Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CAAR6785.3                          195 END     2           0        1                Hypothetical protein MGC69465 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 553.0    0Xt7.1-TTpA026b05.3.5                      193 PI      75        237     1285                eukaryotic translation initiation factor 4A, isoform 1 [Xenopus tropicalis]
     3 198.0    0Xt7.1-IMAGE:7006964.3                       4 PI      76       1062     1430                translational eukaryotic inititation factor 4AII [Gallus gallus]

 This cluster: approximate FL confidence score = 96%

 1012069972 Xt7.1-XZT27685.5 - 908 ESTs
                                                                       ........-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT27685.5                                                                                                                                                                                                                                                                                                                                                                                                     TGGGGTCATTGAGGTAATGTATCCAGTCTGAGTGGCCACTGGGGGTGGGGCGGTGGCCATTGGGGGTGCCCCATCAGGCACTAACTCCTCCCTCCCTTTGCAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCGGAGGCTATATAAGGGACGGTCACCGGCTTGTTAGAAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGACCAGAAGGAGAGAGACGTCATTATGAGGGAGTTCCGATCTGGATCCAGTCGGGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGATCTGCCGACCAACAGGGAGAACTACATCCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATTAACATGGTGACAGAGGATGACAAGCGCACGCTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGGCCGACCTCATCTAACGCCCCCGCCGCAGTCGGAGGGGCAGAAAAACCCGAAAAAAACAGAAAAAAGCATAAAATGAAAATAAAAAGTCGGCCCCGGCTTTCTTTGGGGCATCCGCTGAATTATGGGGGTGTATAGAGCAATGACCATAGCGCCCCTGAGTGGGCGTAGCCTCCACTCCCTGTCACATGATCTGATTTTCTTTCCAATAAATGTTATTTTGAGGTATTGTGGCCGTAACCTGCATCCGTTGTTTCTTTCCTTCTGAAGTGAACACTAAACGTCACTTTTTCCCACCAAATCAGTGGACCAAAGTCCCCCCCAGCTCATCCCTTTAAGATCCGGCAGCTCAATGTGAGTTTTTTCTTTTTTTTTTTTTTTACAAAACTCCCCAAAATTTAAAAAATACCATTTTATTTGCTTTTTCTGTATAGTATTTATTAAATAAAATAAAAATTTACATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221145                                                                                                                                                                                                                                                                                                                                                                                                           CATTGAGGTAATGTATCCAGTCTGAGTGGCCACTGGGGGTGGGGCGGTGGCCATTGGGGGTGCCCCATCAGGCACTAACTCCTCCCTCCCTTTGCAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCxxxGxxTATATAAGGGACGGTCACCGGCTTGTTAGAAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGACCAGAAGGAGAGAGACGTCATTATGAGGGAGTTCCGATCTGGATCCAGTCGGGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGATCTGCCGACCAACAGGGAGAACTACATCCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATTAACATGGTGACAGAGGATGACAAGCGCACGCTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGGCCGACCTCATCTAACGCCCCCGCCGCAGTCGGAGGGGCAGAAAAACCCGAAAAAAACAGAAAAAAGCATAAAATGAAAATAAAAAGTCGGCCCCGGCTTTCTTTGGGGCATCCGCTGAATTATGGGGGTGTATAGAGCAATGACCATAGCGCCCCTGAGTGGGCGTAGCCTCCACTCCCTGTCACATGATCTGATTTTCTTTCCAATAAATGTTATTTTGAGGTATTGTGGCCGTAACCTGCATCCGTTGTTTCTTTCCTTCTGAAGTGAACACTAAACGTCACTTTTTCCCACCAAATCAGTGGACCAAAGTCCCCCCCAGCTCATCCCTTTAAGATCCGGCAGCTCAATGTGAGTTTTTTCTTTTTTTTTTTTTTTACAAAACTCCCCAAAATTTAAAAAATACCATTTTATTTGCTTTTTCTGTATAGTATTTATTAAATAAAAxxxAAATTTxxxxAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                          3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     6     3     7     3     8     3    11     4    15     5    20     7    25    33    57    79   111   221   264   250   304   274   324   322   351   351   368   353   371   359   376   365   382   365   383   364   386   366   387   372   389   376   391   373   394   372   395   377   396   375   398   389   400   385   400   393   404   395   406   401   413   396   415   405   416   404   421   413   428   412   430   408   430   403   433   406   432   411   433   409   435   407   437   410   438   412   442   422   461   425   468   429   474   433   481   435   483   444   489   452   499   448   502   456   508   460   513   452   511   455   516   455   520   459   522   455   519   453   518   437   506   429   499   423   502   399   484   407   481   405   491   404   486   385   483   413   493   410   493   398   492   386   478   387   476   374   470   378   464   370   457   357   447   354   445   330   409   308   399   300   394   305   393   308   398   307   401   313   395   319   393   328   395   336   398   342   405   342   404   347   406   340   410   365   409   357   411   367   411   365   408   369   408   363   405   354   405   359   413   367   414   363   416   364   414   365   416   366   418   373   417   361   419   352   417   365   410   355   406   351   401   328   398   340   393   240   293   236   276   244   276   233   274   242   272   236   269   238   270   240   269   236   266   222   257   223   247   205   242   210   232   190   220   155   196   111   155   116   132    98   125   107   124   109   122   112   121   107   119   107   117   106   114   101   114    88   104    90   101    37    99    30    96    30    94    28    91    27    87    28    87    28    84    12    31    14    19     9    13     3     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTACAAAACTCCCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TACCATTTTATTTGCTTTTTCTGTATAGTATTTATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAATTTTTGCA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------AA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---A----T---
                                               BLH ATG     209    1668                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MIN     209     299                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR     209      84                                                                                                                                                                                                                                                                                                                                                                                                     
                                               CDS MIN     209      58                                                                                                                                                                                                                                                                                                                                                                                                     
                                               EST CLI     204      58                                                                                                                                                                                                                                                                                                                                                                                                     
                                               ORF LNG     209       7                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                       PROTEIN --- Cs ---- 3e-045     BAB12216.1 vasa homolog [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 1e-046     BAE93311.1 zinc finger protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Bf ---- 5e-067     AAM18861.1 unknown [Branchiostoma floridae] ------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sc ---- 6e-144     NP_012397.1 translation initiation factor eIF4A; Tif2p [Saccharomyces cerevisiae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 7e-157     XP_780907.1 PREDICTED: similar to eukaryotic translation initiation factor 4A2 isoform 1 [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 5e-160     NP_001022623.1 INitiation Factor family member (inf-1) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 2e-172     NP_476595.1 CG9075-PC [Drosophila melanogaster] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 0          NP_989880.1 translational eukaryotic inititation factor 4AII [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Dr ==== 0          NP_958918.1 eukaryotic translation initiation factor 4A, isoform 1B [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 0          NP_659207.1 eukaryotic translation initiation factor 4A1; initiation factor eIF-4A long form[Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 0          NP_001407.1 eukaryotic translation initiation factor 4A, isoform 1 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 0          AAH77641.1 LOC444845 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 0          NP_001086413.1 translation initiation factor eIF4A II [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 0          CAJ82477.1 eukaryotic translation initiation factor 4A, isoform 1 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT27685.5                                                                                                                                                                                                                                                                                                                                                                                                                   TAA------------------------------------------------------------------------------------------------ATG------------------ATG---TGA---------------------------------------------TAG------------------ATG---------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---ATG------------------TAA------------------------------------------------------TAA---------------------------------------------------------------------TGA---TAG------TGA---------------------------ATG---TGA------------TAAATG------TGA---------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   1           Gas1 FL                     IMAGE:6986347.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGACCAGAAGGAGAGAGACGTCATTATGAGGGAGTTCCGATCTGGATCCAGTCGGGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGATCTGCCGACCAACAGGGAGAACTACATCCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATTAACATGGTGACAGAGGATGACAAGCGCACGCTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGGCCGACCTCATCTAACGCCCCCGCCGCAGTCGGAGGGGCAGAAAAACCCGAAAAAAACAGAAAAAAGCATAAAATGAAAATAAAAAGTCGGCCCCGGCTTTCTTTGGGGCATCCGCTGAATTATGGGGGTGTATAGAGCAATGACCATAGCGCCCCTGAGTGGGCGTAGCCTCCACTCCCTGTCACATGATCTGATTTTCTTTCCAATAAATGTTATTTTGAGGTATTGTGGCCGTAACCTGCATCCGTTGTTTCTTTCCTTCTGAAGTGAACACTAAACGTCACTTTTTCCCACCAAATCAGTGGACCAAAGTCCCCCCCAGCTCATCCCTTTAAGATCCGGCAGCTCAATGTGAGTTTTTTCTTTTTTTTTTTTTTTACAAAACTCCCCAAAATTTAAAAAATACCATTTTATTTGCTTTTTCTGTATAGTATTTATTAAATAAAAATTTTTGCAACATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas116f12.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACCGTCTCCGCCCTGCACGGCGACATGGACCAGAAGGAGAGAGACGTCATTATGAGGGAGTTCCGATCTGGATCCAGTCGGGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGATCTGCCGACCAACAGGGAGAACTACATCCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATTAACATGGTGACAGAGGATGACAAGCGCACGCTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGGCCGACCTCATCTAACGCCCCCGCCGCAGTCGGAGGGGCAGAAAAACCCGAAAAAAACAGAAAAAAGCATAAAATGAAAATAAAAAGTCGGCCCCGGCTTTCTTTGGGGCATCCGCTGAATTATGGGGGTGTATAGAGCAATGACCATAGCGCCCCTGAGTGGGCGTAGCCTCCACTCCCTGTCACATGATCTGATTTTCTTTCCAATAAATGTTATTTTGAGGTATTGTGGCCGTAACCTGCATCCGTTGTTTCTTTCCTTCTGAAGTGAACACTAAACGTCACTTTTTCCCACCAAATCAGTGGACCAAAGTCCCCCCCCAGCTCATCCCTTTAAGATCCGGCAGCTCAATGTGAGTTTTTTTCTTTTTTTTTTTTTTTTTTTACAAAACTCCCCAAAATTTAAAAAATACCATTTTATTTGCTTTTTCTGTATAGTATTTATTAAATAAAAATTTTTGCAACATAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAA
  5   1   1         - Neu       out                  TNeu062c02.p1cSP6                                                                                                                                                                                                                                                                                                                                        CTCACTCTCCCTCTTGTCATTTCCAGACCCAGACCAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGGTAATGTATCCAGTCTGAGTGGCCACTGGGGGTGGGGCGGTGGCCATTGGGGGTGCCCCATCAGGCACTAACTCCTCCCTCCCTTTGCAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTAAGTATTGCCCCTTCTGCCCTGTCCTGTTTGTATAATGGGCTGTCATCTGCCCCGGCTCCCCCGTAACTTCCTGTAATGCCACTTGGTACATTCCCTTCACTGAGTTTACTAGTCCTATTGATACCCCACTTTGTGTGACTTGGGGTGAGTGATGTCATGTCTGTCAACCCTTTAGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTG
  5   1   1   24    - Te4  5g   ?                          CAAN4726.5p ........................................................................................................................................................................................................................................................................................................................................AGATTGCTGCCGTGGTGGGGAGGAGCTTGTCTTCCCCTAGAGCCAATCGGGATCTGAGCCGGTCAGACAGGGCGGTAAGCGCCGGCCCCTTATTAAATATAAGCAGTGGCAGCCAATCGGCTTCGAGGCTTTCTTGAGCCGTCCTACCTGCTAAAGAAACGTCCCCTGAGCCGCCTTGGCGCTAACCAATCAGTAGCCTGAGGGGCGGAGCCGGCAGGAGGCTATATAAGGGACGGTCACCGGCTTGTTAGAAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGNTAAACAGGCGTTACCTGTCCCCCTAATACATAAAGATGTTCGTGT
  5   1   1         - Gas8      in                          st11m04.5p                                                                                                                                                                                                                                                                                                                                                                            ATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGGTAATGTATCCAGTCTGAGTGGCCACTGGGGGTGGGGCGGTGGCCATTGGGGGTGCCCCATCAGGCACTAACTCCTCCCTCCCTTTGCAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTAAGTATTGCCCCTTCTGCCCTGTCCTGTTTGTATAATGGGCTGTCATCTGCCCCGGCTCCCCCGTAACTTCCTGTAATGCCACTTGGTACATTCCCTTCACTGAGTTTACTAGTCCTATTGATACCCCACTTTGTGTGACTTGGGGTGAGTTATGTCATGTCTGTCACCCCTTTAGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTC
  5   1   1         - Gas8      out                         st34i14.5p                                                                                                                                                                                                                                                                                                                                                                               ACCCGAAGGCATGGAGCCCGAATGGGGTCATTGAGGTAATGTATCCAGTCTGAGTGGCCACTGGGGGTGGGGCGGTGGCCATTGGGGGTGCCCCATCAGGCACTAACTCCTCCCTCCCTTTGCAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTAAGTATTGCCCCTTCTGCCCTGTCCTGTTTGTATAATGGGCTGTCATCTGCCCCGGCTCCCCCGTAACTTCCTGTAATGCCACTTGGTACATTCCCTTCACTGAGTTTACTAGTCCTATTGATACCCCACTTTGTGTGACTTGGGGTGAGTGATGTCATGTCTGTCACCCCTTTAGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGGTAAGTCCCGCCCCCTCAGGGTCCTTTTTGCCGTTAGTAATTCCTTCTACACAAACACTTTTCTACATTCATCCTGTG
  5   1   1         - Egg                            TEgg029d20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCGGGcccggcccggacacggaaaggattgacagattgatagctctttctcgattctgtgggtggtggtgcatggccgttcttagttggtggagcgatttgtctggttaattccgataacgaacgagactcctccatgctaactagttacgcgacccccggcgAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGG
  5   1   1         - Gas8      in                          st76n01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTGGGCAGTTAGTGGCTGCAGATTAACAGCGTCTTCTCCCCCAGGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGTAGGTGCCTTCCTCTGGGTTCCATTGGCCCTGGGGGGTGGAGCAGTCGTTGGGATTGCACCATTACCCCCTCATAGGGGAAAGCCAATAGGAAAGCTTTAGTATATGGGGGGGGGCGAGGGTGGAAGGTGCCCCGTCACTGGGCAAGGACTGGTCTGTCTGTGACTGTGCTTCTTATATCTGGCGGGGTGAGAGCAGCGGCCCATATTCATCCCAGCGCGGCTCCTCTGTGCCTGACGGCTGGTTCATGCTGTGGGGACACTTGTAGTGAGGGAGGGGCCAGGCTGGATGGGGAGGAGCTTCCTTTTGCTGAACCCCTTTTGCCCCCCGATGCAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGGTGAGTTTTGCCATCGGCCACCTGTGGGGGTGCCATGATTGCACCCAACCCCCGTCACTGGGCAAGGACTGGTCATGTGACTATGCTTCTTATATCTGGCGGGGGGAAAAGAAATTATCCCATGTTCATCCNAGCGCGGCCCCCCCTGTGCTCAAAANNTGGTTCATGCANTGG
  5   1   1         - Tbd0 5x                            IMAGE:6976288                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCCCCCCCCGCCCCCCCACCGCGCCCCCCGCCGGCCCCCCCCCCGCCCCCCCCCCCCCCACCCCCCCACCCCGCTGGTCCGGTCCGATTCCGGGAGAGATGTCTGCGAGTAGAGAGTCGACCCACAGAAATGGACCCGAAGCATGGAGCCCGATGGGGTCATTGCAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCCAGAAGCCCCTCATATAATTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGGATTGAAGCCGAACGAGATGTTTGAGTAAGAGGTTTTCAAGGGATCAAAATCTACCAACCTAATTCCAGAAAGCCTTGAGCAGCTAATGCCCCAGGATGGGTTTTTGCCTCCTCCGGCCAACCATGCCCCGGCCGACGTTGCTCCGAGGGTGGACCCAAAGAAGTTTCCATGGCGGGGGACCCCCCATTCCCGGAATTCCCTGGGTTTAAAAAAAGGGAAGGAACCTTGAACCCCCTGGGGAGGGGTTATTTTAGGGGCCAGTTTCCTTACCTTCCAAACCCTTGGGAAACCCCAACAAAGGAATTTGGGAAAAGCCCTGGGCGACCCCAATTTGGGTGGAGGGAACCCCTTGGGACCCAAAGAAACAACCTGGGACCCCATTTCCCCCCCCCCCCGGGCCCCCGCAAAAATCCCCTTTCCCAAAAAAAACGCCCC
  3  -1   1         - Te5       in                        CAAO10258.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCGCGATCTAGAACTAGGCCGGCAGGAGGCTATATAAGGGACGGTCACCGGTCTTGTTAGAAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCCTGGTAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGNAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTAC
  5   1   1         - Gas1 5x                            IMAGE:6988922                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               NNNNNNTTTTNTTTTTTNNNTTTTNGGGGGGGGAAAAAAAGCAGGGCTGGTACCANGGTCCGGAATTTCCGGGATCTGCGAGCTACGAGAGTCGATCCCGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGGATCAAATCTACGACATATTCCAAAAACTGAGCAGTAATGCCCCAGGTGGTTTTTGCATCTCGAGCCAACCAATGCCCTGCCGAACTTTGCCTCCAAGGGTGGACCCAGCTAAGTTTCCAGGGCGGGGGGAACCCCCATTCCCCGGGAAATCCTTGTGGTTTAAAAAAAAGGGGAGGGGAAGACCTTGAAACCCCCCTTGGGAAGGGGTGGTTATTTTTAATGGGGAATATTTTTCCTTAGACATTCCTAACCCCCTGTGGTAAATGCCGAAAGAAAGGGAAAATTGTGGGAAACAGTCCTGAGGAACAAACATTCTTGGGTGGGTGGTGTACACCTGTTTACTCTAAAAAAACACATTAGTAATTCCATTTGCTCTGCCCAGGGGGATCCCGTATATCTCCTTTAAATTAAATACCACCCGCCCCCCCCATGAAAAGGGGTGGGAAAATGTGGGGCCTTGGAACCCGTGAAATAAAAGAGATTCCCACCGGCCGCAAAGGTGGAATGTTCCACCGTGGAATTCCATCGCCCCCCCTGGGGCCGCGGGGGTGAGACTTTGGGGTACCCTCTNTATAAGTGGACATAATAATAAAAGATCTCTATATT
  5   1   1   14    - Te5  5g3  in                         CAAO1173.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGCGGAGCCGGCAGGAGGCTATATAAGGGACGGTCACCGGCTTGTTAGAAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACG
  5   1   1         - Gas8      in                          st15o11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTCTGCGAGCTACGAGAGTCGGTGAGTGAGAGGGAGCGGCCTGGAGGCCTGGGGAGCGATACGGGGAGCGATACGGGGAGCGATACGGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCT
  5   1   1         - Gas8      in                         st114c11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACATTGAGTACGTAGTCGCGTGGCGCCAGTGCAGCACTCACTCCGCTCTGTATCCGCAGCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTAAGTGCCCGTAGCCTCTGCCTGATTGGCCTAACCTCCCCGGCTATAGTCCCACCCTCACGGGGCACGTGCTGAGCAACAACATCCTGCCCCGAGGTACCACATTCCCTCTGTCTTGTGGTTTGTACAATGCTGCACTGATTGGAGAACGACTCCCTGTACAGCCAATGAGAGCTCATGCCCTCCCCCTGTCATTTCCTCTCAGCCAATGAGACCTTATGCCCTCCCCCTGGCATCTATTGGCCAATAAGACTGTTCATGGTTGCCCCCAGACTCACTTTCCAATGGGGGCTCAGTGTAGTGATGATATCCCATGCGTGTCATCTGATGCCCACGTCTCTCTCTGCCCTTGGCCTGCGCAGCCTGCGTCCTGCGGGTTGGGTTTGGCTAGAGCAG
  3   1   1         - Neu       in                    TNeu088o07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGCAGGAGGCTATATAAGGGACGGTCACCGGTTTGTTAGAAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACA
  5   1   1         - Neu       in                   TNeu088o07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGCAGGAGGCTATATAAGGGACGGTCACCGGTTTGTTAGAAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGT
  5   1   1         - Tbd0 5g                            IMAGE:6978570                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGGCTATATAAGGGACGGGTCACCGGTTTGTTAGAAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTANATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTTCAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCCATGCCGCCGACGTGCTCGAGGTGACCNAGAAGTCATGCGGGACCCATCGGATCTGGTTAAAAGAGGACTGACCTGAGGGTATAGCN
  5   1   1         - Te5                                  CAAO5227.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGCTATATAAGGGACGGTCACCGGCTTGTTAGAAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCCTGGTAANAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTAC
  5   1   1         - In54 5g                         IMAGE:8947001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTTTTTTTGGGGCGCAAGAAATCTTTTTTTTATTTTCGTCCCGAAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCACGTGAGCGAGAGAGTGAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGCCGTATCTTCATAACACGCGCGGAGGTGGAATGCTGACGAAAGATGCACGCGAAGGAACTCACTTGTCTCCGCCTTGACACGGCGACACTTGACCAGAG
  5   1   1         - In62 5g                         IMAGE:8956322.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGTGATTTTCGGGGTGGGGGCAGGCGCCTTCTTAATTCGTCCCGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCACGTGAGCGAGAGAGTGGAAGCTGGACACATTGTTGTGACTGTACGAGACACTGACATCACGCAGCCGTTATCTCATAAACACGCGCGGATGTGATGCTGACGGAAGATGCACGCAAGGACCTCCTTGTCTCCCTCCTTGCCCGGGCGACATAGTGGTAC
  5   1   1         - Gas1 FL                            IMAGE:6986347                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGGGCATGAGTACCGGGGTCCGGGAATTCCCGGGGATGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGGAGTGGAGCCTGGACCCATGGTGTG
  5   1   1   12    - Gas7 5g3  in                         XZG50914.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACAT
  5   1   1         - 1030 5x                         IMAGE:7094133.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAATTAACTCTAAAAGCGCCCCCGGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCTAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTTTTTTTAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGAGAACCGACGAGATGTGATAGAGGTTCAAGATCAATCTCGACTATTCAGAGCTGACATATGCCAGTGGTTTGTCTCGCACATGCCGCGACTGCTCAGGACAGAGTCTGTGACCCTCGATCCTGTCTACGCCACGGTGACTGCGTGCCTTTTGACTTAGTCATACAACCCATCCTACTTTCTGTCTTGTGA
  5   1   1         - In54                            IMAGE:8840998.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGAGGTTAAATGGGGGAGGAAAATACGTATTCGAATTCGTCCCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGTATTAGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACCCATTGTGTGACCTGTACGAGACGCCTGACATCACGCAGTCGTATCTTCATAAACACGCCGCCGGAAGTGAATGCTGACGAAAGATGCCACGCGAGGAACTCACTGTCTCGGTCTGGCACTGGCGACATGAACTAGATGGAGAAGAGACCGTCT
  5   1   1         - In54 5g                         IMAGE:8945071.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGGGAAGCTATGGGGGATGTTCAGGTCATTTAGTATTCGTCCCCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTTAAAGGAGGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCAACGTGGAGCGAGAAGGAGTGAAGCTGGACACATTGTGTGAACTGTTACGAAACACCTGAACATCACGCAGCCGTATCTTCATAACCCCGCCGCCCGGAAGTTGATTGCTGACGAATAGATGCACGCGAGGGACTTCCACTTGTCCTCCGGCCCTGACCACGTCG
  5   1   1         - In63 5g                         IMAGE:8961600.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTATTTTATTAAAGGATTAAAAGTGATTTAGAATTCGTCCCCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACATCACGCAGCCGTAATCTTCATAAACACGCGCGAGTTGATTGCTGACGAAAAGATGCACGCGAGGAACTCACTGTCTCGCCCTTGCCACGGCAACTGCAACCCAGAAAGGAAAAAGAAACG
  5   1   1   14    - Te4  5g3  in                         CAAN8688.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGGCTTGTTAGAAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCCTGGT
  5   1   1         - Tbd0 5g                            IMAGE:6980506                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           NGTACAGCTGGTCGGGCCGGATTCCCGGGATCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCCGCGACGTGCTCGAGGTGACCNAGAAAGTCATGCGGGGACCCATCCGGGATCTGGNTNANANNGANGAGCTGACCCTGGNAGGGTATAGGCAGTCTACATCACGTGGACGAGAGGATGGAGCTGACCCATGTGTGACTGTAGAGACCTGACATCAGCAGCGTATCTCTAAACGCGC
  3  -1   1         - Thy1      out                       CBST1059.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGCGATCTAGAACTAGTGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAANAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGAC
  5   1   1         - Gas7                                 XZG17883.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCCGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAG
  5   1   1   12    - Tad5 5g3  in                         XZT29574.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGA
  5   1   1         - 1030 5g                         IMAGE:7028397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGGCACCATGCCCGCCGACGTGCTCGAGGTGACCAAAAGTTCATGCCGGACCCCCATCCG
  5   1   1         - 1030 5g                         IMAGE:7028798.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAACAGGCGTTACCTGTCCCCTAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCCAGAAGCTGAGCAGTAATGCCCAGGTGGGTTTTGCTCTCGGCCACCATGCCCGCCCGACGTGCTCGAGGTGAACCAAGAAGTTCATGCGGGGACCCCATTCCG
  5   1   1         - 1030 5g                         IMAGE:7027699.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTTCAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAAGTGACCAAGAAGTTCATGCCGGGACCCCATCCG
  5   1   1         - 1030 5g                         IMAGE:7029673.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAAAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCG
  5   1   1         - 1030 5g                         IMAGE:7027257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAACTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGACGTTCGGGTTGGATGAACCCGACTAGATGTTTGATAGAGGTTTCAAGGATCAATTCTCCCACATTTCCCCAAAGCTGACCACTATAGCCCCAGGTGGTTTTTGGCTCTCCGGGCAACCATGCCCCGCCCAAACTTGCTTCGAAGGTGGACCCAAAAAAGTTTCATGCGGGGGAACCCCCATTCTTGTGATCCCCGGGTGTTTAATAAGGGGCGGAAACCCTCTCGCCCTCCCGGTAGGGGTTTATTTAAGGGGCAAGTTTCTATAATCTTCCACCTTTTTGGAAAATTGTAACGCGGGTAGCTGGGAAAAACGCCT
  5   1   1         - 1030 5g                         IMAGE:7094193.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTAGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGGTTTGC
  5   1   1         - 1030 5g                         IMAGE:7093553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAATACATAAAGATGTTCGTGTTGGATGAGCCGACGAGATGTGAGTAAGGTTTCAGGATCAATCTACGACTATTCAGAACTGACAGTATGCCAGGTGTTTGCTCTCGCACATGCCGCGACTGCTCAGGACAGAGTCTGCGGACCCTCNNGATCTGTAAGAGACTGACTGAGATAGCATTATACTGACGAGATGACGACTGTGCGCAACTCTCCGCTATTACGCGAGGTGAGAACAGTCTCCCGCGCAGA
  5   1   1         - 1030 5g                         IMAGE:7093323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTGAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTTCAGGGATCAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGN
  5   1   1       chi 1030                            IMAGE:7027370.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAATCCACACAGGCCCTGGTGTTGGTGCCAACCCGTGAGCTGGCCTAGCACATCCATAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCCTGCGACGCCTGCATTGGGGGCCCCTACGTAACGGGTGAATTACACAACCTGCTCGTCACAAACCCCCTATATAGTTTGCGGGCCCCCCCGGGAGTATTGGTCCATATGCTTTAACTGGCCGTTACCCGTCCCCCCAAACTTTTTCAAGAAGTTTCCTGGTTGGAATGAAACCCCAACGAACTGTGTGGAGTACACAGTTTTCTTTGGAATCCCAATCTTACCCAAGTGTTTTCCCATGAAAACCCTGATCAGGCCACACCGCCTTTGTAGGGCTTGTGGGCTTCTTTAGGACCACCCCTTGATTCGGTTTTTACCCTTGTGTTTCATAACGTGGGTTATTATACAACTGTTTTTTCGCGGAGAAACCACCCCACTAAACCGTTTTCCGTGCTCAGGTTTTCTTAAAAGGGGGGTTTCCTCCGTTTGTGTTGGTTGCCACACCCCTCGGCTCCGTTTTGCCCCAACCCCCCCCCG
  5   1   1         - 1030 5g                         IMAGE:7093810.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACATGCCCGCCGACTGCTCGAGGTGACCAGAAGTCATGCGGGACCCATC
  5   1   1         - 1030 5g                         IMAGE:7027083.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCCAGGTGGTTTTTGCTCTCGGCCACCATGGCCCGCCGACGTGCTTCGAAGGTGACCAAAAAAGTTTCATGGCGGGGACCCCCATCCGGGGATCCCACTAGNTTCTTAGAGCCGGGCCGGCCCCCCCGGCGGTGGGAAGCTTTTGGCCCGTTGGGCCCC
  5   1   1         - 1030 5g                         IMAGE:7094601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTANTACATAAAAAGTTCGTGTTGGATGAGCCGACGAGAGTTGAGTGAGGTTTCAGGATCGATCTCGACTATTCAGAGCTGAGCATATGCCCAGTGTTTGCTCTCGCACTGCCGCGACTGCTCAGTGACAGAGTCTGGGACCCTCGATCTGTAAGAGACTGACTGAGTTAGCATTACCCTGACGAGATGACGACTGGGCTCAACGCTCCGCTATAACCCGAGGTGAGAACCGTCTCCGGAG
  5   1   1         - 1030 5g                         IMAGE:7028079.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCCTGGAGGGGTATTAGGCAGTTCTACCTCAACTTGGAANCGAAGAGGAGTGGAAACTGGGACACATTGTGTTGACCTGTACGAAGAA
  5   1   1         - 1030 5g                         IMAGE:7026661.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACAAAGAGTTCATGCGGGACCCCCTCCG
  5   1   1         - 1030 5g                         IMAGE:7091323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTATGGCCAGGTGTTTTTGTCTCGGCCACATGCCCGCCGACGTGCTCGAGGTGACA
  5   1   1         - 1030 5g                         IMAGE:7091443.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTNCAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGG
  5   1   1         - 1030 5g                         IMAGE:7092234.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCCAGTGGGTTTGCTCTCGGN
  5   1   1         - Gas  5g                        TGas062d01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGGCCCGGGGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCC
  5   1   1         - Tbd0 5g                            IMAGE:6980485                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAATTCCGGGATGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGNNGTTAAAGGAGGAGCTGACCCTGGAGGGGTATAGCAGTCTACATCACGTGGACGAGAGAGTGGAGCTGACCATGTGGACTGTACAACCTGACATCCCA
  5   1   1   12    - Gas7 5g3  in                         XZG34633.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCACGCGTCCGGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGNAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACA
  5   1   1   12    - Gas7 5g3  in                         XZG52212.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATTCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCT
  5   1   1         - 1030 5g                         IMAGE:7091503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTNCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTCAAGGATCAATCTACGACATATTCANAAGCTGAGCAGTATTGCCCAGTGGTTTTGCN
  5   1   1         - 1030 5g                         IMAGE:7026868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGGTTTTGCTCTCGGCCACCATGCCCCGCCGACGTGCTCGAGGTGACCAAAAAGTTCATGCGGGGAACCCATCCG
  5   1   1       chi 1030                            IMAGE:7093229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCTTCCGCTCATAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCATAGTCTCTGCTTATGGGTATTTACACCTATGGCTTTGAGAAACCCTCTTCCATCCGGGGGGGAGCTATTATGCCTTGTATAGAGGGGGATGATGTCATTGCTCGCGCTCATTCTGTTTCTGGGGGGGGGGTACAGGGGGATTTTCCTTTTTTTACTCTATCTAACTGGTATATGAAAGCCACTCTTGCCCTGGTGTTGTATTCACTCCGTGAGCTGGTTCAGTACATCCCTATTTTTCTTTGGGCCCGTAGTATCTTCATGTTTTCCTCTTGAGTCTTCTTCTTTGTTGGCATCTACTTCCTGTTCTTTTTTTTTTTATTTTGTCTTATCTTACTGATTTATTTTTTGATTTATCCTCTGGTTTATTGGTCTTACACTTCTTTTTGTGTTATCTGTTTTTATTAGTTTATTTTTTGGTACATTCCCTCTCGTTTATTTAATATTCACATTTTTATTAATCTTTATTT
  5   1   1         - 1030 5g                         IMAGE:7094571.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTNCGCCA
  5   1   1       chi 1030                            IMAGE:7028917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCACAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCACGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACACATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCTCACCACATCCAGATAGTAGTTATGGCCCTCGGAGATTACACGGGTGCCTCTTGCCCCGTCTGCACTGGTGGCCCTAACGTACTGGCCCGAATATAGAAGCTGCAGTCATACGCCCCTCATATGGTTGTGGGCACCCCCGGCAAAATGTTCTACTTGCTAAACAGGCGTTAACTGCCTCCTCAATCTTCTAATACGTTTTTGTCTTCATGAAGTCTTACTATCACTTCGTTCATTAGGCTTTTTCTGCATCAAGTTCTACCTATCTTTTCCCCTTTATTTCTCACCCACTAATTGTTCTTTGTTGGCCTTAGGCTTTTTCGGCCACCCATTGTCCTCGTTCGCATATTGCTTCTCAGGGGGCGGCCAAGTAAATTTTCTTTCCGGGGCCCTCTTGTTCCCCGAATTTATGGGTTTAATACCGGTAGGGAGCTGTAACCCCCTATCCCGTTTTATTTAGGGGCTGTTCTCTTACCATG
  5   1   1         - 1030 5g                         IMAGE:7091206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCGAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTGGGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACGTAAAGATGTTCGTGTTGGATGAAGCGGACGAGATGTTGAGTAGAGGGTTCAAGGATCAAATCTACGACTTATTCCCGAAACTGAACAGTAATGCT
  5   1   1         - 1030 5g                         IMAGE:7029418.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGGCCCAGGTGGTTTTGCTCTCGGCCACCATGGCCCGCCGAACGTGCTCGANGGTGACCAAAGAAGTTCATGCGGGACCCCCATCCGGGATCCCTGGGTTAAAAAAAGGAGGAGNTTGACCCCCTGGGAGGGGGTATTANGGCAGTTTCTACCATCAACGTGGNAAG
  5   1   1   22    - Gas7 5g                              XZG10631.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCGTGGGCGGACGCGTGGGCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCTCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGGTATAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCCGTAATCTTCATAAA
  5   1   1         - 1030 5g                         IMAGE:7027113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTTCCGCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACCAGATGTTGAGTATAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGGTTTTGCTCTCGGGCACCCATGCCCCGCCGGACGNTGCTCGAAGGTGACCAAAGAAGTTCCATGCCGGGAACCCCCCTCCGGAATCCCTGGGTTAAAAAGGGAGGAACCTGGACCCTGGGGAGGGGTAATTAGTGCCGTTTCTTTAAATCCAACGGTGGGGAACCGGAGA
  5   1   1         - Neu  5g                        TNeu025p04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAATCCCCGGGGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCTGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAG
  5   1   1         - Gas1                               IMAGE:6988063                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAATTTTCCCTGGGGATCTAGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCCCATGCCGCCGACGTGCTCAAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAAGGACTGACCCTGGAGGGATTAGGAGTTCTCACTCAACGGGAGCAGAGGATTGAAGCGGGCCCTTGTTTGACT
  5   1   1         - TpA  5g                        TTpA044i07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCGGGGAAGAATGTCTGCNGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAACACGCGCCGGAAGGTGGATTGGCTGAC
  5   1   1         - In63                            IMAGE:8960177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTTCCTTATTTTGACGATATTAAATAAAAAAATAAAATCCGAGACATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCAACGTGAGCGAGAGGAGTGAAGCTGGACACCATTGTGTGACCTGTACGAGACACTGACCATCACGCCAGCCGTATCTCATAAAACCCGCGCCGAGGTGATGCTGACGGAAAGATGCACGCGAGGGACCTTCACTGTTCTTCCGCCCTGCCGC
  5   1   1         - Gas  5g3  in                   TGas118j04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGCCCCGGGGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCC
  5   1   1         - TpA                            TTpA008i23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCCGCAGCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTAAGTGCCCGTAGCCTCTGCCTGATTGGCCTAACCTCCCCGGCTATAGTCCCACCCTCACGGGGCACGTGCTGAGCAACAACATCCTGCCCCGAGGTACCACATTCCCTCTGTCTTGTGGTTTGTACAATGCTGCACTGATTGGAGAACGACTCCCTGTACAGCCAATGAGAGCTCATGCCCTCCCCCTGTCATTTCCTCTCAGCCAATGAGACCTTATGCCCTCCCCCTGGCATCTATTGGCCAATAAGACTGTTCATGGTTGCCCCCAGACTCACTTTCCAATGGGGGCTCAGTGTAGTGATGATATCCCATGCGTGTCATCTGATGCCCACGTCTCTCTCTGCCCTTGGCCTGCGCAGCCTGCGTCCTGCGGGTTGGGTTTGGCTAGAGCAGAGGAGTCTGGGAAATGATCTGACTGTCTATCTGAATACTTGCCCCCCTTGGAACATGAAGAGGCAATTGGCTTGGTGCTGGGCAGTTAGTGGCTGCAGATTAACAGCGTCTTCTCCCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGTAGGTGCCTTCCTCTGGGTTCCATTGGCCCTGGGGGGTGGAGCAGTCGTTGGGATTGCACCATTACCCCCTCATAGGGGAAAGCCA
  5   1   1         - Egg  5g                        TEgg133f03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCGGGAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGAT
  5   1   1         - Tbd0 5g3  in                     NISC_nl13c11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTG
  5   1   1   24    - Gas6 5g                              ANBT1547.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAANAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATNCACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCAT
  5   1   1         - Tad5      in                         XZT46644.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACGCGTGGGCGGACGCGTGGGCGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATC
  5   1   1         - 1030 5g                         IMAGE:7094795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAACCGACGAGATGTGATAGAGGTTTCAGGATCAATCTCGACTATTCAGAACTGAGCATATGCCAGGTGTTTGCTCTCGCACATGCCGCGACTGCTCAGTGACAGAGTCTGCGGACCATCNGATCCTATCTAACGCGCACCGTGACTGCGTGCACTGTATGCCTAATGTCATACAACTCATTCATAGCTTTCGTCATGTGCACCAGCTGTGTGAACGCCGCT
  5   1   1         - Tbd0 5g3  in                     NISC_nl20a06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCTCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTG
  5   1   1         - Gas1 5g3  in                     NISC_mq03b12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCT
  5   1   1         - Tbd0 5g3  in                     NISC_nl03f01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGT
  5   1   1   22    - Tad5 5g                              XZT27685.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGAC
  5   1   1   22    - Tad5 5g                              XZT45508.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACA
  5   1   1   22    - Tad5 5g                              XZT53989.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGC
  5   1   1         - In60                            IMAGE:8950242.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAGTTTATAACAATGCTCTTTTTCCGATTTTTTATTCGTCCGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTTAAAAAGAGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCACGTGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACATCACGCAGCCGTAATCTTCATAAACACGCGCTGAGTGGATGACTGACGGAAAAGAATGCACTGCAAGGGACTCACTGTCTTCGCCCTGCACAGCACTGGAACCGAGGAAAGAGACGTCCATATGAAGGAAGTCCGAATACTGGATTACG
  5   1   1   10    - Te1  5g3  in                        CBWN14302.b1 ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGA
  5   1   1         - Neu  5g                        TNeu144h19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGATCTACGAGAGTCGACCCATAGTACAATGGCGCCCGAATGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAATTCGTTGATAGTTTTGATGACATGATCCTATCATATTCTCTGCTTATGGGTATTTACGCCTATGGCTTTGAGAAACCCTCATCCATCCATCATCGAGCTATTATGCGGTGTGTCAAAGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAATCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCATCATATCCATAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACATAATCTGCAGTCAGAATCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAATATGTTCGTGTTGGATGAATCCGACGATATGTTGAGTAGATGTTTCAAGGATCAAATCTACGACATATT
  5   1   1         - Tbd0 5g3  in                     NISC_nl15e04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCG
  3   1   1         - Gas6      in                         ANBT2686.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTG
  5   1   1         - Gas6      in                         ANBT2686.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTG
  5   1   1   22    - Tad5 5g                              XZT64638.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCANGCCGTAATCTTCATAAACACGCGCC
  5   1   1   20    - Eye  5g                              CCAX3803.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTG
  5   1   1         - Neu  5g3  in                   TNeu106i01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCGCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATA
  5   1   1         - Tad0 5g                            IMAGE:6983619                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAGATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCCTCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACTGGAGCGAGAGGAGTGGAAGCGGGACCTTTGGTGA
  5   1   1         - Gas1 5g                            IMAGE:6988466                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAATGTCTGCGAGCTACTTGCGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAACGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAAGACACTGGACCATTCACGCAGGCCGGTAATCTTTCATAAAACACGGCG
  5   1   1         - AbdN 5g                            IMAGE:7004359                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCAGGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACNTGGAACGAGAGGAGTGGAAACTGAACACATTGTGTGACCTGTACGAGACGCTTGAACATCACGCAGGCCGTAATCTTCATAACCACNCCCCCGGAAGGTGGGATGGCCTGACGGAAAAAGAG
  5   1   1         - AbdN 5g                            IMAGE:7022285                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCAGGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAANCGAGAAGGAGTGGAAAGCTGGACACATTGTGNTGACCTGNTACGAGACGCTGACCATTCACGCAGGCCGGTAATC
  5   1   1         - AbdN 5g                            IMAGE:7023567                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACNTGGAACCNAGAGGAGTGGAAGCTGGACACCTTTGTGTGAACCTGTACCAAAACGCTTGACCATCACGCCAGGGCCGTAAATCTTTCATTAAACACCGCGGCCGCGA
  5   1   1         - Gas1 5g3  in                     NISC_mq20e03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGTGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCT
  5   1   1         - Neu0 5g3  in                     NISC_ng03e05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATG
  5   1   1         - Neu0 5g                          NISC_ng04g11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTT
  5   1   1         - Neu0 5g3  in                     NISC_ng05c02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAG
  5   1   1         - Tbd0 5g3  in                     NISC_nl04d04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGC
  5   1   1   24    - Neu5 5g   ?                           ANHP916.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCC
  5   1   1   12    - Gas7 5g3  in                         XZG18166.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGT
  5   1   1         - Gas7 5g3  in                         XZG27927.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCCCCGTTTCGGTAGG
  5   1   1   22    - Gas7 5g                              XZG35891.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGNTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATNCA
  5   1   1   12    - Gas7 5g3  in                         XZG54649.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATNCACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAA
  5   1   1   12    - Tad5 5g3  in                         XZT23863.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTANAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGC
  5   1   1   22    - Tad5 5g                              XZT26255.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACA
  5   1   1   12    - Tad5 5g3  in                         XZT45455.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCANGCCGTAATCTTCATAAACA
  5   1   1   12    - Tad5 5g3  in                         XZT56094.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGAACATCACGCAGGCCGTAATCTTCATAAACACG
  5   1   1   12    - Tad5 5g3  in                         XZT69087.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCCATCACGCAGGCCGTAATCTTCA
  5   1   1   22    - Tad5 5g                              XZT71105.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACC
  5   1   1   10    - Spl2 5g3  in                        CBSS8914.fwd ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTC
  5   1   1   10    - Tbd1 5g3  in                        CBXT19047.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACAAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGC
  5   1   1   10    - Tbd1 5g3  in                        CBXT21078.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGA
  5   1   1   10    - Tbd1 5g3  in                        CBXT22919.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACAAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAG
  5   1   1   10    - Eye  5g3  in                         CCAX1501.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACA
  5   1   1         - Egg  5g                        TEgg121p09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCAGAAGGCATGGAGCCCGATGGGGTCATGTGAGAGCAATTGGAATGAAGTCGTTGATAGTTCTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACGGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAACTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAG
  5   1   1         - Gas  5g                        TGas129d21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGGGGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAAGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAAGCGTTACCTGTCCCCTAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGT
  5   1   1         - Neu  5g3  in                   TNeu058j18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGT
  5   1   1         - Neu  5g3  in                   TNeu114h14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAAGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGAGCCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCATCAGCGAGCTATTATGGCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGC
  5   1   1         - Neu  5g3  in                   TNeu118n11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGT
  5   1   1         - TpA  5g3  in                   TTpA009c17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACTGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACG
  5   1   1         - Tbd0 5g                            IMAGE:6977009                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGGGATCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGCTGAGTACAGGTTTCAAGGATCCAATCTCCCACCTCTTCCAGATGCTGAGCATTAATGCCCAGCTGGTTTTGCTATCAGCCACAGGCCCGATGATGCGCGTCAGGGACTCCCCACTGCTGGCGGCCCGCTTCGTAGCGCCCTCACATGACCGATGCCTCGCGGTGCCTCGCTCACCCCCTCGAGCCCCCG
  5   1   1         - Tbd0 5g3  in                       IMAGE:6977944                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAAGTGACAAAGAAGTTCATGCGGGGACCCCATCGGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGGTCTACATCCACNTGGACCCAGAGGATGGAAACTTGGACACTTTGTGTGACCTGTACAAGACCTGGACATCACGCAGGGCGGTAATCCTTCATAACACCCCCCGGAAAGGGGGA
  5   1   1         - Gas1 5g                            IMAGE:6987229                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAAGGTATTANGCAGTTCTACATTCACGTGGAGCGAGAGGAGTGGAAGCTGGGAACATTGTG
  5   1   1         - Neu0 5g                            IMAGE:6993131                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACNTGGAACGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCCATCACGCAGCCGTAATCTTCATAAACACNCNCCGGAAAGGTGGATTTGGCTGACGAAAAGATGCACGCCGAGGGACTTCACTGTTTCCGCCCCTGCAGGGCGACATGGACCA
  5   1   1       chi AbdN 5x                            IMAGE:7004895                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTTCAACAGATAGAACTGGGATATTGAAAAGCCACCCAGGCCCCTGGGTTGTTTGGGCAACCAAACCCCCCGTGGAAGCCTGGGCCCCCAGCCAGGAATTCCCCGGAAAAAGGTTAAGGTTTTATTGGGGGCCCCCCCTCCGGGGAAGAAAAATTTTAACCAATGGGGGGGGGGTGGGGCCCCCCTCTCCTTTTGGGGCCCCCCAACCCGCCGCCCCCCATTGGGACCAAATATTTTTTTTTTTGAAGAGGGGGNTGGGGCCCCGAAAAACAACCCTCCCCCAAAAAGAAAAAAACCCGGTTGTTATTTAATAAAAAAGGGGGGGGGGGGGGGGGGCCCCCCCCCCCCCCAAAAAAAAAAGATTGTTTTCTCTACCCCCCCCGGAAAAAAAAAAAANCCCCCCACTTTTTTGTTGCCCCCAAAAAATTCTTTTCCCCCCCTAAGAAAAAAGAAAAAAGACCCCCCCCCCCCCCCCCTTTTGAAAAGAAAAAAATAAAATAAATAAATTTTTTTTCTTTGTGTGATGGGGGGGGGGCCCCCCCCCCCCCCCCCCCCCCCCGGGGGGGAAAAAAAAAAAAAAAAGTGTGTTTTTTCTCCCCGACAACACAATAATTGTTTTTTTTATAAAAAAAAAAACACAGGGGGGGGGGGGGTGTTTTATACCCCCCCTGTGTGTTCCCCTCCCCCCCCCAAAAAAAAAT
  5   1   1         - Neu  5g                        TNeu048o19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATCCCCGGGTGCGAGCTACGAGAGTCGACCCANAGACAATGGACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATT
  5   1   1         - TpA  5x3  out                  TTpA050a15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAACACGCGCCGGAAGGTGGATTGGCTGA
  5   1   1         - TpA  5g3  in                   TTpA072g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATA
  5   1   1         - TbA  5g                        TTbA001j14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATNCACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACG
  5   1   1         - TbA  5g3  in                   TTbA004d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGATCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACG
  5   1   1         - TbA  5g3  in                   TTbA011p22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTA
  5   1   1         - HdA  5g3  in                  THdA009i02.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCA
  5   1   1   22    - Gas7 5g                              XZG56279.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTTGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACA
  5   1   1   22    - Tad5 5g                              XZT18285.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGG
  5   1   1   22    - Tad5 5g                               XZT7374.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGCGTGGGTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCANGCCGTAATCTTCATAAACACGCGCCGG
  5   1   1   10    - Tail 5g3  in                         CBSW4113.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAA
  5   1   1         - Egg  5g                        TEgg079g05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGAC
  5   1   1         - Gas  5g                       TGas083c07.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTA
  5   1   1         - Gas  FL   in                   TGas116f12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAATACATAAAGATGTTCGTGTTGGATGA
  5   1   1         - Neu  5g                        TNeu063p05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGAATGTCTGCGAGCTACGAGAGTCGACCCAGATACTTTGGACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGA
  5   1   1         - Neu  5g                        TNeu101b21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGAATGTCTGCGAGCTACGAGAGTCGACCCGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTC
  5   1   1         - Tbd0 5g3  in                     NISC_nl21a03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGC
  5   1   1         - TpA  5g3  in                   TTpA020h18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCATGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTG
  5   1   1         - TbA  5g                        TTbA037l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAACGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCATCATATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCGTCATATAGTTGTGGGCACCCCCGTGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCT
  5   1   1         - TbA  5g3  in                   TTbA049k10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGGGGCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACG
  5   1   1   14    - Te4  5g3  in                         CAAN9680.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATNCACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGATCATCACGCAGGCCGTAATCTTTCAT
  5   1   1         - Te5  5g3  in                        CAAO12850.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCAT
  5   1   1         - Te5       in                         CAAO2865.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAA
  5   1   1   12    - Gas7 5g3  in                         XZG24975.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAA
  5   1   1   12    - Gas7 5g3  in                         XZG26747.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGGTAAAAGGAGGAGCTGA
  5   1   1   12    - Gas7 5g3  in                         XZG40499.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTATGCAGTTCTACATCAACGTGGAGCGAGAGGAGT
  5   1   1   22    - Tad5 5g                              XZT58254.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAANAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCAT
  5   1   1         - In54                            IMAGE:8945689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGATTGTTGATCACCGAAAAAATAAGTATAAAGAATTCGTCCCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACAATCACGCAGCCGTATCTCATAAACACGCCGCGAGTGATGCTGACGAAAGATGCACGCGAGGACTCACTGTCTTCCGCCTGCCAGCGACATGACCGAAGAAAGAGACGTCATAGAGGGAGTTCCGATCTGGATTCAGTCCGT
  5   1   1   20    - Tbd1 5g                             CBXT21822.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACAAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACAT
  5   1   1   20    - Eye  5g                              CCAX7422.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGGTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAA
  5   1   1         - Neu  5g                        TNeu055a18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAATGTCTGCGAGCTACGAGAGTCGACCCATATACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGATGTTTCAAGGATCAAATCTACGACAT
  5   1   1         - Gas1 5g                            IMAGE:6987941                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCCGGAAGGTGGATTGGGCTGACGGAAAAAAATGCCACGCGAGGGGACTTCCACTGGTCTCN
  5   1   1         - Neu  5g                        TNeu014d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCNGCCACCATGCCTGCCGACGTGCTCNGAGTGACCAAGAAGTTCATGCG
  3  -1   1         - TbA       in                    TTbA014b12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCTCCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAAGGTGGATTGGCTG
  5   1   1       chi HdA                            THdA049j23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCTACCAGACTGAATACCGGGCATGATTGAACTTCTAGAAGAGGTTGAAGATAAGCAGAAAATCACCGAAGAAATTCCTGAACAAGCTGAAGAAATTGAAGATGAGGAGGAAGAGGAGGAGGAGGAGGAAGAGGAGGAGGATGCGCCTATGGCTTTGAGAAACCCTCAGCCTTCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAGAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCGTTGGGGGCACCAACGTAAGGGCCGAAGTACAGAGGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAATAAGGAGGAGCTGACCCTGGA
  5   1   1   12    - Gas7 5g3  in                         XZG53585.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGAACATCACGCAAGCCGTAATCTTCATAAACA
  5   1   1   10    - Tail 5g3  in                         CBSW7854.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTC
  5   1   1         - Gas1 5g3  in                     NISC_mq04g02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGATCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGGTACCTGT
  5   1   1         - Gas  5g                        TGas001j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGATGTCTGCGAGCTACGAGAGTCGACCCAGAACATGGACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAAGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGA
  5   1   1         - Gas  5g                        TGas049n14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGGGCTGCGAGCTACGAGGGTCGACCCANAACAATGGACCCGAAGGCTGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATT
  5   1   1         - TbA  5x3  out                  TTbA032l17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACG
  5   1   1   10    - Spl2 5g3  in                        CBSS3525.fwd ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACC
  5   1   1         - Gas  5g                        TGas134a08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAAT
  5   1   1         - Neu  5g3  in                   TNeu075h24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGGCTGCGAGCTACGAGAGTCGACCCAGATCAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATT
  5   1   1   12    - Tad5 5g3  in                         XZT57151.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGA
  5   1   1         - Gas8 5g                              st104n19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTGTGAGTATCATGAGCCTGCCTCTGATTGGCTGGGATGTACAGGGCTCCCTCTGCTGGTGGAAGGGAAGGTTGCACTTGG
  5   1   1         - Gas8      in                          st38n02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGA
  5   1   1         - Gas1      in                       IMAGE:6989452                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGCCCTTTTAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGCTTTGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGTTTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAANAGGAGGAGCTGACCCTGNAGGNTATTANGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGAAGCTGGACACATGTGTGACTGTAGAGACATGACATCACCAGCC
  5   1   1         - Neu                            TNeu042a11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCTGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTANGGGTATTTACGCCTATGGCTTT
  5   1   1         - Tad5      ?                           XZT3359.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACTTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAAAC
  5   1   1         - Tad5                                  XZT9830.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGT
  5   1   1         - Egg                            TEgg105k22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGG
  5   1   1         - Gas       in                   TGas053k21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCT
  5   1   1         - Gas                            TGas085k24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGC
  5   1   1         - Tbd0                               IMAGE:6980691                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGTATANGCAGTTCTACATN
  5   1   1       chi Gas1                               IMAGE:6988219                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTTGGATGAAGCCCGACGAAGATGTTGAGTAAAAGGGTTTCAAGGGATCCAATCCTACGAACTTTTTCCCAAAAACCTGAACCAGTAAATGGCCCCGGGGGGGGTTTTGGCTCTTCGGGCCCACCATTGCCCCCGCCCAAAATTGGCCCTCAAGGGGGGACCCCAAAAAAATTTTTCTTGGGGGGGGACCCCCCCCCTCCGGGAAACCGGGGGTTTTAAAAAAGGGGGGGGGACCCTTGAACCCCCGGGGGGGGGGTTTTATTAGGGGGGGGTTTTTTTACCAACCCACACCCTTGTGGAACCCCCGAAGAGGGGGGGGGGAGA
  5   1   1         - Neu0                               IMAGE:6995364                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCCGGAAGGTGNATTTGGCTGACCGNAAAGATGCACGCGAGGGGACTTCACTGGTCTCCGCCCCTGCACGGGCGACATGGACCAGAA
  5   1   1         - Neu0                               IMAGE:6995834                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAANAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCCGTAATCTTCCATAACACGCGCCGGGAAGGTGGGATTGGGCTTGACCGGAAAAAGATGCCACGCCAAGG
  5   1   1         - Gas1                             NISC_mq28d05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCA
  5   1   1         - Neu                            TNeu027k19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGTCTGCGAGCTACGANAGTCGACCCAGAGACATGGACCCGAAGGCTGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCT
  5   1   1         - Gas7                                 XZG25928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCAAGGTGA
  5   1   1         - Gas8      in                          st37n02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGA
  5   1   1         - Gas8      in                          st47m15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTAGGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGAT
  5   1   1         - Gas8                                  st59k14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCG
  5   1   1         - Gas8                                  st63d10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTGTGAGTATCATGAGCCTGCCTCTGATTGGCTGGGATGTACAGGGCTCCCTCTGCTGGTGGAAGGGAAGGTTGCACTTGGGCGGTGGAACATTGAGCCCATTAGTGTGGAATGTTCTCTGTTTGGAATGAGGCTGTTTATGGGCGGTACCAGCACAG
  5   1   1         - Gas8      in                          st83e20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCC
  5   1   1         - Thy1      in                        CBST8848.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTNCAGCACAGTCTGGAACTGGGGAAACTGC
  5   1   1         - HdA       in                   THdA022f24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAAC
  5   1   1         - HdA       in                  THdA025b11.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGGGACCGGGGACCAGGGGGACGCAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGGTAAAAAGGAGGAGCTGACCCTGGAGGGTATTANGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACG
  5   1   1         - Te5       in                         CAAO8760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGC
  5   1   1         - Gas7                                 XZG12254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGG
  5   1   1         - Gas8      in                          st42i18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCTCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGT
  5   1   1         - Spl2                                CBSS3468.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTG
  5   1   1         - Tbd1      in                        CBXT12915.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACA
  5   1   1         - Neu       in                   TNeu053l10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCTTTGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTGTGAGAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAG
  5   1   1         - Gas1                               IMAGE:6987802                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACTTGTACGAGACACG
  5   1   1         - Gas1                               IMAGE:6988496                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATTCACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGGCGTAATCTTCATAAACACGGCGCCGGAGGGTGGATTGGCTGGACGGAAAGATGCACGCGGAGGGACTTTCACTGTTCTCCGCCCCTGCCACGGGGAACTTGGGACCAGAA
  5   1   1         - Gas1      in                       IMAGE:6989360                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCCTGGAGGGTATANNGCAGTCTACATNCACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACATGACATCACGCAGGCGTATCTCATAACACCGCGGAAGTGA
  5   1   1         - Neu0                               IMAGE:6993565                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAAGCCGGTAATCTTCATAAACACGCGCCCGGAAGGGTGGATTGGGCCTGACGGAAA
  5   1   1         - Neu0                               IMAGE:6993932                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAACGAGAGGAGTGGAAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGGCCGTAATCTTCATAAACAACGCGCCCGGAAAAGGGGGGATTGGCCTGGACGGGAA
  5   1   1         - Neu0                               IMAGE:6994185                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAACTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGGTAATCTTTCATAAACACCCCGCCCGGAAAGGTGGGATTGGGCCTGAAGGAAAAAA
  5   1   1       chi Neu0                               IMAGE:6995329                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGGTATTAGGCAGTTTCTACATCAACGTGGGAGCCGAGAGGAGTGGGAAAGCTGGGACACATTGTTGGTGACCCTGGTACGTAGNACAACTGGACCATTCCACGGCAAGGGCCCGGTAAATTCCTTTCATTAAAAACAACGGCCGGCCCGGGAAAAGGGGGTGGGAATATTGGC
  5   1   1       chi Neu0                               IMAGE:6995544                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTTGGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAACCCCTCATATAGTTGTGGGCACCCCCCGGCAGAGTGGTCGAACATGTTAAAAAGGGCGTTAACCTGTCCCCCTAAATACCATAAAAGAAGTTTCCTGGTTGGGAAAGAAACCCCAAACAAAAATGTTTAAGATTAAAAGGTTTTCAAGGGGTTCCAAATTCCTCCCAACATTATTTTCCAAAAAGGCTGTAACCCACTTAATGGGCCCCCGGGGGGGGCTTTTGGGCCTTCTCGGGCCCACACCATGTGCCCCCCCCCAAAAAGGGGGGCTCCCGAAGGTGGGGCCCCCCAAAAAAAATTTTTCCTTGTGCGCGGGGGGAACCCCCCCCCCTCCCGGGGAAAATCCCCCGGGGGGTTAAAAAAAAA
  5   1   1         - Neu0      in                     NISC_ng02a02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATT
  5   1   1         - Neu0      in                     NISC_ng09c05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGC
  5   1   1         - Neu0      in                     NISC_ng18e10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGT
  5   1   1         - Neu0      in                     NISC_ng26b01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGA
  5   1   1         - Tbd0      in                     NISC_nl03h05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGAC
  5   1   1         - Tbd0      in                     NISC_nl08c05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGC
  5   1   1         - Tbd0      in                     NISC_nl23b05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCC
  5   1   1         - TpA       out                  TTpA043d24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCCGGAAGGTGGATTGGGCTGACGGAAAGATGCACGCGA
  5   1   1         - TpA       in                   TTpA052m09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCNAGAAGTTCATGCGGGACCNCATCCGGATCCTG
  5   1   1         - TpA                            TTpA071e17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCT
  5   1   1         - TbA       out                  TTbA007i17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCAAGCCTCAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGGGCCTATCACAGTCTCTGCTTATGGGTATTTACACCTATGGCTTTGAGAAACCCTCAGCCATCCAGCATCGAGCTATTATGCCTTGTATCAGGGGTTATGATGTCATTGCTCAAGCACAATCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAACAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCTCGCCTGCAATTGGGGGCACCAAAGTAAGGGCCGAAGTACAGAAACTGCAGTCAGAAGCCCCTCATATATTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACACGCGTTACCTGTCCCCTAAATACATAGAGATGTGCGTGTTGGATGAAGCCGACGAAATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTC
  5   1   1         - HdA       in                  THdA026b12.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAAAGTGGATTGGCTGACGGANAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCA
  5   1   1         - HdA                            THdA052g18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGC
  5   1   1         - Gas7      in                         XZG19184.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGGTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCCCACCAGATGTTGAGTAGAGGTTTCAA
  5   1   1         - Gas7      in                         XZG40640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTGTGAGTATCATGAGCCTGCCTCTGATTGGCTGGGATGTACAGGGCTCCCTCTGCTGGTGGAAGGGAAGGTTGCACTTGGGCGGTGGAACATTGAGCCCATTAGTGTGGAATGTTCTCTGTTTGGAATGAGGCTGTTTATGGGCGGTACCAGCACAGGCTTGTTGGGTTGGGCCACTAATTGCAGCGTAGTACAGAAGTGCTCAGGGACTTGGATTGTAAGCTCTGTGGGC
  5   1   1         - Gas7                                 XZG41486.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATNCACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAA
  5   1   1         - Gas7      in                         XZG57636.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAAC
  5   1   1         - Tad5      in                         XZT69525.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAATAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAG
  5   1   1         - Spl2      in                        CBSS9767.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCC
  5   1   1         - Panc      in                         CBTA6445.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCT
  5   1   1         - Eye       in                         CCAX6123.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTA
  5   1   1         - Eye       in                         CCAX7696.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGGACCCCATCCGGATCCTGGTTAA
  5   1   1         - Egg                            TEgg116e09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGAC
  5   1   1         - Egg                            TEgg117k14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAAGGTTTCAGGATCAATCTACGACTTTCCAAAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCT
  5   1   1         - Gas                            TGas083e02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGAGCTACTAGAGTCGACCCACAGACAGTGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCATAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCATATCCAGAAAGTAGTTATGGCCCTCGGAGATTACACTGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAATGGCCGAAGTACTGAAGCTGCAGTCAAAAGCCCCTCGTATAGTTGTGGGCACCCCCGGCATAGTGTTCTACATGTTAAACAAGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCTGATCTACGACATATTCCGCAAGCTGAGC
  5   1   1         - Gas                            TGas129m02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGAGCTACGAGAGTCGACCCAGAGACAACGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCA
  5   1   1         - Gas                            TGas129m04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGAGCTACGATAGTCTACCCAGAGACTATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCATAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCATCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCTACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGG
  5   1   1         - Gas1                             NISC_mq09g12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAG
  5   1   1         - Neu0      ?                      NISC_ng19g10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCG
  5   1   1         - Tbd0                             NISC_nl01d01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCTCAGCCATCCAGCAGCGAGCTATTATGCCTT
  5   1   1         - Gas8                                  st36g15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCGAGCTCGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGCCCTTTA
  5   1   1         - In63                            IMAGE:8961272.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCAACGTGAGCGAGAGGAGTGAAGCTGACCATTGTGTGACTGTACGAGAAACTGACATCACGCAGCGTATCTTCATAACACGCGCCGGAGTGATGCTGACGAAAGATGCCGCAGGACTCACTGTCTCCGCCTGCCGGCGACTGACGAAGAAAGAAACGTCATATGAGATCGATCGATCAGTCGGTCGATAACAGATGCTGTCAGCATGAGTCCACAGTCATGCATACTGACCGCCACAGGAATATCAGATGCAGGGCTTCGGAAGGTTCTTACTTTGACAGAGTAGCGCCTAG
  5   1   1         - Eye       in                         CCAX5593.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCA
  5   1   1         - Gas       in                   TGas079d18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCC
  5   1   1         - Tbd0      in                       IMAGE:6977604                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGNCGAGAGGAGTGGAANCTGGACACATTGTGTGACCTGTACGAGACACTGGACATCACGCAAGCCCGTAATCTTCATAAACACGCGGCCCGGAGGGTGGATTTGGCTGGACGGAAAAGATGCACGCCAAGGGAACTTCACTGGTCTCCGCCC
  5   1   1         - Neu0                               IMAGE:6993351                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACNTGGAACGAGAGGAGTGGAAACTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAAGCCGTAATCTTCATAAACACGCCCCCGGAAAGGGTGGAATTGGCTGGACGGAAAAAAATGCACGGCGAGGGGACTTTCACTGTTCTTCCGCCCCTGCAAGGGCGGACCTGGGAACCANAAAAGGGAGAGGAGACCGTCCATTTTATTGAG
  5   1   1         - Gas1      in                     NISC_mq22e05.y2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCA
  5   1   1         - Neu                            TNeu041n07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCGAGCTACGAGAGTCGACCCAGANACATGGACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAAGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCT
  5   1   1         - Gas7      in                         XZG19425.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCT
  5   1   1         - Gas7      in                         XZG34979.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCC
  5   1   1         - Gas7      in                         XZG59873.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCANGCCGTAATCTTCA
  5   1   1         - Gas7      in                         XZG61150.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACA
  5   1   1         - Gas8                                 st100o11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCGAGCTCGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGCCT
  5   1   1         - Thy1      in                        CBST3240.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGC
  5   1   1         - Tbd1      in                        CBXT15785.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACTCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTC
  5   1   1         - Egg       ?                    TEgg007c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAGCTTGGGGAGACCACCCATATACTCTGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCG
  5   1   1         - Neu       out                  TNeu092a02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGATACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGG
  5   1   1         - Neu       in                   TNeu103m17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTA
  5   1   1         - TpA                            TTpA011b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGANAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCA
  5   1   1         - Gas1                               IMAGE:6989190                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGGTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGCACGGCGAATTGGACAAAAGGGAAGAGACTT
  5   1   1         - Neu0      in                       IMAGE:6992089                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTTGGAGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAAGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCCGTATCTTTCATAACACNCGCCCGGAAGGTGGATTGGGCTGAACGGAAAGATGCACGCCGAGGGACTTCACTGTCCTCCGCCCTGCACGGGCGACTTGGGACCAGAAAAGGAGAGAGACGTCCTTTTATGA
  5   1   1         - TbA       out                  TTbA007e11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCA
  5   1   1         - Neu5      in                          ANHP539.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAANAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACA
  5   1   1         - Te5       in                         CAAO1954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCANGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGCCTGACGGAAA
  5   1   1         - Gas7      in                         XZG16626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACCTCCACGTGGAGCGAGAGGAGTGGAAGCTGGA
  5   1   1         - Gas7      in                         XZG54033.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCTACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACG
  5   1   1         - Tad5                                 XZT68140.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAANAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCANGCCGTAATCTTCATAAACA
  5   1   1         - In54                            IMAGE:8943660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCAACGTGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCCCGCAGCGTATCTCATAAACCCCGCGCCGAAGTTGATGCTGACGGAAAGATGCACGCGAGGACTTCACTGTCTCGCCCTGGCATGCAACTGAACGAGGGAAGAGACGTCTCTTTTGAAG
  5   1   1         - Tbd1      in                         CBXT8085.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACAAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACAC
  5   1   1         - Egg                            TEgg080g06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTC
  5   1   1         - Neu       in                   TNeu061d05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGAGCTACGAGAGTCGACCCAGACCAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATCATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGT
  5   1   1         - Neu       in                   TNeu092e02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGAGCTACGAGAGTCGACCCAGATCAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAG
  5   1   1         - In62                            IMAGE:8954574.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGATGTTCGACCCAGAGACAATTGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAAGAGCAATTGGAATTGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCATCCGGATCCTGATAAAAGGAGAGCTGACCCTGAGGTATAGCAGTCTACATCACGTGAGCGAGAGGAGTGAGCTGACACATTGTGTGACTGTACGAAACACTGACATCACGCAGCGTAATCTTCT
  5   1   1         - Limb      ?                         CBSU6818.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGCTACGAGAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAA
  5   1   1         - Gas1      in                     NISC_mq11h08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCA
  5   1   1         - Neu                            TNeu049n23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAGCTACGAGAGTCGACCCAGAGACATGGACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTC
  5   1   1         - HdA       in                   THdA042k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAAAGTGGATTGGCTGA
  5   1   1         - In62                            IMAGE:8955436.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCACGTGAGCGAGAGGAGTGAAGCTGGAACCATTGTGTGACTGTACGAGACACTGACATCCCGCAGCCGTAATCTCATAACCCGCGCCGGAGTGATGCTGACGAAAAATGCACGCAGGACTCACTGTCTCGGCCTGCCGCGCACTGACAGAAGAAAAGAGCTCTTAGAGGATCCGATCGATCCAGTCGGTCCGATACACGATGCTGCCAGCCTGATTCCGAAGTCTCATGCTATATGATCCGCCCAAGAACCTTCCAGATTGCAAGGCCCTCCAGGAGAGTGCCTACTGCAAGATAACAGCCCTTGTAGAC
  5   1   1         - Gas       in                   TGas103e16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCTACGAGAGTCGACCCGAGACATGGACCCGAAGGCGTGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATG
  5   1   1         - Neu       in                   TNeu101c02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGCTACGAGAGTCGACCCGAGACATGGACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGT
  5   1   1         - Gas                            TGas008g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGCTACGAGNATCGACCCANAACATGGACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTC
  5   1   1         - In66                            IMAGE:8965894.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCACGTGAGCGAGAGAGTGAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACATCACGCAGTCGTATCTTCATAACACGCGCCGAGTTGATGCTGACGAAAGATGCACGCGAGACTTCACTGTCTCGCTGGACTGCGACTGACAGAAGGAGAGAACGTTCATTATGAGGAGTTCCGAATCGTGGAATATCAG
  5   1   1         - Gas1      in                     NISC_mq02c08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATCGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCA
  5   1   1         - Gas       in                   TGas065n11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACGAGAGTCGACCCAGATACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAAGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCATGTGCTGAGCAGTAATG
  5   1   1         - Neu                            TNeu003c19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCTACGAGAGTCGACCCANAACATGGACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCCAGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCT
  5   1   1         - Tbd1      in                         CBXT9947.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGG
  5   1   1         - TpA                            TTpA004i18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGANAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGACCAGAAAGAGAGAGACGTCATTATGAGGGAGTTCCGATCTGGATCCAGTCGGGTTCTGATTACACAGATTTGCTGGCCCGAGGCATTGATGTC
  5   1   1         - TpA       in                  TTpA022b22.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACA
  5   1   1         - Neu                            TNeu039h19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTACGAGAGTCGACCCANANACATGGACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCT
  5   1   1         - Te5       in                        CAAO10613.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCC
  5   1   1         - Gas8                                  st16c19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGTTCGTGGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTAAGTGCCCGCAGCCTCTGCCTGATTGGCCTAACCTCCCCGGCTATAGTCCCACCCTCACGGGGCACGTGCTGAGCAACAACATCCTGCCCCGAGGTACCACATTCCCTCTGTCTTGTGGTTTGTACAATGCTGCACTGATTGGAGAACGACTCCCTGTACAGCCAATGAGAGCTCATGCCCTCCCCCTGTCATTTCCTCTCAGCCAATGAGACCTTATGCCCTCCCCCTGGCATCTATTGGCCAATAAGACTGTTCATGGTTGCCCCCAGACTCACTTTCCAATGGGGGCTCAGTGTAGTGATGATATCCCATGCGTGTCATCTGATGCCCACGTCTCTCTCTGCCCTTGGCCTGCGCAGCCTGCGTCCTGCGGGTTGGGTTTGGCTAGAGCAGAGGAGTCTGGGAAATGATCTGACTGTCTATCTGAATACTTGCCCCCCTTGGAACATGAAGAGGCAATTGGCTTGGTGCTGGGCAGTTAGTGGCTGCAGATTAACAGTGTCTTCTCCCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGCCC
  5   1   1         - Tbd0                               IMAGE:6980450                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTNCAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGGTTTGCTCTCGGCCACCATGCCCCGCGACGTGCTCGAGGTGACCAGAAAGTCATGCGGGACCCCCATCNGGATCTGGTAAAAAGGAGAGCTGACCCCTGAGGGTATAGCAGTCTACTCACGTGAACAAGAGATGAACTGACACTGTTGACTGTACAAACTGAC
  5   1   1         - Neu0                               IMAGE:6995479                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAAGGTGGATTTGGCTGACGGAAAAAGATGCACG
  5   1   1         - Gas1      ?                      NISC_mq07f04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTT
  5   1   1         - Tbd0      ?                      NISC_nl18f03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGA
  5   1   1         - Ova1      in                         CABE3249.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCCGGAGGTGGATTGGCTGAC
  5   1   1         - Gas7                                 XZG39013.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTTCATAACACGCGCC
  5   1   1         - Tad5                                 XZT17360.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCTAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAACCTGGACACATTGT
  5   1   1         - In62                            IMAGE:8955299.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTCGACCCATGAGACAATTGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCATCCGGATCCTGGTTAAAAAGGAGAGCTGACCCTGAGGGTATAGCAGTTTACATCACGTGAGCGAGAGGGTGGAAGCTGGACACATTGTGTGACTGTACGAGACCTGACCATCACGCAGCCGTATCTTCTAAACCCGCGTCGAGTGATGCTGACGAAAAATGCACGCGAGGACTCCCTGCTTCGCCTGCCGGCACTGACGAAGAGAGAACTCATTTGAGGATTCGATTGATCATCGTCTGAAACACAAATTGTGCAGACTGAGTCCAAGGTCCATGGCTTACATGATGCCACTGTATATCCAGATGCAGTCTCGGAGAGGTTCCTAATGGCAGAAGCCGTATAAGTCTACGCCTA
  5   1   1         - Eye       in                         CCAX6722.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAG
  5   1   1         - Egg                            TEgg137f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCCAGGTGGTTTTGCTCTCGGCCACATGCCCGCCGAC
  5   1   1         - Eye                                  CCAX3034.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGG
  5   1   1         - TpA                            TTpA069l20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACG
  5   1   1         - TpA                            TTpA069l21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCCGGAAGGTGGATTGGCTGACGGANAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGA
  5   1   1         - Gas8      in                          st67m12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGAT
  5   1   1         - In66                            IMAGE:8963339.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTCCTTTTATAAAAATAGGACCCGAAGGCATGGAGCCCGATAGGGGTCATTGAGAGCAATTGGAATGAAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCAACGTGAGCGAGAAGGAGTGGAAGCTGACACATTGTGTGACCTGTACGAGAACACTGACATCACGCAGCGTATCTTTATAAACACGCGCGAGTGAATGGCTGACGAAAGATGCCAGCGAGACTCACTTCTCGCTGCCCGGTACTGGAACTATGAAAGACGTCTCATATATGGAGGGAGTTGCGA
  5   1   1         - Gas       ?                    TGas141k24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAACAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGAATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCT
  5   1   1         - TpA                            TTpA073i23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATA
  5   1   1         - Gas7                                  XZG8675.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGTCGACCGAGACATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTTATAA
  3  -1   1         - Liv1      in                         CAAR2447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTATAGGGCGAGAGGTGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCANGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGAC
  5   1   1         - Gas8      in                          st66m08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCC
  5   1   1         - Liv1      in                         CAAR2139.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCGAGGAGACATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCC
  5   1   1         - Brn1      in                          CABL741.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGAGGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCANGCCGTAATCTTCATAAACACGCGCC
  5   1   1         - Gas7                                  XZG8818.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCCAGAGACATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGNAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCANGCCGTAATCTTCATAAACA
  5   1   1         - Neu0      in                     NISC_ng08a03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAAT
  5   1   1         - TbA       in                   TTbA003k17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGTCAGCCGTAATCTTCATAAACA
  5   1   1         - Spl1      in                         CABK4845.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAGATGCACGCGAGGGGACTCACTGTCTCCGCCCTGC
  5   1   1         - Tbd1      in                        CBXT13496.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACAAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGT
  5   1   1         - TpA       in                   TTpA036m05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAGAAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGGCTGACGGAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGA
  5   1   1         - TpA                            TTpA074b15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAGACATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAAGGTGGATTGGCTGACGGANAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCG
  5   1   1         - Gas7      in                         XZG52496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAGACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAACCTGGACACATTGTGTGACCTGTACGAGACGCTGACCAT
  3   1   1         - Gas6      in                          ANBT240.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTTAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACG
  5   1   1         - Gas6      in                          ANBT240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTTAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTG
  3   1   1         - Gas6      in                         ANBT2928.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCGGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTTAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTG
  5   1   1         - Gas6      in                         ANBT2928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTTAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTG
  5   1   1         - Tbd1      in                        CBXT20867.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGCCGTAATCTTCATAAACACGCGCCGGAATGTGGATTGGCTGACGGAAAAGATGCA
  5   1   1         - Egg       in                   TEgg009p09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCAGGCCCGCCGACGTGCTCGA
  5   1   1         - Egg       in                   TEgg055h24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAA
  5   1   1         - TbA       in                   TTbA035b20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATGGACCCGAAGGCATGGAGCTCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCTTATCAGAGTCCTTTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACTCTTAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCTCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGG
  5   1   1         - TbA       in                   TTbA039h07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGA
  5   1   1         - Brn4      in                        CAAL20044.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCANGCCGTAATCTTCAT
  5   1   1         - Gas8      in                          st15n12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTG
  5   1   1         - Gas8                                  st34d21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGGACCCGAAGGCATGGAAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGCC
  5   1   1         - Gas8      in                          st37a11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGGACCCGAAGGCATGGAAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATC
  5   1   1         - Gas8      in                          st38o12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGGACCCGAAGGCATGGAAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGAACCCCATCCGGA
  5   1   1         - Te5       in                         CAAO7236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGAC
  5   1   1         - Gas8                                  st43i18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCTCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGAACCCCATCCGGATCCT
  5   1   1         - Gas8                                  st67m08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCANAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCANGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTANTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCNTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGA
  5   1   1         - Gas8      in                          st79l06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAG
  5   1   1         - Lun1      in                         CABD5223.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCG
  5   1   1         - Mus1      in                        CABH10970.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCANGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGG
  5   1   1         - Mus1      in                         CABH9678.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCANGCCGTAATCTTCATAAACACGCGCC
  5   1   1         - Gas7      in                         XZG34906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGT
  5   1   1         - Neu                            TNeu011h03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATG
  5   1   1         - TpA       in                   TTpA074h05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATA
