...................................................................................................................................................................................................................GATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCA 5 1 2 10 bld Te1 5g3 in CBWN11918.b1 ...................................................................................................................................................................................................................GATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAAGGCTGCCAT 5 1 2 10 bld Eye 5g3 in CCAX6813.b1 ...................................................................................................................................................................................................................GATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGA 5 1 2 20 bld Hrt1 5g CAAQ5037.5p ....................................................................................................................................................................................................................ATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 bld Gas8 5g3 in st10i07.5p ATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGC 5 1 2 10 bld Tbd1 5g3 in CBXT17615.b1 ....................................................................................................................................................................................................................ATAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGGCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTTGCTGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAGGCTGTTGGGAAAGTCATCCCTGAGCTGATGGCAAACTGACGGGGATGGCTTTCCGTGGTCCCCACCCCGAATGTCTCGTT 5 1 2 bld Abd0 FLq IMAGE:7017410 CGAGTGCGACTGGGCTCTCGTGAGTCTTCTAGAGACTTCTCTCATTAAAATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACAAACTGCCTGGCTCCTCTTGCAAAGGTCATCCATGACAACTTTTGGCATCCTGGAGGGACTGATGACTAACGTCCATGCCTTCACTGGCACCAAAAAAACTGTGGATGGCCCTTCTGGAAACTTTGAAAAGATGGCAAAAGTGCGGTTCAACAATCATCCTGCCTAAATGGTGCAAAAAAGGTGTTTGGAAATTCTCC 5 1 2 bld Neu 5g TNeu048g08.p1kSP6 GGTTGATACTACCAATGACCCAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGT 5 1 2 14 bld Brn4 5g3 in CAAL21422.5p .....................................................................................................................................................................................................................TAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGAATCTGAACTGCCGTCTGTCCAAGCCTGCCCAGTATGATGACATCAAAGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACAC 5 1 2 14 bld Brn4 5g3 in CAAL9001.5p .....................................................................................................................................................................................................................TAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGAACTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATG 5 1 2 bld Te5 in CAAO4062.5p TAACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCCTGGATACAC 5 1 2 bld HdA 5g3 in THdA013c19.p1kbSP6 AACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACNTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGNTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGAACAGGTTGTCTCCACTGAC 5 1 2 14 bld Brn4 5g3 in CAAL11147.5p ......................................................................................................................................................................................................................AACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAANGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCC 5 1 2 20 bld Limb 5g CBSU577.fwd ......................................................................................................................................................................................................................AACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGT 5 1 2 10 bld Tail 5g3 in CBSW12166.b1 ......................................................................................................................................................................................................................AACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCC 5 1 2 10 bld Tail 5g3 in CBSW5052.b1 ......................................................................................................................................................................................................................AACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACT 5 1 2 10 bld Tbd1 5g3 in CBXT22777.b1 ......................................................................................................................................................................................................................AACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTG 5 1 2 10 bld Tbd1 5g3 in CBXT4076.b1 ......................................................................................................................................................................................................................AACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTTTTGATAGCGGCAAATGCGACGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCATGGCCGATTCAAGGGAACAGTGAAGGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAATCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCAGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGAGAACTCTCTTCAAGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAACGGCAAACTGACTGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATG 5 1 2 10 bld Eye 5g3 in CCAX7905.b1 ......................................................................................................................................................................................................................AACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCT 5 1 2 10 bld Eye 5g3 in CCAX8621.b1 ......................................................................................................................................................................................................................AACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCT 5 1 2 10 bld Mus1 5g3 in CABH5052.5p .......................................................................................................................................................................................................................CATCGATTCGGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGAACAGGTTGTCTCCACTGACTTC 5 1 2 10 bld Tail 5g3 in CBSW1278.b1 .......................................................................................................................................................................................................................ACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCANACTGACAGGAATGGCTTTCCGTGTCCCCACCCCCAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCC 5 1 2 10 bld Tail 5g3 in CBSW6432.b1 .......................................................................................................................................................................................................................ACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCG 5 1 2 10 bld Tail 5g3 in CBSW6837.b1 .......................................................................................................................................................................................................................ACTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGAT 5 1 2 bld TbA 5g3 in TTbA072n15.p1kSP6 CTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATNCANGCTGCCATTAAGACTGCAGCACATGGCCCAATGAANGGAATCCTGGAATACACAGAAGAACAGGTTGTCTCCACTGACTTTCATGGTGACACTCATTCCTCCATCTTTGATGCTGGAGCTGGAATTGCACTGAA 5 1 2 10 bld Ovi1 5g3 in CABI9014.5p ........................................................................................................................................................................................................................CAATTCGGCACGAGGACAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACA 5 1 2 20 bld Bone 5g CBTC3384.fwd ........................................................................................................................................................................................................................CTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGA 5 1 2 20 bld Bone 5g CBTC7836.fwd ........................................................................................................................................................................................................................CTAAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTG 5 1 2 bld Egg 5g TEgg141f18.p1kSP6 AAACCAAGTGACACCAAAATTGACTGTCAAGAATGGAATTCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAGCCTGCCAAGTATGATGACATCAAGGCTGCCAT 5 1 2 bld HdA 5g THdA009h03.p1kaSP6 CTAACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACAGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGAACAGGTTGTCTCCACTGACTTCAATGGTGACACTCATTCCTCCA 5 1 2 bld Neu 5g TNeu004b09.p1kSP6 ACTAAACCAATGACACCAAATGACTGTCAAAATGGAATCATGGNTTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAATCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGNAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAAAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCTAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTG 5 1 2 bld HeRe 5g3 in EC2CAA2AD12.g1 AACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGC 5 1 2 bld In62 5g IMAGE:8957189.5p CACGTCGACCATCCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAAACATCATCCCTGCTCAACTGGTGCAGCAAGGCTGTTGGGAAAGTCATCCCTGAGCTGATGCAAACTGACGGGATGCTTTCGTGTCCCCACCCAAATGTCTCGTGTGATCTGACTGCGTCTGTCAGCTGCCAGTTGATGACTCAGCTGCATAAGACTGCAGCATGGCATGAAGAATCTGGATACAGAAACAGTGCTCCATGACTCATGGTGACCTCA 5 1 2 10 bld Liv1 5g3 in CAAR10786.5p ............................................................................................................................................................................................................................ACCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGACCAGGTTGTCTCCACTGACCTTCATGGTGACACTCA 5 1 2 10 bld Mus1 5g3 in CABH10764.5p ............................................................................................................................................................................................................................CCTCGTGCCGACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAAT 5 1 2 10 bld Mus1 5g3 in CABH3149.5p .............................................................................................................................................................................................................................CCAAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGGATCCTGGAATACACAG 5 1 2 10 bld Liv1 5g3 in CAAR10997.5p ...............................................................................................................................................................................................................................CCTCGTGCCGAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCANATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAG 5 1 2 bld Tad5 in XZT841.5p AAGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAATGTCTCCGTTGTGGAT 5 1 2 bld TpA 5g3 in TTpA046f02.p1kSP6 AGTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGNAATACACAGAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCATTCCTCCATCTTTGATGCT 5 1 2 20 bld Liv1 5g CAAR13201.5p ................................................................................................................................................................................................................................CCGAGGACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATG 3 -1 2 bld Mus1 in CABH10570.3p CGAGAGGCCCAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGAACAGGTTGTCTCCACTGACTTCAATGGTGACACTCATTCCTCCATCTTTGATGCT 3 -1 2 bld Lun1 in CABD6846.3p AGGGCGAGAGGCTGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACA 5 1 2 bld Tad5 XZT547.5p GTGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTG 5 1 2 10 bld Hrt1 5g3 in CAAQ9180.5p ..................................................................................................................................................................................................................................TGACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAG 3 -1 2 bld Hrt1 in CAAQ6745.3p GACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGGATCCTGGAATACACAGAAGAC 5 1 2 10 bld Liv1 5g3 in CAAR8026.5p ...................................................................................................................................................................................................................................GACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTAATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGA 5 1 2 10 bld Liv1 5g3 in CAAR8492.5p ...................................................................................................................................................................................................................................GACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCANAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCAAGCCTGCCAAGTATGATGACATCAAGGCTGC 5 1 2 10 bld Liv1 5g3 in CAAR9948.5p ...................................................................................................................................................................................................................................GACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGACCAGGTTGTCTCCACTGANCTTCATGGTGACACTCAT 5 1 2 bld Lun1 in CABD6334.5p GACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATG 5 1 2 10 bld Ova1 5g3 in CABE13033.5p ...................................................................................................................................................................................................................................GACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCA 5 1 2 10 bld Mus1 5g3 in CABH1911.5p ...................................................................................................................................................................................................................................GACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATNCAGGCTGCCATTAAGACTGCAGCACATGGCCC 5 1 2 10 bld Mus1 5g3 in CABH2506.5p ...................................................................................................................................................................................................................................GACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACA 5 1 2 10 bld Mus1 5g3 in CABH3640.5p ...................................................................................................................................................................................................................................GACACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAG 5 1 2 20 bld Limb 5g CBSU8158.fwd ....................................................................................................................................................................................................................................TCCGCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAATGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACAGGAATGGCTTTCCGTGTCCCCACCCCAA 5 1 2 10 bld Mus1 5g3 in CABH11555.5p .....................................................................................................................................................................................................................................CACCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGAC 3 -1 2 bld Ovi1 in CABI1314.3p CCTATAGGGCGAGAGGCCAGATTGGAATAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAGAAGAACAGGTTGT 5 1 2 bld Hrt1 5g CAAQ5977.5p CCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCCAATGAAGGGAATCCTGGAATACACA 3 -1 2 bld Mus1 in CABH11321.3p CCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGGATCCTGGAATA 5 1 2 10 bld Ovi1 5g3 in CABI5574.5p .......................................................................................................................................................................................................................................CCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGTGAAGTCGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAATATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCCGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGGGAAAGTCATCCCTGAGCTGAATGGCAAACTGACGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTCTCCGTTGTGGATCTGACCTGCCGTCTGTCCAAGCCTGCCAAGTATGATGACATCAAGGCTGCCATTAAGACTGCAGCACATGGCCCAATGAAGGGAATCCTGGAATACACAG 5 1 2 20 bld Bone 5g CBTC7619.fwd .......................................................................................................................................................................................................................................CCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTACATGTTCAAGTATGACTCCACCCACGGCCGATTCAAGGGAACAGTGTGTGTTGAGAATGGCAAGCTGGTTATCAATGGCAAGGCAGTCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGGGGCGATGCTGGTGCAGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCAAAGAGAAGGCTGGTTTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCTGCCCCCTCAGCTGATGCCCCCATGTTTGTTGTTGGGGTGAACCATGACAAATATGATAACTCTCTTCACGTTGTCAGCAACGCATCCTGCACAACCAACTGCCTGGCTCCTCTTGCAAAGGTCATCAATGACAACTTTGGCATCCTGGAGGGACTGATGACTACCGTCCATGCCTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCTGGCAAGCTGTGGAGAGATGGCAGAGGTGCCGGTCAGAACATCATCCCTGCCTCAACTGGTGCAGCAAAGGCTGTTGNGAAAGTCATCCCTGAGCTGAAACGCAACTGACAG 5 1 2 20 bld Limb 5g CBSU7636.fwd .......................................................................................................................................................................................................................................CCAAAATGACTGTCAAGATTGGAATCAATGGATTTGGCCGCATCGGGCGCCTGGTGACCCGCGCTGCTGTTTTAAGCGGCAAATGCGAAGTTGTTGCAATCAATGACCCCTTCATTGACTTGGACTACATGGCTTAC