  5   1   1         - Neu       in                   TNeu122n03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATT
  5   1   1         - Gas                            TGas001f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTT
  5   1   1         - Neu                            TNeu041l06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACCCGAAGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATT
  5   1   1         - HdA       in                   THdA050f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAAGGTGGATTGGCTGACNGANAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGA
  5   1   1         - Spl1      in                         CABK5833.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGAC
  5   1   1         - Eye       in                         CCAX5173.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGT
  5   1   1         - Mus1      in                         CABH9039.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCC
  3  -1   1         - Ski1      in                        CABJ10261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGA
  5   1   1         - Gas7                                  XZG8395.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCANGCCGTAATCTTCATAAACACGCGCC
  5   1   1         - In63                            IMAGE:8961128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGCCGTAATCTTCATAAACACGCGCGGAGGGGATTGCTGACGAAAGATGCACGCGAGGACTTCACTGTCTCCGCCTGCACGGCGACTGACAGAGAAAGACGTCATTATGAGGAGTTCGATCTGATCAGTCGGTCGATACACGATGCTGCGAGCATGAGTCACAGTCCTGCCTACTTGATGCGACAGGACATCCAGATGCCAGGCGTCGTGAAGATGCTTACTGGCAGAGTACAGCACGTAAATAGATCTTC
  5   1   1         - In63                            IMAGE:8960944.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCATGGAGCCCGATTGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGAGCGAGAGGAGTGAAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCGTAATCTTCATAAACACGCGTCGGATGTGGATTGCTGACGAAAGGATGCACGCGAGGACTTCACTGTCTCCGCCTGCCTGGCGACTGGACAGAGGAAGAGGACGTCATTATGAGGATCGAATCTGGATCCAGTCGTCGTTACGATGCTGCGTGAGCATGAGTGTCTACTCACGAGCT
  5   1   1         - Mus1      in                          CABH825.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCG
  5   1   1         - In62                            IMAGE:8956076.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTCTACATCAACGTGGAGCGAGAGGAGTGGAGCTGGACCATTGTGTGACCTGTACGAGACACTGACCATCACGCAGCCGTATCTCATAAACACGCCGCGAGGTGATGCTGACGGAAAGATGCCCGCGAGGACTCACTGTCTTCGCCTGCACGGCGACTTGACCAGAGGAAGGACGTCATATGAGGAGTTCGATCTGGAATCAGTCGGATCTGATATACACAGATTGCTGTGCCGAGG
  5   1   1         - In62                            IMAGE:8954578.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAGGCCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGGACACATTGGGGTGACCTGTACGAGACACTGATCATCACGCAGGCCGTATCTTCATAACACGCGCCGGAGGTGGATGACTGACGGAAAAGAATGCACGGCGAGGACTTCACCTGTCTCCGCCCTGCACGGGCGAC
  5   1   1         - Limb                                CBSU1917.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGTCCTGTTTGTATAATGGGCTGTCATCTGCCCCGGCTCCCCCGTAACTTCCTGTAATGCCACTTGGTACATTCCCTTCACTGGGTTTACTAGTCCTATTGATACCCCACTTTGTGTGACTTGGGGTGAGTGATGTCATGTCTGTCACCCCTTTAGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTG
  3   1   1         - Sto1      in                         CABG1549.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTG
  5   1   1         - Sto1      in                         CABG1549.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTG
  5   1   1         - Ovi1      in                         CABI5340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTC
  5   1   1         - Gas8                                 st105n19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGAGCCCGATGGGGTCATTGANAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCANAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCANCCATCCAGCANCGAGCTATTATGCCTTGTATCAANGGTTATGATGTCNTTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACNNGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCC
  5   1   1         - In66                            IMAGE:8962786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATGCCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAGGAGGAGCTGACTCTGAGGGTATTAGCAGTTCTACATCACGTGAGCGAGAGAGTGAGCTGACCATTGTGTGACCTGTACGAGACACTGACATCACGCAGCGTAATCTCTAACACGCGCGAGTGATGGCTGACGAAAGATGCAGCAGACTTCTGGTCGCTGACGGCACTGGACGAAGAAGACGTCATATGAAGGGAGTCCG
  5   1   1         - Lun1      in                         CABD1047.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAGATGCACG
  5   1   1         - Gas8                                 st110a04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGCCCTT
  5   1   1         - Gas8                                  st33i16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTGTGAGTATCATGAGCCTGCCTCTGATTGGCTGGGATGTACAGGGCTCCCTCTGCTGGTGGAAGGGAAGGTTGCACTTGGGCGGTGGAACATTGAGCCCATTAGTGTGGAATGTTCTGTTTGGAATGAGGCTGTTTATGGGCGGTACCAGCACAGGCTTGTTGGGTTGGGCCACTAATTGCAGCGTANTACAGAAGTGCTCAGGGACTTGGATTG
  5   1   1         - Gas8                                  st82m08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGC
  5   1   1         - Liv1      in                         CAAR5115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCAT
  5   1   1         - Fat1      in                         CABC7560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGATGGGGTCATTGAGAGCAATTGGAATGAATTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGACC
  5   1   1         - Lun1      in                         CABD6903.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAANAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACA
  5   1   1         - Lun1      in                         CABD8250.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGA
  5   1   1         - Mus1      in                         CABH2475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCANCGCG
  5   1   1         - Hrt1      in                         CAAQ3774.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACG
  5   1   1         - Spl1      in                         CABK8907.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGACCAGAAGGAGAGAGACG
  5   1   1         - Spl1      in                        CABK10938.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGG
  5   1   1       chi Tad5                                 XZT29934.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGGACTTCACTGT
  5   1   1         - Lun1                                 CABD5891.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGANAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGA
  5   1   1         - Neu                            TNeu014m24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCT
  5   1   1         - Neu                            TNeu102m09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTG
  5   1   1         - Gas7      in                         XZG38096.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCC
  5   1   1         - Eye                                  CCAX2758.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGG
  3   1   1         - Lun1      in                         CABD5216.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTG
  5   1   1         - Lun1      in                         CABD5216.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTG
  5   1   1         - Neu                            TNeu023d19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCC
  5   1   1         - TbA       out                  TTbA033f22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAGTTTTGATGACCTGACCCTATCACAGTCTCTGCTTAGGGGTATTTACGCCTATGGCGTTTGAGAAACCCTCAGGCCTTCTCTCATCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTAGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAACGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCATCAGATCCACAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACACCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCACTCGGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTATAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCANGCCGTAATCTTCATAAACA
  3  -1   1         - Ski1      in                        CABJ10835.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGCCGCCATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCTGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGANAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGACCAGAAGGAGAGAGACGTCATTATGAGGGAGTTCCGATCTGGATCCAGTCGGGTTCTGATTACAC
  5   1   1         - Tbd1      in                         CBXT9764.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGACATGAGCCTATCACACTCTCTGCTTAAGGGTATTTACGCCTATGGCTTTGAGAAACCCTCATCCGTCCAGCACCGAGCTAATATGCCTTGTATCATGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCTCCAGATAGAACTGGATATGAAAGCCACACA
  5   1   1       chi Gas7      in                          XZG3942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGAGCAATTGGAATGAAGTCGTTGATAGTTTTGATGACATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGACCAGAAGGAGAGAGACGTCATTATGAGGGAGTTCCGATCTGGATCCAGTCGGGTTCTGATTACCACAGATTTG
  5   1   1         - Gas7      in                         XZG42102.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGAGCCTATCAGAGTCTCTGCTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCC
  5   1   1         - HdA       in                  THdA009m10.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCTTAGGGGTATTTACGCCTATGGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAAAGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGA
  5   1   1         - Neu0                               IMAGE:6995379                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGAATGTCTGCGAGCTACGAGAGTCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCCGATGGGGTCATTGAGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCNGGAAGGTGNNGATTGGCTGACGGAAAAGATGCACNNGCGAGGGACTTCACTGGGTCTCCGCCCTGCACGGGCGACATNGGACCCAGAAGGGGGAGAGAGACGTCATTTATGAGGGGGAAGTTCCCCGATTTCTGGGAATCCCAGTT
  5   1   1         - Gas7      in                         XZG42346.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTAGGGGTATTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGACCAGAAGGAGAGAGACGTCATTATGAGGGAGTTCCGATCTGGATCCAG
  5   1   1         - In60                            IMAGE:8949261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGCCGTAATCTTCATAAACACGCGCCGGAATGGGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCCCTGTCTCGCCCTGCACGGCGACATGGACCAGAAGGAAAGAGACGTCATTATGAGGGAGTTCGATCTGATTCAGTCGGGTTCTGGATTACCACAGAATTTTGCCTGGCCCGAAGCAC
  5   1   1         - Gas7      in                         XZG48416.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGAAAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGACCAGAAGGAGAGAGACGTCATTATGAGGGAGTTCCGATCTGGATCCAGTCGGGTTCTGATTACCACAGATTTGCTGGCCCCGAGCATTGATGTCCCAGCAGTCTCACTGGTCATTAACTATGATCTGC
  5   1   1         - Bone      in                        CBTC4380.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCCTATGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGC
  5   1   1         - Spl2      in                        CBSS7023.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGCTTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACGCTGACCATCACGCAGGCCGTAATCTTCATAAACACGC
  5   1   1         - Egg                            TEgg112n02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGAGAAACCCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATC
  5   1   1         - Bone      in                         CBTC679.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACTTTGTGTGACTTGGGGTGAGTGATGTCATGTCTGTCACCCCTTTAGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTAGGCAGTTCTACATCAACGTGGAGCGAGAGGAGTGGAAGCTGGACACATTGTGTGACCTGTACGAGACACTGACCATCACGCAGGCCGTAATCTTCATAAACACGCGCCGGAAGGTGGATTGGCTGACGGANAAGATGCACGCGAGGGACTTCACTGTCTCCGCCCTGCACGGCGACATGGACCAGAAGG
  5   1   1         - Gas                            TGas007o16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCTCAGCCATCCAGCAACCAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATACAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCATCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACTCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGT
  5   1   1         - HdA       in                   THdA032k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTCAGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAAGCACAGTCTGGAACTGGGAAAACTGCCACCTTTGCCATTTCCATTCTTCAACAGATAGAACTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTCGGAGATTACATGGGTGCCTCTTGCCACGCCTGCATTGGGGGCACCAACGTAAGGGCCGAAGTACAGAAGCTGCAGTCAGAAGCCCCTCATATAGTTGTGGGCACCCCCGGCAGAGTGTTCGACATGTTAAACAGGCGTTACCTGTCCCCTAAATACATAAAGATGTTCGTGTTGGATGAAGCCGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTACGACATATTCCAGAAGCTGAGCAGTAATGCCCAGGTGGTTTTGCTCTCGGCCACCATGCCCGCCGACGTGCTCGAGGTGACCAAGAAGTTCATGCGGGACCCCATCCGGATCCTGGTTAAAAAGGAGGAGCTGACCCTGGAGGGTATTANGCAGTTCTACCTCAACGTGGAGCGAGAGGAGTGGAAACTGGACACATTGTGTGACCTGTACCAAACACTGACCATCACGCAGGCCGTAATCTTCATAA
  5   1   1         - Gas8                                   st2m05.5p