Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 29 Mar 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012069993 Xt7.1-CABK2025.3 - 933 ESTs
                                                                       ....-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABK2025.3                                                                                                                                                                                                                                                               GTTCCTTCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAATTACCCGCGATTCAAGAATCTGAGAGAAACTTTGATGGTCCAAGGAATGGAGGTTTTGGAGGAAGAGGGAGGAGACCTTTTGATAGAAGAAATAATTCCAGAGGAGGAAGAGGAGGAGGAGGAAGAGGCAGAAATAGAAGTGGAGGGTTTAGAAGGGGCCGTTAGTGACTCCAAACATCCCAACATCCCATGTCACAATAACTTTTTTTAATATACTGCCATGTTCATAAATATTCCTTCCTAAAGTAACTTGAGACATATTTTTATGCAATATAAAACTGTGTGCTTAGCCCTTATTAAAATCTATCTGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221144                                                                                                                                                                                                                                                                     GCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAATTACCCGCGATTCAAGAATCTGAGAGAAACTTTGATGGTCCAAGGAATGGAGGTTTTGGAGGAAGAGGGAGGAGACCTTTTGATAGAAGAAATAATTCCAGAGGAGGAAGAGGAGGAGGAGGAAGAGGCAGAAATAGAAGTGGAGGGTTTAGAAGGGGCCGTTAGTGACTCCAAACATCCCAACATCCCATGTCACAATAACTTTTTTTAATATACTGCCATGTTCATAAATATTCCTTCCTAAAGTAACTTGAGACATATTTTTATGCAATATAAAACTGTGTGCTTAGCCCTTATTAAAATCTATCTGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                    5     9    19    24    35    41    72    90    81   104    95   114   106   134   145   161   151   168   162   180   170   188   172   190   176   190   184   196   190   200   194   201   198   203   199   205   199   205   203   211   204   212   211   219   212   220   215   222   217   226   219   226   221   228   220   228   220   229   224   231   223   230   223   231   224   233   226   235   228   239   233   241   233   241   235   243   237   247   235   247   235   248   236   246   241   251   243   252   246   253   244   253   246   256   250   257   245   258   247   257   247   258   251   258   256   261   256   262   255   261   254   263   258   267   260   267   257   268   261   271   262   270   258   269   252   266   254   267   253   267   248   261   242   256   239   253   235   248   233   247   232   245   223   238   212   228   218   230   214   229   211   229   200   213   195   211   180   196   178   186   158   172   150   156   147   153   143   152   139   149   137   150   133   149   137   150   138   152   143   152   141   152   141   152   142   151   139   151   144   154   145   152   146   154   135   146   137   148   134   150   136   149   131   147   124   137   118   133   117   132   125   138   125   136   120   134   121   135   120   133   116   133   115   131   115   132   119   132   122   135   120   135   122   138   122   138   124   137   125   137   128   139   127   141   125   139   125   137   125   135   127   137   128   136   129   137   128   139   129   138   132   142   136   146   144   154   150   159   148   162   173   188   182   198   193   216   198   221   212   235   214   239   207   238   216   245   245   266   319   339   324   346   334   355   338   361   367   390   388   407   393   412   421   436   436   451   443   458   443   464   444   469   453   467   456   469   459   474   464   478   463   487   471   496   482   499   480   504   482   505   486   504   487   504   486   506   492   507   486   504   497   504   496   506   492   507   494   507   489   500   472   501   488   498   483   496   480   496   479   493   481   493   478   493   472   491   464   490   421   490   460   479   460   472   456   470   459   469   455   469   455   469   453   467   448   467   422   467   421   466   425   467   426   466   421   464   411   465   408   464   402   461   371   460   372   458   364   452   280   443   275   433   210   414   210   403   191   361    43   153    42    55     9    19
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGCAGAAATAGAAGTGGAGGGTTTAGAAGGGGCCGTTAGTGACTCCAAACATCCCAACATCCCATGTCACAATAACTTTTTTTAATATACTGCCA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                               -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----G-----A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------T----
                                               BLH ATG      88     491                                                                                                                                                                                                                                                               
                                               BLH MIN      88     241                                                                                                                                                                                                                                                               
                                               BLH OVR      88      66                                                                                                                                                                                                                                                               
                                               CDS MIN      88      36                                                                                                                                                                                                                                                               
                                               EST CLI      16      36                                                                                                                                                                                                                                                               
                                               ORF LNG      88      15                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Bf ==== 1e-032     AAM18861.1 unknown [Branchiostoma floridae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN --- Cs ---- 7e-051     BAB12216.1 vasa homolog [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 1e-051     BAA36710.1 DEAD-Box Protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 1e-053     NP_001033411.1 F53H1.1 [Caenorhabditis elegans] --------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Sc ---- 7e-056     NP_011437.1 ATP-dependent RNA helicase CA3 of the DEAD/DEAH box family; Dbp3p [Saccharomycescerevisiae] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 1e-055     NP_723899.1 vasa CG3506-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dr ---- 2e-056     NP_001019988.1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Sp ==== 4e-148     XP_786504.2 PREDICTED: similar to DEAD (Asp-Glu-Ala-Asp) box polypeptide 21a [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Gg ---- 0          XP_001232052.1 PREDICTED: similar to Gu protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 0          NP_062426.2 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 [Mus musculus] -----------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 0          NP_004719.2 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 0          AAG22819.2 RNA helicase II/Gu [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === ?? ==== 0          NP_001082035.1 RNA helicase II/Gu [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          CAJ82454.1 novel GUCT (NUC152) domain containing DEAD/DEAH box helicase [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABK2025.3                                                                                                                                                                                                                                                                                     TAA---------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------ATG------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTGA---------------------ATG------TAA---------------------------------------------TAA------------------------TAA---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  0   1   1           Neu  FL                     TNeu091l21.FL-Sanger                                                                                                                                                                                                                                                                                           TGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAATTACCCGCGATTCAAGAATCTGAGAGAAACTTTGATGGTCCAAGGAATGGAGGTTTTGGAGGAAGAGGGAGGAGACCTTTTGATAGAAGAAATAATTCCAGAGGAGGAGGAGGAAGAGGCAGAAATAGAAGTGGAGGGTTTAGAAGGGGCCGTTAGTGACTCCAAACATCCCAACATCCCATGTCACAATAACTTTTTTTAATATACTGCCATGTTCATAAATATTCCTTCCTAAAGTAACTTGAGACATATTTTTATGCAATATAAAACTGTGTGCTTAGCCCTTATTAAAATCTATCTGTTAAATAAAAAAAAAAAAAAAAAA
  5   1   1       chi Bone      in                         CBTC493.fwd                                                   GCAGGAGCCGGGGGGGCTGGAGGTTCTGGGTCTCCCAGCCCTGAGGCCGAAGAAGCCCAGGCGCAAGCTGTACAGTTTCACGAGGATGAGGAGATCATCGAGGTGCTGGAGCTGAACGACGTAGAACCAGATCCAGATGATTTGGCCAGCGACATGGAGGACGTCGACTTTGCAGATGATCCTGAAGATGGGGAAATGGCTGATAATGAGGAATGGGAGACAGAGGATGAGGGAGTGGAAGAAGGAACGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGACACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAACGGCGTANAGAGTGTTAAAAAATCTAANAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGA
  3   1   1         - Gas       in                    TGas135l23.q1kT7                                                                                                                                                                                                                                                   TGACGCACGATCGTTCCTTCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGGTTAAAAAAAAAAAAAAAAAA
  5   1   1   12    - Gas7 5g3  in                         XZG32917.5p ...................................................................................................................................................................................................................................................GACGCACGATCGTTCCTTCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTTCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCANGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCACAGCCGTTGGCT
  5   1   1         - Gas       in                   TGas135l23.p1kSP6                                                                                                                                                                                                                                                      GACGCACGATCGTTCCTTCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTT
  5   1   1         - Gas1 5g                            IMAGE:6987313                                                                                                                                                                                                                                                      TGGGTCGGGTCCGGATTCCCGGGATCGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGANATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCNCATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGG
  5   1   1         - Neu  5g3  in                   TNeu059g09.p1cSP6                                                                                                                                                                                                                                                        CACGATCGTTCCTTCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAG
  5   1   1         - Neu0 5x3  in                     NISC_ng28h04.y1                                                                                                                                                                                                                                                          CGATCGTTCCTTCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAGAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCG
  5   1   1   10    - Tbd1 5g3  in                         CBXT3504.b1 .........................................................................................................................................................................................................................................................CGATCGTTCCTTCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTTCAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTT
  5   1   1   15    - Brn3 5g3  in                         CAAK7134.5p ...........................................................................................................................................................................................................................................................GGTCGGATTCCGGGATTCGTCGACCACGCGTCCGGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTT
  3   1   1         - BrSp      in                     EC2BBA10DA07.b1                                                                                                                                                                                                                                                                  GGGGCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGATATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAAAAATCAACAACAATAATCCGACTCCCAA
  3   1   1         - BrSp                             EC2BBA23BF10.b1                                                                                                                                                                                                                                                                  GGGGCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGATATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAGCTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACA
  3   1   1         - BrSp      in                     EC2BBA27BE04.b1                                                                                                                                                                                                                                                                  GGGGCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGATATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCGGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAAGAAGATCACA
  3   1   1         - BrSp      in                     EC2BBA35DE02.b1                                                                                                                                                                                                                                                                  GGGGCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAATGGCGTAAAGAGTGTAAAAAATCAAAAGAACACAACAG
  3   1   1         - BrSp      in                      EC2BBA9AD04.b1                                                                                                                                                                                                                                                                  GGGGCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTCGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTAAAAAATAAAAAAGAACACAACA
  5   1   1         - BrSp      in                     EC2BBA10DA07.g1                                                                                                                                                                                                                                                                   GGGCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGATATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGTCTGTGCCACAATCAGATCTCTCTGAAACCGCAAAAAAAAAAAAAAAAAAAA
  5   1   1         - BrSp      in                     EC2BBA27BE04.g1                                                                                                                                                                                                                                                                   GGGCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGATATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCGGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAAAAAAAAAAAAAAAAAA
  3   1   1         - BrSp FLt3                        EC2BBA32AC11.b1                                                                                                                                                                                                                                                                   GGGGCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGACACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATAAGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAAAGAACCAACTCCTAAGAAAAGAAAAAAGGATAC
  5   1   1         - BrSp      in                     EC2BBA35DE02.g1                                                                                                                                                                                                                                                                   GGGCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAATGGCGTAAAGAGTGTTAAAAAATCTAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAAAAAAAAAAAAAAAAAAA
  5   1   1         - BrSp      in                      EC2BBA9AD04.g1                                                                                                                                                                                                                                                                   GGGCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTCGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCCAAAAAAAAAAAAAAAAAAAA
  5   1   1         - HeRe 5g3  in                     EC2CAA26AC12.g1                                                                                                                                                                                                                                                                     GCCTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTC
  3   1   1         - Tad5      in                         XZT52254.3p                                                                                                                                                                                                                                                                     CCACGCGTCCGGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAG
  5   1   1         - Gas       in                   TGas060n06.p1cSP6                                                                                                                                                                                                                                                                        GTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTT
  3  -1   1         - Ovi1      in                        CABI13615.3p                                                                                                                                                                                                                                                                        CTTTTTCCGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAAT
  3   1   1         - Gas       in                    TGas060n06.q1kT7                                                                                                                                                                                                                                                                         TTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAAAAAAAAAAAAA
  5   1   1         - Neu                            TNeu021b07.p1kSP6                                                                                                                                                                                                                                                                            CTTTTTCACGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGTCTGAAACTCCTCTACCCAAGATAAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTC
  5   1   1   14    - Brn3 5g3  in                         CAAK5766.5p ..............................................................................................................................................................................................................................................................................CGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACT
  5   1   1   14    - Brn4 5g3  in                        CAAL20407.5p ..............................................................................................................................................................................................................................................................................CGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCCTAGG
  5   1   1   10    - Spl2 5g3  in                        CBSS7521.fwd ..............................................................................................................................................................................................................................................................................CGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGACACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCC
  5   1   1   10    - Spl2 5g3  in                        CBSS9534.fwd ..............................................................................................................................................................................................................................................................................CGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGAC
  5   1   1   10    - Te1  5g3  in                         CBWN6247.b1 ..............................................................................................................................................................................................................................................................................CGCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGACACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGG
  5   1   1         - TbA  5x3  in                   TTbA053c14.p1kSP6                                                                                                                                                                                                                                                                                CTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGGCTGAAACTCCTCTACCCAAGATAAAAAAGAGAATAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCTGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCATAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAGAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGATGAGTGTGAAGAAAAGCAGTTAACCGAAGAGGAAGAGGAAATAAATCATGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCGCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAGTGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAAAAAGC
  5   1   1         - Tad5      in                         XZT52254.5p                                                                                                                                                                                                                                                                                GCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAAAAAAAAAAAGG
  5   1   1   12    - Tad5 5g3  in                         XZT68661.5p ...............................................................................................................................................................................................................................................................................GCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCC
  5   1   1   20    - Spl2 5g                             CBSS6868.fwd ...............................................................................................................................................................................................................................................................................GCTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGC
  5   1   1         - Neu  5g3  in                   TNeu105l16.p1cSP6                                                                                                                                                                                                                                                                                 CTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATT
  5   1   1         - TbA  5g3  in                   TTbA017h10.p1kSP6                                                                                                                                                                                                                                                                                 CTGCTAAGTGTGGCGTGGTCAGCTGCGGATCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTT
  5   1   1         - TbA  5g3  in                   TTbA049o22.p1kSP6                                                                                                                                                                                                                                                                                 CTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATT
  5   1   1         - Abd0 5g                            IMAGE:7017572                                                                                                                                                                                                                                                                                    CTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCNTAAGGCGTGTCCTACCTGTTNCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAA
  5   1   1   14    - Brn3 5g3  in                        CAAK10906.5p ...................................................................................................................................................................................................................................................................................CTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCAT
  5   1   1   22    - Gas7 5g                              XZG18560.5p ...................................................................................................................................................................................................................................................................................CTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCT
  5   1   1         - TpA       in                   TTpA067j24.p1kSP6                                                                                                                                                                                                                                                                                       CTGCTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTTACTCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCAT
  5   1   1         - Abd0 5g3  in                     IMAGE:6999165.b                                                                                                                                                                                                                                                                                        GTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAAATTCATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCTCGTACAGGCACAGGGAAAATCATTTCCTTTGCTATTNCCTTAGTGGA
  5   1   1         - Abd0 5g                            IMAGE:7015973                                                                                                                                                                                                                                                                                        CCGGGACGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGG
  5   1   1         - Neu  5g                        TNeu006f05.p1kSP6                                                                                                                                                                                                                                                                                        CCCCGGGGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCT
  5   1   1   10    - Thy1 5g3  in                        CBST1795.fwd .......................................................................................................................................................................................................................................................................................GTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGAT
  5   1   1   12    - Tad5 5g3  in                         XZT47897.5p ........................................................................................................................................................................................................................................................................................GTGGCGTGGTCAGCGTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCCTTTAGTGGAGCGGCTTTAATGAGGACCAACAGGCCGTTGGCTAGAGGAACGTGCCGCCCAAGGGTGAATAATT
  5   1   1         - Gas       in                   TGas059c10.p1cSP6                                                                                                                                                                                                                                                                                          CTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTA
  5   1   1         - Gas       in                   TGas071m19.p1cSP6                                                                                                                                                                                                                                                                                          CTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAAC
  5   1   1         - Gas       in                   TGas124k09.p1cSP6                                                                                                                                                                                                                                                                                          CTAAGTGTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTC
  5   1   1         - Tbd0 5g                            IMAGE:6976694                                                                                                                                                                                                                                                                                          GTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGGTCAAGCCCCGTACAGGCACAGGGAAAACATTTTTCTTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGGACCAACAGCCGTTTGGCTAAAGGACGTGCGCCCTAGGGTGGATAATTTCTTACTCCCCACCAGAGAGTTAGCCTA
  5   1   1         - Tbd1      in                         CBXT5143.b1                                                                                                                                                                                                                                                                                          GTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCAAAAAAAAAAAAAAA
  3   1   1         - Tbd1      in                         CBXT5143.g1                                                                                                                                                                                                                                                                                          GTGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCAAAAAAAAAAAAAAA
  5   1   1         - Neu  5g                        TNeu068j08.p1cSP6                                                                                                                                                                                                                                                                                           TGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGGAGAGGGGAAATAATCAGAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCA
  5   1   1         - Neu  FL   in                   TNeu091l21.p1cSP6                                                                                                                                                                                                                                                                                           TGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAA
  5   1   1         - TbA  5g3  in                   TTbA003f05.p1kSP6                                                                                                                                                                                                                                                                                           TGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACT
  5   1   1   14    - Te4  5g3  in                         CAAN5922.5p ..........................................................................................................................................................................................................................................................................................TGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAA
  5   1   1   14    - Te4  5g3  in                         CAAN6050.5p ..........................................................................................................................................................................................................................................................................................TGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAGCTGAAAGTCTGTTGTT
  5   1   1   14    - Te4  5g3  in                         CAAN8088.5p ..........................................................................................................................................................................................................................................................................................TGGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTTGCTATCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGC
  5   1   1   10    - Spl1 5g3  in                         CABK7438.5p ..........................................................................................................................................................................................................................................................................................CATCGATTCGCAGCTGCGGACCCCGTTCTCTTGGATCGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACT
  5   1   1   11    - Te1  5g3  in                        CBWN10929.b1 ..........................................................................................................................................................................................................................................................................................GGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAATGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTC
  5   1   1   15    - Brn4 5g3  in                        CAAL23633.5p ...........................................................................................................................................................................................................................................................................................GCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACNTCCACCAGAGAGTTAGCTATTCAGATCACAAATGGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACT
  5   1   1   12    - Gas7 5g3  in                         XZG28977.5p ...........................................................................................................................................................................................................................................................................................GGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGTCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATT
  5   1   1   10    - Te1  5g3  in                         CBWN9079.b1 ...........................................................................................................................................................................................................................................................................................GGCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGACACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGG
  5   1   1   14    - Te5  PIPE in                        CAAO11873.5p ............................................................................................................................................................................................................................................................................................GCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACT
  5   1   1   10    - Tail 5g3  in                         CBSW3476.b1 ............................................................................................................................................................................................................................................................................................GCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAATGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAG
  5   1   1   10    - Te1  5g3  in                         CBWN8802.b1 ............................................................................................................................................................................................................................................................................................GCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGACACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGG
  5   1   1         - TbA  5g3  in                   TTbA009e05.p1kSP6                                                                                                                                                                                                                                                                                              GCGTGGTCAGCTGCGGACCCCGTTCTCTTGGATCGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACT
  5   1   1   10    - Spl2 5g3  in                         CBSS525.fwd .............................................................................................................................................................................................................................................................................................GGTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGACACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGT
  5   1   1         - Neu0 5g                            IMAGE:6991450                                                                                                                                                                                                                                                                                               GTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTNATGAGGACCAACAGCCGTTGGGCTAGAGGACGTGCGCCCTAGGGGGATAATTCTTACTCCCCACCAGAGAGTTTAGCTATTCAGATCACCAATGAAATCCGCAGCATCACTTAAAAGCTTGAAAGTCTGGTTGTTTCTACCGA
  5   1   1   10    - Spl2 5g3  in                        CBSS8993.fwd ..............................................................................................................................................................................................................................................................................................CGTGGTCAGCTGCGGACCCCGTTCTCTTGGATCGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAA
  5   1   1   10    - Eye  5g3  in                         CCAX9918.b1 ..............................................................................................................................................................................................................................................................................................GTGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGCTTAATGAGGACCAA
  5   1   1         - TbA  5g3  in                   TTbA001k10.p1kSP6                                                                                                                                                                                                                                                                                                TGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAG
  5   1   1         - TbA  5g                        TTbA007c02.p1kSP6                                                                                                                                                                                                                                                                                                TGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTTACCCAAGAGGAAGAAGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTTCAAGGGACACCATTAAGAATTTTGCAGCTAAAAGGTGTGTCCCTACTGTTNCCNANNTTCATCNAAACATTCCACACTGCTTACAGNTGGCAAGATGTAGTGGTCCANGCTCGTACAGGGCACAGGGAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACT
  5   1   1         - TbA  5g3  in                   TTbA007g24.p1kSP6                                                                                                                                                                                                                                                                                                TGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGA
  5   1   1         - TbA  5g3  in                   TTbA063n05.p1kSP6                                                                                                                                                                                                                                                                                                TGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCNAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGNCANAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTC
  5   1   1         - TbA  5g3  in                   TTbA070n23.p1kSP6                                                                                                                                                                                                                                                                                                TGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATG
  5   1   1         - HdA  5g3  in                   THdA021b01.p1kSP6                                                                                                                                                                                                                                                                                                TGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACT
  5   1   1         - Te5       in                         CAAO2500.5p                                                                                                                                                                                                                                                                                                TGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCCTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCT
  5   1   1         - Te5       in                         CAAO9895.5p                                                                                                                                                                                                                                                                                                TGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAGTCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTANGAGACGTGCGCCTAGG
  5   1   1   11    - Te1  5g3  in                        CBWN12877.b1 ...............................................................................................................................................................................................................................................................................................GTGCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAATGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCCAGGGTGATAAA
  5   1   1         - TbA  5g3  in                   TTbA001k06.p1kSP6                                                                                                                                                                                                                                                                                                 TGGTCAGCTGCGGACCCCGTTCTCTTGGATCGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTA
  5   1   1   10    - Ski1 5g3  in                         CABJ9540.5p ................................................................................................................................................................................................................................................................................................CCATCGATTCAATCGGCCGAGGCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCANCAATGAAATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCA
  5   1   1   10    - Spl2 5g3  in                        CBSS7400.fwd ................................................................................................................................................................................................................................................................................................GGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCC
  5   1   1   10    - Thy1 5g3  in                        CBST1173.fwd .................................................................................................................................................................................................................................................................................................GTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCC
  5   1   1   10    - Spl2 5g3  in                        CBSS4667.fwd .................................................................................................................................................................................................................................................................................................GTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCANAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCCCGTGCTAGAGGACGTGCGCCTAGGG
  5   1   1   10    - Te1  5g3  in                        CBWN12323.b1 .................................................................................................................................................................................................................................................................................................GTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCCGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAAAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCACAATCTGTAGATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGACACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAA
  5   1   1   10    - Eye  5g3  in                         CCAX5401.b1 .................................................................................................................................................................................................................................................................................................GTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTT
  5   1   1         - TbA  5g3  in                   TTbA039b06.p1kSP6                                                                                                                                                                                                                                                                                                   TCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACT
  5   1   1   14    - Brn3 5g3  in                         CAAK6499.5p ..................................................................................................................................................................................................................................................................................................TCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCAT
  5   1   1         - Brn4      in                         CAAL5888.5p                                                                                                                                                                                                                                                                                                   TCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGA
  5   1   1   22    - Tad5 5g                              XZT27963.5p ...................................................................................................................................................................................................................................................................................................CAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAGGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACA
  5   1   1   10    - Thy1 5g3  in                        CBST4370.fwd ...................................................................................................................................................................................................................................................................................................CAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGC
  5   1   1         - Gas       in                   TGas068g15.p1cSP6                                                                                                                                                                                                                                                                                                      GCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTT
  5   1   1         - HdA       in                   THdA044g21.p1kSP6                                                                                                                                                                                                                                                                                                      TGGTCAGCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCAT
  5   1   1         - Abd0 5g                            IMAGE:7018046                                                                                                                                                                                                                                                                                                       CTGCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCATTCAATCCAAACATTCCACACTGCTTACAGTGGGCAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCN
  5   1   1         - TbA       in                   TTbA015g16.p1kSP6                                                                                                                                                                                                                                                                                                       TGGTCAGCTGCGGACCCCGTTCTCTTGTTTCGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACT
  5   1   1   25    - Brn3 5g                              CAAK7816.5p .......................................................................................................................................................................................................................................................................................................GCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTAC
  5   1   1         - TpA  5g3  in                  TTpA047i07.p1kaSP6                                                                                                                                                                                                                                                                                                         CGGACCCCGTTCTCTTGGATACGGGGACCTTCTGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTTCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCAT
  5   1   1   14    - Te4  5g3  in                         CAAN5775.5p ........................................................................................................................................................................................................................................................................................................GCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGC
  5   1   1   10    - Te1  5g3  in                         CBWN3800.b1 ........................................................................................................................................................................................................................................................................................................GCGGACCCCGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGACACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGC
  3  -1   1         - Lun1      in                        CABD13014.3p                                                                                                                                                                                                                                                                                                           CCTATAGGGCGAGAGGGGATACGGGAGTTTCAGGACAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAG
  3  -1   1         - Liv1      in                         CAAR1819.3p                                                                                                                                                                                                                                                                                                            CTAGTGCGGCCCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCT
  5   1   1   10    - Spl1 5g3  in                         CABK1401.5p ...........................................................................................................................................................................................................................................................................................................CCGAGGGTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGC
  3  -1   1         - Spl1      in                         CABK1778.3p                                                                                                                                                                                                                                                                                                             GGGCGAGAGGCCTTGGATCGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACT
  5   1   1   10    - Spl1 5g3  in                         CABK2160.5p ...............................................................................................................................................................................................................................................................................................................CTCGATTCGTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTAC
  5   1   1         - Neu  5g                        TNeu138e14.p1cSP6                                                                                                                                                                                                                                                                                                                  GTTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCGAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCA
  5   1   1         - Gas  5g                        TGas033p18.p1kSP6                                                                                                                                                                                                                                                                                                                   TTCTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATNTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTG
  5   1   1   10    - Hrt1 5g3  in                        CAAQ11243.5p ....................................................................................................................................................................................................................................................................................................................CTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATNCACAGCAAGTTTTC
  5   1   1   10    - Spl2 5g3  in                        CBSS8231.fwd ....................................................................................................................................................................................................................................................................................................................CTCTTGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGT
  5   1   1   10    - Ovi1 5g3  in                        CABI13062.5p .....................................................................................................................................................................................................................................................................................................................ATTGGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTC
  3  -1   1         - Int1      in                        CAAP11338.3p                                                                                                                                                                                                                                                                                                                        TAGGGCGAGAGGCTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACT
  5   1   1   10    - Liv1 5g3  in                         CAAR1900.5p ........................................................................................................................................................................................................................................................................................................................TGGATACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGNTGTTTCTA
  3  -1   1         - Lun1      in                         CABD1361.3p                                                                                                                                                                                                                                                                                                                          GGGTAGAGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAAATCGCAGCAT
  5   1   1         - Sto1      in                         CABG3036.5p                                                                                                                                                                                                                                                                                                                          GATACGGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCNTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTAC
  5   1   1         - Gas1 5g                            IMAGE:6990827                                                                                                                                                                                                                                                                                                                             GGGAGGGAGTTTCAGGACAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCNTTGCTATTCCTTAGTGGGAGCGCTTNATGAGACCACAGCCGTGGCTAGAGACGTGCGCTAGGTGATATCTACTCCACAGAAGTAGCTATCGATCCATGAA
  5   1   1   10    - Liv1 5g3  in                        CAAR10031.5p ............................................................................................................................................................................................................................................................................................................................TACGGGAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTAC
  5   1   1   10    - Limb 5g3  in                        CBSU3493.fwd .............................................................................................................................................................................................................................................................................................................................GCGGGAGTTTCAGGACATATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAATGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCTAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTT
  3  -1   1         - Fat1      in                          CABC564.3p                                                                                                                                                                                                                                                                                                                                GGAGGCTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAAAAAGCTGAAAGTCTGTTGTTTCTACGGAGGAACTCCATATNCACAGCA
  3  -1   1         - Lun1      in                        CABD11207.3p                                                                                                                                                                                                                                                                                                                                GAAGGCTTTCAGGACAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTTCTACGAGGAACTCCATATNCACAGCAAAG
  5   1   1         - Spl1      in                         CABK9957.5p                                                                                                                                                                                                                                                                                                                                 CATCGATTCGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAAAAAAAAAAAAAAAAA
  5   1   1   10    - Spl1 5g3  in                        CABK10238.5p .................................................................................................................................................................................................................................................................................................................................GAGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAC
  5   1   1   11    - Fat1 5g3  in                         CABC6368.5p ..................................................................................................................................................................................................................................................................................................................................CCGAGGGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATCAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGA
  5   1   1   10    - Spl1 5g3  in                         CABK3751.5p ..................................................................................................................................................................................................................................................................................................................................AGTTTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAANA
  5   1   1   10    - Hrt1 5g3  in                        CAAQ12424.5p .....................................................................................................................................................................................................................................................................................................................................TTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCA
  5   1   1   10    - Liv1 5g3  in                         CAAR6645.5p .....................................................................................................................................................................................................................................................................................................................................TTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACT
  5   1   1   10    - Fat1 5g3  in                         CABC5292.5p .....................................................................................................................................................................................................................................................................................................................................TTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACNGAGGAACTCCATATCAACAGCAAGTTTTC
  5   1   1   10    - Fat1 5g3  in                          CABC573.5p .....................................................................................................................................................................................................................................................................................................................................TTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACG
  5   1   1         - Lun1      in                        CABD11335.5p                                                                                                                                                                                                                                                                                                                                      TTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACANATGAAATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATNNCACAGCAAG
  5   1   1         - Lun1      in                         CABD9081.5p                                                                                                                                                                                                                                                                                                                                      TTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTAAGGAGTGGTTCCCGTTTTATGTTTTACTTTACTTGATACCAGATAAATCCATACA
  5   1   1   10    - Ova1 5g3  in                        CABE10154.5p .....................................................................................................................................................................................................................................................................................................................................TTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCCAAG
  5   1   1   10    - Ski1 5g3  in                        CABJ12168.5p .....................................................................................................................................................................................................................................................................................................................................TTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATNCACAGCAAGTTTTCTCCATTA
  3  -1   1         - Spl1      in                        CABK10266.3p                                                                                                                                                                                                                                                                                                                                      TTCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGC
  5   1   1   10    - Fat1 5g3  in                         CABC5438.5p ......................................................................................................................................................................................................................................................................................................................................TCAGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTC
  3  -1   1         - Lun1                                 CABD8276.3p                                                                                                                                                                                                                                                                                                                                       TTCAGGACAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCA
  5   1   1         - Fat1 5g                              CABC6902.5p                                                                                                                                                                                                                                                                                                                                        CAGGACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTTGTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCCATTAGGAGGGATTTGACTTTTTAGTT
  5   1   1         - Ovi1      in                         CABI1560.5p                                                                                                                                                                                                                                                                                                                                         AGGACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGA
  3  -1   1         - Liv1      in                          CAAR440.3p                                                                                                                                                                                                                                                                                                                                           GGACAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAAAAAGCTGAAAGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTTA
  5   1   1   10    - Lun1 5g3  in                         CABD4616.5p ..........................................................................................................................................................................................................................................................................................................................................GACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATC
  3   1   1         - Spl1      in                         CABK9957.3p                                                                                                                                                                                                                                                                                                                                           GACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTC
  5   1   1   12    - Gas7 5g3  in                         XZG33601.5p ..........................................................................................................................................................................................................................................................................................................................................GACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAGGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGACTCCATATC
  5   1   1         - Hrt1 5g3  in                        CAAQ11290.5p                                                                                                                                                                                                                                                                                                                                            ACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAGGGTCTGTTGTTTCTACGGAGG
  5   1   1   10    - Fat1 5g3  in                         CABC7192.5p ...........................................................................................................................................................................................................................................................................................................................................ACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTA
  5   1   1   10    - Mus1 5g3  in                         CABH4055.5p ...........................................................................................................................................................................................................................................................................................................................................ACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAGATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGG
  5   1   1   10    - Ovi1 5g3  in                        CABI13875.5p ...........................................................................................................................................................................................................................................................................................................................................ACAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAG
  5   1   1   10    - Spl1 5g3  in                         CABK2717.5p ...........................................................................................................................................................................................................................................................................................................................................ACAAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCAT
  5   1   1         - Neu0 5g                            IMAGE:6993704                                                                                                                                                                                                                                                                                                                                             CAAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCNTAGGGTGATAATTCTTACTCCCCACCCCAGAGAGTTAGCTATTTCAGATCACAAAATGAAAATCCCCGCCAGCATCACTAAAAAAAGCTGAAAAGGTTCTGTTTGGTTTCN
  5   1   1   12    - Gas7 5g3  in                         XZG12523.5p ............................................................................................................................................................................................................................................................................................................................................ACAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGA
  5   1   1   10    - Int1 5g3  in                        CAAP12701.5p .............................................................................................................................................................................................................................................................................................................................................AAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGGACTCCATATCAACAGCAAGTTTTCT
  5   1   1   10    - Hrt1 5g3  in                         CAAQ3688.5p .............................................................................................................................................................................................................................................................................................................................................AAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACANATGANATCCGCAGCATCACTAANAAGCTGAAAGTCTGTTGTTTCTA
  5   1   1   10    - Hrt1 5g3  in                         CAAQ7136.5p .............................................................................................................................................................................................................................................................................................................................................AAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATG
  5   1   1   10    - Liv1 5g3  in                         CAAR3104.5p .............................................................................................................................................................................................................................................................................................................................................AAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAANAAGCTGAAAGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAG
  5   1   1         - Lun1      in                        CABD12995.5p                                                                                                                                                                                                                                                                                                                                              AAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACCGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGGTTCTACGGAGGAACTCCATATCAACAGCAAG
  5   1   1   10    - Spl1 5g3  in                        CABK10890.5p .............................................................................................................................................................................................................................................................................................................................................AAATCATCGATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGGACTCCATATCAACAGCAAGTTTT
  5   1   1   10    - Spl1 5g3  in                         CABK2504.5p .............................................................................................................................................................................................................................................................................................................................................AAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACATCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAANAAGCTGAA
  5   1   1   10    - Spl1 5g3  in                         CABK3183.5p .............................................................................................................................................................................................................................................................................................................................................AAATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTAC
  5   1   1         - Int1 5g3  in                         CAAP1361.5p                                                                                                                                                                                                                                                                                                                                               AATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTAC
  5   1   1   10    - Int1 5g3  in                        CAAP11315.5p ...............................................................................................................................................................................................................................................................................................................................................ATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCA
  5   1   1   10    - Liv1 5g3  in                          CAAR393.5p ...............................................................................................................................................................................................................................................................................................................................................ATCATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGANGTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAA
  3  -1   1         - Int1      in                        CAAP10188.3p                                                                                                                                                                                                                                                                                                                                                 CTCCTATAGGGCGAGAGGCTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAAGA
  5   1   1         - Lun1      in                        CABD11101.5p                                                                                                                                                                                                                                                                                                                                                  CATCGATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTTAGTG
  5   1   1   10    - Lun1 5g3  in                         CABD3530.5p ..................................................................................................................................................................................................................................................................................................................................................ATCGATTCGCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCCGTGGCTAGAGGACGTGCGCCT
  5   1   1   10    - Int1 5g3  in                        CAAP12491.5p ......................................................................................................................................................................................................................................................................................................................................................ATGCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGA
  5   1   1         - Int1      in                        CAAP13156.5p                                                                                                                                                                                                                                                                                                                                                        TGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACT
  5   1   1         - Lun1      in                        CABD12104.5p                                                                                                                                                                                                                                                                                                                                                        TGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGAT
  3  -1   1         - Int1      in                        CAAP10610.3p                                                                                                                                                                                                                                                                                                                                                         GCCCGTGAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTTGTTTCTACGAGGAACTCCATATCAACAGCAAGTT
  5   1   1         - Spl1      in                         CABK4468.5p                                                                                                                                                                                                                                                                                                                                                           CCATGCCCGTGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCGAGAAGAAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCACGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCATAACAGTATGAAGGACAGCAGCCCGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCGAAGAGGAAGAGGAAATAAATCACGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGAC
  5   1   1         - Hrt1      in                        CAAQ10635.5p                                                                                                                                                                                                                                                                                                                                                              TGAAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTC
  5   1   1         - Gas7                                 XZG13448.5p                                                                                                                                                                                                                                                                                                                                                               GAAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTA
  5   1   1         - Int1      in                        CAAP12740.5p                                                                                                                                                                                                                                                                                                                                                                AAGGTTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAAAAAGCTGAAGGT
  3   1   1         - Lun1      in                         CABD8843.3p                                                                                                                                                                                                                                                                                                                                                                AAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACC
  5   1   1         - Lun1      in                         CABD8843.5p                                                                                                                                                                                                                                                                                                                                                                AAGGTTTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAAAAAAAAAAAAAAAA
  5   1   1         - Int1      in                         CAAP2709.5p                                                                                                                                                                                                                                                                                                                                                                    TTTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAAGTCTGTTGTTTCTA
  5   1   1         - Int1      in                        CAAP11960.5p                                                                                                                                                                                                                                                                                                                                                                     TTATGCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCAT
  5   1   1         - Lun1      in                         CABD6437.5p                                                                                                                                                                                                                                                                                                                                                                     TTATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACNGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGNATTTGAC
  3  -1   1         - Fat1      in                         CABC8317.3p                                                                                                                                                                                                                                                                                                                                                                      ATAGGGCGAGAGGCGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATNCACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGT
  5   1   1         - Int1      in                         CAAP7484.5p                                                                                                                                                                                                                                                                                                                                                                       ATGTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAAAAAGCTGAGGGTCTGTTGTTTCTA
  5   1   1         - Tail      in                        CBSW12133.b1                                                                                                                                                                                                                                                                                                                                                                       GCTCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGAT
  3  -1   1         - Int1      in                         CAAP6776.3p                                                                                                                                                                                                                                                                                                                                                                         GTCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAAATCCGCAGCATCCCTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGT
  3  -1   1         - Ova1      in                         CABE6095.3p                                                                                                                                                                                                                                                                                                                                                                         GCCGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATAT
  5   1   1         - Int1      out                         CAAP675.5p                                                                                                                                                                                                                                                                                                                                                                          CGATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGAGTAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGA
  5   1   1         - Int1      in                        CAAP11549.5p                                                                                                                                                                                                                                                                                                                                                                             ATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACANNATGAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATNCACAGCAAGTTTTCTCCATTAAGGAGGGATTTGA
  5   1   1         - Int1      in                        CAAP14226.5p                                                                                                                                                                                                                                                                                                                                                                             ATGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTAGCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTAC
  5   1   1         - TpA       out                  TTpA054n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                              ATGAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGANATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCNACAGCCGTTGGCTAGAGGACGTGCGCCTAGG
  5   1   1         - Liv1      in                         CAAR4489.5p                                                                                                                                                                                                                                                                                                                                                                              TGAAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTA
  5   1   1         - Int1      in                         CAAP8041.5p                                                                                                                                                                                                                                                                                                                                                                                GAGGGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAGGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTNNGTGTTCTACGGAGGAACTCCATATCAACAGCAAGTT
  5   1   1         - Lun1      in                        CABD13672.5p                                                                                                                                                                                                                                                                                                                                                                                AAATGGAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTA
  5   1   1       chi Egg                           TEgg057f16.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                     TGACACGTGGATCTTTCTCATTGACGTAATTATCTACTATATTCTATTACTACTTAAAAAATCTAAAATGTATCTGTATGGAATACGTTATACAATTTATGGAATTTTCTTATAATAACTCTGTGTGTATTATAAAATATTTTTTACTATCTGTAATTTTTAAAAGAAAGGGGACATTAAAATGTTTTTCTGATACCGCAAAACAATAATGAAAGAGAACAACCAGATCACAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTGGGCCAGGGGGCCGAACATTCCCACTCACCCGATAGGACAGACAATTCCGAACCACCAATGATCGGAGTATAAGAGTGTTAAATTATCTAAAAACAACACAACAAGGGATGATAATGAACCCTCTCCTTGGAAAATATAAAAGGATACTATGTTATATTCACAACATCCTAAGAGTGTGAAGAAAAGCTGTTAACCAAAGATGAAGATGATTTAAATCTTCAAAGAAATAGATGGCGGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTT
  5   1   1         - TbA       in                   TTbA004l12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                     GAGGTTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACNGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGG
  5   1   1         - Liv1      in                         CAAR5425.5p                                                                                                                                                                                                                                                                                                                                                                                         TTGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTT
  5   1   1         - Int1      in                         CAAP9364.5p                                                                                                                                                                                                                                                                                                                                                                                          TGAAAGTGTCAAGAAGAAGAAACAGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGA
  5   1   1         - Eye       in                         CCAX4759.b1                                                                                                                                                                                                                                                                                                                                                                                                                  GTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCA
  5   1   1         - Int1      in                        CAAP11102.5p                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTA
  5   1   1         - Hrt1      in                        CAAQ10840.5p                                                                                                                                                                                                                                                                                                                                                                                                                     TGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCG
  5   1   1         - Limb      in                        CBSU4630.fwd                                                                                                                                                                                                                                                                                                                                                                                                                      AAACTCCTCTACCCAAGATAAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTCGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATCATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGC
  5   1   1         - HdA       in                   THdA050j22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                        AACTCCTCTACCCAAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCATTAANGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCAT
  5   1   1         - TpA                           TTpA047i09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCTGCCCACGATACAAATGAGAATCATGCTCAATGGGGCCACTGAACATCTTGATTTGGATCTGGTGGCAGACTCTGTCAATGGAGAGATCAACCTCCATAATCCGACTCCCCATCTGACTATGTAGACGACGCCTGTGCCACTTTCTGATCTCTCTGACACCGCACAACAGTATGAACGAGAGCAGCCAGATCCA
  3  -1   1         - Liv1                                 CAAR9871.3p                                                                                                                                                                                                                                                                                                                                                                                                                             CTCTTTTTTATCTTGGGTAGAGGAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTC
  5   1   1         - Fat1      in                         CABC5537.5p                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGGATCTGGCTGCTCTCCTTCATACTGTTCTGCGGTTTCAGAGAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCGGATCTCTCTGAAACCGCAGAACAGTATGATGGAGAGCAGCCAGATCCAAGCATC
  5   1   1         - Tail      in                         CBSW3003.b1                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCCAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCAC
  3  -1   1         - Tbd1                                CBXT21847.g1                                                                                                                                                                                                                                                                                                                                                                                                                                       GATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCA
  5   1   1         - Ova1      in                        CABE13319.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        ATAAAAAAGAGAAAAATGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCAC
  5   1   1         - Tad5                                 XZT35689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTG
  5   1   1         - Thy1      in                       CBST13195.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAAAATGGGGCAACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGATATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAG
  5   1   1         - In54                            IMAGE:8945451.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTAGTTAATAAGGGATTAGGGGATATTTAGAATTCGTCCCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAGAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAGATGTAGTGGTCCAGGCCCGTACAGGCACATGGAAAACATTTTCCTTTGCTATTCCTTTAAGTGGAGCGGCTTATGAGGACCATCAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGAAATTCTTACTCCCACCAAGAGAGATGAACTAATCGGATCACAAATGAAATCCGCGACAACAACAAAAAGCTGAAGGTCTGTTGTTACTATGGATGAA
  5   1   1         - TbA       in                   TTbA007d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAGAAGATCTTGATTTGGAACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAA
  5   1   1         - Ova1      in                        CABE10700.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTT
  5   1   1         - Te5       in                         CAAO1496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGTGGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAANACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAAGTGACATGATGTTTGATAT
  5   1   1         - Lun1      in                         CABD6791.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCATCGATTCGTGTAAATGGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCCAAACTACCG
  5   1   1         - Spl2      in                        CBSS1044.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGGCAGAATCTGTAAATGGAGAGATAAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGANATCCGCAGCATCACTAANAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATNCACAGCAAGTTTTC
  5   1   1         - Spl2      in                        CBSS5411.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCAGAATCTGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGACACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATACCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTCTTAGTTGGCACACCTGGCCGTG
  5   1   1         - Tad5                                  XZT8107.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAATCTGTAAATGGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTG
  5   1   1       chi TbA       in                   TTbA053g03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATGGCGCTAGCGACTTCACTATTCCGACTCCAAAACTCACCATAATCCTGAACCCTGTGTCCCATTCATCTTTCTCTGAATTCTTGCAATACTCTTTATCATATGTTGCTGATCGCTTTCGCTCGCCATATCTCGTTATTTCCTTTTTTCTACAACTAATAGATGGCAAGGATCATTTGTACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAATAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAATAGCAGTTAACCAAAGACGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGTGCAAAGGATGTANTTGGTCCTAGGCCCGTACAGGCACANGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACT
  3  -1   1         - Liv1      in                        CAAR11564.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAA
  5   1   1         - Thy1      in                        CBST5431.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCGCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCC
  5   1   1         - Gas7      in                         XZG41752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACT
  5   1   1         - TbA                            TTbA051h24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGATCACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCACGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTANACGAAGTTGACATGATGTTTGATATGGGCTT
  5   1   1         - Tail      in                         CBSW9253.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATCAACAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATCATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTCTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTT
  5   1   1         - Spl1      in                         CABK4326.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCGATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAA
  5   1   1         - Eye       in                          CCAX538.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAACAATAATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGC
  5   1   1         - Spl1      in                          CABK928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAG
  5   1   1         - Hrt1                                 CAAQ7214.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGACTCCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAAACAGTCGAGGAATATTATCT
  5   1   1         - Hrt1                                 CAAQ6742.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAAACAGT
  5   1   1         - Spl1      in                         CABK2025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAAGCTGAAGAAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTC
  5   1   1         - Ovi1      in                         CABI9148.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAAGAAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAAACCTGATCCTG
  5   1   1         - TbA       in                   TTbA070p18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAAACAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCC
  5   1   1         - HdA                           THdA030g19.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAACCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCNCCAGACTCTTCTTTTCTCTGCAACATGT
  5   1   1         - Tad5                                 XZT30058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGCCTGTGCCACAATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAGTCGAGGANATATTATCT
  5   1   1         - Neu       ?                    TNeu071f22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCAGATCTCTCTGAAACCGCAGAACAGTATGAAGGAGAGCATTTAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCT
  5   1   1         - Thy1      in                        CBST1447.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCGATTCGAATTCCAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAAACAGTCGAG
  5   1   1         - Lun1                                CABD14578.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGAACAGTATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAATCAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGA
  5   1   1         - Ovi1      in                         CABI6110.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGAAGGAGAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGA
  5   1   1         - Gas       in                   TGas123b11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCAGCCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAAAGGACGTGCGCCTAGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAAGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCAT
  5   1   1         - Spl1      in                         CABK5421.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAATCCCCAGACTCTTCTTTT
  5   1   1         - Spl1      in                         CABK7082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGATCCAAGCACTCCCATACCAAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGC
  5   1   1         - TbA       in                   TTbA009i23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCACTCCCATACCAAAGAAAGTCAAGAAGATAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATNCACAGCAAGTTTTCTCCATTAAGGAGAGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTG
  5   1   1         - In62                            IMAGE:8952544.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACTTGCTTATTATCAGAAGGATCTCATAAAATTCGAATTCGTCCCGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCTTTTCTCTTGCAACATGTCCAGACTGATGTACATGTGCTAAAAAATATATGAAAAAAACAGTTGAAAAACTGGACTTGGTTGGACCCATAGAAAAGTCCG
  3  -1   1         - Lun1      in                          CABD864.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTATAGGGCGAGAGGCGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGTTA
  3   1   1         - Gas       in                    TGas071m19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCCAGACTGGATGTACAAT
  3   1   1         - Gas       in                    TGas124k09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGT
  5   1   1         - Fat1      in                         CABC1736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGA
  5   1   1         - Spl2      in                        CBSS8067.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAGTCAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGT
  3  -1   1         - Fat1      in                         CABC8196.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGCGAGAGGCGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAANATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCT
  5   1   1         - Gas7      in                         XZG30833.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGA
  5   1   1         - Te1       in                        CBWN13226.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGAACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGGAAATAAATCAAGAAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACGGGCACAGGGAAAACATTTTCCGTTTGCTATCCTTTAGTGGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTTAGAGGACGTGC
  3  -1   1         - Fat1      in                         CABC2232.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAAAACTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATAT
  3  -1   1         - Te4       in                        CAAN10928.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTATATTTTTTAGCCACATTGTACATCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAAAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCCTGTGAGAGATCTTGTCCCAAACTACCGTTTGGACCCTCCTGTTTTAAAGCATGTGGTACTAGACCAAGTTGACCTGATGTTTGATATGGGCTT
  5   1   1         - Brn4      in                        CAAL22015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTAAAAGAGGGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTANCATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAATTGA
  5   1   1         - Int1      in                         CAAP9031.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACGAGGGGAAGATTCAGACCACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAATCCCCAGACTCTTCTTTTCTCTNGCACATGTCCAGACTGGATGTACAATGTGGCT
  3  -1   1         - Int1      in                         CAAP7461.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCAAGGAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGNCACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGNTGAGCATTTGGCCATTGAGTG
  5   1   1         - Egg                            TEgg113k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAATTCACACACCCCGGAAGGGACAGACAAGTCCGAACCACAAATGAACGGCGTAGATAGTGTTACAAAATCTAGAAAGAACGCAACACGCTGATGATAATGAACCAACTCCTAAGAAAACAAAAAAGGATACCATGGAGATCACAGCATCCGAGGAGTGAGAAGAACATCAGTTAACCCAAGAGGAATAGGAAATAAATCAACAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGACCTACCTGCTTCCCAATTCAATCCGGAACATTCCACACTGCTTACAGTGGCCAAGATGTACTGGGCCACGCCCGTACATGCACAGGGAGAACCTTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAAAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCACAGAGTTAGCTATTCAGATCGCAAGTGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCGACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGG
  5   1   1         - Neu       in                   TNeu058j10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGATTCAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGG
  5   1   1         - Spl1      in                         CABK3938.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGATTCAGACCACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGCCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAANANATATATGAAAAAACAGTTTGAAAAATTGACTTGGTTGGACATAGAAGTC
  5   1   1         - Int1      in                        CAAP13816.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATG
  5   1   1         - Liv1      in                         CAAR6666.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGACACACAGGAAGGGACAGACAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGA
  5   1   1         - Int1      in                         CAAP2918.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGNCACATGTCCAGACTGGATGTACAATGTGGCT
  3  -1   1         - Liv1      in                        CAAR12047.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATCCGAACCACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATG
  5   1   1         - Ovi1      in                         CABI2176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTTGAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGC
  3   1   1         - Liv1      in                         CAAR4489.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAAATGAACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCT
  5   1   1       chi Neu       in                   TNeu097h14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTTATTTTATCTATTATAACAACTGCAAACAATTCTCAAACATAAAGTTTAACCAAGACAAAAAATGAAAACGAAAAGGTTTTAATAGCTCAGCTGGACTTTACACTAGTGAAACAACTACACACTGGGCTTTTTATTCTTACAGCAGAGAAGTACTTTATTTTGACTTATCTGTGATAAGAGGACATTGTAACATATTGATTTTTCTTTTCATTACAATATAAATTTTATTAGGAGCTGGTACATTATGGGCGACTCCAGGTACTTAAGGTTGCTTCTGACTCCGCAGCTCTGATGATATGTACAAAATTTGAATTTGTAATGTATATTTTATTTTAAATGTTTTCACTTTTTTCTTTAAGTACTGTGTTAAAAATCAAATTAAACTACTTTCCCCTAGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGT
  5   1   1         - Liv1      in                         CAAR5702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACGGCGTAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTC
  5   1   1         - Tad5      in                          XZT5992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCGTAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCC
  5   1   1         - In62                            IMAGE:8957077.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTTCTTATATATACGTTTTCATTAAATTAAACTTAATTATCCCGATATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAATCCCCAGACTCTTCTTTTCTCTGCACATGTCCAGACTGGATGTACAATGTGCTAAAAAATATATGAAAAACAGTTTGAAAAATTGACTTGTGACTAGAGTCAGATCTGCATCACTGTGACATTGCATGAATGCACAGGTTCCAGAAGCAACGGATCCTGAGATATAGTTTCAAGTTCTACAGTGGTAA
  3   1   1         - Gas       in                    TGas068g15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTGAAAAAAAAAAAAAAAAA
  5   1   1         - Hrt1      in                        CAAQ12033.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCATCGATTCAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAANAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTNGTGAGCATTTGGGCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAATCCATCATCTTTTGTGATCAAAATTAGAGCT
  5   1   1         - Mus1      in                         CABH4434.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAAAAATCTAAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAANAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCANGTCCCAGAAGGCAGC
  5   1   1         - Int1      in                        CAAP12647.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTAAAAGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAANNAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTNGTGAGCATTTGGCCATTGAGTG
  5   1   1         - Fat1      in                         CABC4734.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGAGGAACACAACAGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAANAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGNTGAGCATTTGGCCATTGAGTGCACCAGGTCCC
  3   1   1         - Brn4      in                         CAAL5888.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATG
  5   1   1         - Tail      in                         CBSW3613.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGACACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATACCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTCTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAA
  3   1   1         - Te5       in                         CAAO2500.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACCAGTTTG
  5   1   1         - Gas7      in                         XZG37542.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGCCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAANAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCC
  5   1   1         - Gas7      in                         XZG26962.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAATGAACCAACTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTG
  5   1   1         - Te1       in                         CBWN7517.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACCAACTCCTAAGAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGATATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAANAAATATATGANAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCC
  5   1   1         - Thy1                                CBST3492.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAACTCCTAAGAAAAGAAAAAAGGACACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATACCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTCTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAAGCTGCCATCACTGTTGAG
  5   1   1         - Spl1      in                         CABK2037.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCAC
  5   1   1         - In63                            IMAGE:8959057.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCTAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAATCCCCAGACTCTTCTTTTCTCTGCACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAACAGTTTGAAAAATTGACTTGGTTGGACATAGAAGTCAGACGCTGCCATCACTGTGAGCATTTGACATGATGCACAGTCCCAGAGCACGGTCTGAGATATAGTCAAGTCTACAGTGGTAGTCACGAATCCATCATCTTGGATTCAGTTAGAGCTCACGATAGCCACAAACTGGTGGGACTTCAATTAAACAGGC
  5   1   1         - In63                            IMAGE:8959081.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTAAAGAAAAGAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCACATGTCCAGACTGGATGTACAATGTGGCTAAAAATATATGAAAAACAGTTTGAAAAAATTGACTTGGTTGACATAGAGTCAGCGCTGCATCACTGTTGAGCATTTGTCATGAATGCACCAGTCCAGAGCAGCGTCTGAGATATAAGTCAGTCTACAGTGTAGTCACGAATCATCATCTTTTGTGATCATAGAGCTCACGATTAGCCGACTGGTTCTATAACGCTGCTACATTACTGGGAAACCT
  3   1   1         - Gas       in                    TGas059c10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAAAAAGGATACAATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAAT
  5   1   1         - Int1      in                        CAAP11884.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAANAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCAT
  5   1   1         - Spl2      in                         CBSS509.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAANAAATATATGANAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCANGTCCCA
  5   1   1         - Eye       in                          CCAX595.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCA
  5   1   1         - Te5       in                         CAAO4016.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCANGTCCCAGAAGGCAGCGGTCCTTGNAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAA
  3   1   1         - Te5       in                         CAAO9895.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCACAGCATCCGAGGAGTGTGAAGAAAAGCAGTTAACCAAGAGGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCACCCTGGATGTACAATGTGGCTAAAAAATATATG
  3   1   1         - Lun1      in                         CABD9081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGTGTGAAGAAAAGCAGTTACNCAAAGAGGAAGAGGAAATAAATCAGAAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTAAGGAGTGGTTCCCGTTTTATGTTTTACTTTACTTGATACCAGATAAATCCATACAGAAGGTTTTGCATGTATGCATGTATGCTTAACTCTTAGGTTTTTACTTAGGAACTGTAAGAGGGAGTGGCAAAAGTATGGATTTAGGAAACCTTAGGTATGGGTTTGCACCAGTCTAGAACTTTTATACTGATTGCCCTTGCTAAAAAAGGCCCATAACTATAAATGAGAGATTTCTAAATTTGACCTTTATAATAGCAAGAGGACTATAGCCTAGGGACAGAATGTAGAAACAAGATCTCTTAATGTACAAATGGTGGAGGCAGCTTGTCTCTTGCCCAAAGTGAATTTCTGTTGGGGATAATTGCAGTGGGCCTGATTTTGAACCAAAATAGATATTTTGTTTACTTTGTGAGGGCATAATATTTCCAAATGTTAAAGATGCTAGGAAGCTGGTGTACTACCCAGTTGGCCATCCAAGCCTGTCACTGCCAACATTAATGAGGATACTGTTCAAGCCTATGTCATTGTGAATTTTTATTTTATCTATTATAACAACTGCAAACAATTCTCAAACATAAAGTTAACCAAAAAAAAA
  5  -1   1         - Neu                            TNeu011c19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTGTGAAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTNCTGCAACAATGTNCCAGACTGGAAATGTACAATGTGGC
  5   1   1         - Ovi1      in                         CABI2203.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAAAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCA
  5   1   1         - Te3       in                         CAAM2382.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTCCCGGGATTCGTCGACCCCGCGTCCGAATAAATCAAGACAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCAC
  5   1   1         - Tail      in                        CBSW12178.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAAGCCGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATACCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTCTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCAT
  5   1   1         - Int1                                CAAP10826.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGAGGAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAATTAGAAGCTCACGAATT
  5   1   1         - Tbd1      in                         CBXT2728.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAATAAATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTTCAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATCATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTCTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTG
  5   1   1         - Hrt1      in                         CAAQ7577.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCAAGAAAAAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAG
  5   1   1         - TpA                            TTpA028n18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATAGATGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAATAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTATTGGTCCAAGCCCGTACAGGCACACGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCATATCACAAATGAAATCCGCACCATCACTAAAAAGATGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCTAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAACAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGATGGACATATAAGTCAGAATGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCATGTCCCACAAGGCAACGGTCCTTGTAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCT
  5   1   1         - In63                            IMAGE:8957360.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTAGGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGTTCCCAGAAGCAGCGGTTCCTTGAGATTATAGTTCAGGTCTACAGTGTAGTCACGGAAATCCATCATCTTTTTGGTGATTCAAAATTAGAGCTCACGATTAGCCACAAACTTGTGTCATAAACAGTCTGCACATTACATGGGGAACTTCAGCAAAGGAAAAGGGAAGCATCCTTTGAAGGCTTG
  5   1   1         - Thy1      in                       CBST12504.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAANGCAGCGGTCCT
  5   1   1         - Limb      in                        CBSU9239.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCGACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATACCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTCTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTGTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCANAATTAGAAGCTCACGAATTA
  5   1   1         - TbA       in                   TTbA079p13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGACTTCTCTAAATTTCCAATTTCCAAGGACTTCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTAC
  5   1   1         - Neu       in                   TNeu080k22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTGATATGGGCTTCTCGGAACAAGTC
  5   1   1         - Spl1      in                         CABK5917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCCTCAGCAAAAGGA
  5   1   1         - Int1      in                         CAAP8392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCTCTAAATTTCCAATTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTAAGGAGTGGTTCCCGTTTTATGTTTTACTTTACTTGATACCAGATAAATCCATACAGAAGGTTTTGCATGTATGCATGTATGCTTAACTCTTAGGTTTTTACTTAGGAACTGTAAGAGGGAGTGGCAAAAGTATGGATTTAGGAAACCTTAGGTATGGGTTTGCACCAGTCTAGAACTTTTATACTGATTGCCCTTGCTAAAAAAGGCCCATAACTATAAATGAGAGATTTCTAAATTTGACCTTTATAATAGCAAGAGGACTATAGCCTAGGGACAGAATGTAGAAACAAGATCTCTTAATGTACAAATGGTGGAGGCAGCTTGTCTCTTGCCCAAAGTGAATTTCTGTTGGGGATAATTGCAGTGGGCCTGATTTTGAACCAAAATAGATATTTTGTTTACTTTGTGAGGGCATAATATTTCCAAATGTTAAAGATGCTAGGAAGCTGGTGTACTACCCAGTTGGCCATCCAAGCCTGTCACTGCCAACATTAATGAGGATACTGTTCAAGCCTATGTCATTGTGAATTTTTATTTTATCTATTATAACAACTGCAAACAATTCTCAAACATAAAGTTTAACCCAGACAAAAATGAAAA
  5   1   1       chi Neu0                               IMAGE:6994326                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTCCAAGGACACCATTAAGAATTTGCAAGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAACCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAAAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAACAAACAGTTTGAAGAAATTGACTTGGTTTGGACATTAAAAGTCCAGAAGGCTGCCCCTCACTGGTTGAGCCTTTTTGGCCCTTTTGAATGCAACCAGGGCCCCAAGAAAAGGGCAAGCGGGCCCCTTTGGGAAAATTTAAAATTTCGAGGGGGCCTGCCCGTGTTGGGTAAATCTCCCCCGGGGAAAAAAAACCCCCCTGCCCCCTCCTTTTTTTGGGGGGGGGTTCCCCCAAAAAATTTTTTAAGAAAAACCCCCTCCCCCACGAGAGAAAATT
  5   1   1         - TbA       in                   TTbA011j02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGNAAAGGGAAGTCAT
  5   1   1         - Te1       in                         CBWN6174.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACCATTAAGAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGATATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCC
  5   1   1         - Gas7      in                         XZG64541.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAA
  5   1   1         - Gas7      in                         XZG46645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAACAGTCTGCCAAACCATTACATGG
  3  -1   1         - Lun1      in                         CABD6769.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAAACATTACATGGGGA
  5   1   1         - Gas7      in                         XZG16648.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAGCTAAAGGCGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATAGAAGCTCACGAA
  5   1   1         - In63                            IMAGE:8961190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGCTAAAGGTGTGTCCTACCTGTTCCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAATTAGAAGCTCACGAATTAGCCACAAACTGTGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAATGAAAGGAGTCATCTTGATGCTTCAGCAGATCATTGAGTTCTGTGCGACCATGTACTGCTCGTGATGATATCCCAAGTGACCTGTAGAATGTATCTGCACAGAGGATGCTATGTCTCGGTCAGGCCCAGAACGAACCAGGAATCGCATCATAGACTAAGCTACTCGAATGAGACGAACTCACGTGACCTCTTAGAGTCCACTCTGCTGA
  5   1   1         - TbA       in                   TTbA072p19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGCCCGGGGCCCATTCATCCAAAATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCANAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGC
  5   1   1         - Int1      in                        CAAP12868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGT
  5   1   1         - In66                            IMAGE:8964172.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTATTTTTACTTCCAAATTAAAAATAAAAAAAAACCGGAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAGGTTTCAGCAGGATCATTTGAAGTCTGTGCGACATGTAGCTGCTCGTGATTGATATCCAGAGTGACCTGTAGTATTGTACTCTGCACCAAGAAGCAGATGCTTATGTCATCGTTCAAGGGCGCCACAGGAAAGAGCTGAAACTCAG
  5   1   1         - Lun1      in                         CABD7637.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATTCAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCANAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCCAGC
  3   1   1         - HeRe      in                     EC2CAA10CC12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATCATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTCTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCT
  5   1   1         - HeRe      in                     EC2CAA10CC12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATCCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTAGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATCATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTCTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas7      in                         XZG20380.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGGCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAA
  5   1   1         - Spl2      in                        CBSS5555.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCCGTACAGGCACAGGGAAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATACCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTCTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAANAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCA
  5   1   1         - In62                            IMAGE:8956369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACATATGTTAAAACAAAATTTATCTTTATATAAAAATTCGTCCCGGAGCGGCTTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTTGGCCATTGAGTGCACCAGGTCCCAGAAGCAGCGGTCCTTGGAGATATTAGTTCAGGTCTACAGTGGTAGTCACGGAAAAATCCATCATCTTTTTGTGATTCAAAATTAGAAGCTCACGAATTTAGCCATAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGACCTCCTAGCAAAGGAAAGGGAAGTCATCTTGAAGGTTTCAGCAGGGATCATTTGAAGTTCTGTTGCGACCCAATGTAGCTGCCTCGTGGATTGCATAATTCCCAGAAAGTGGACTCTTCGTA
  5  -1   1         - Ova1      in                         CABE6095.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGTACAGGGAAAACATTTTCCTGTGGTATTCCTTTACCGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCGCCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCT
  5   1   1         - Gas7                                 XZG10338.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACAGGCCAGGGAAAAATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCANAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGNGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTTGAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTTGTGCGACCAATGTAGCTGCTCGTGNNATGNATATCC
  3  -1   1         - Liv1      in                         CAAR9647.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGAAACATTTTCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACCAACAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAGGAAGCAGATGCTTATGTTCATCGNTC
  5   1   1         - Gas7      in                           XZG176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCTTTGCTATTCCTTTAGTGGAGCGGCTTAATGAGGACTTTAGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAAGTCTTTGTGCGACCAATGTAGCTGCTCGTGGATTGGAAT
  5   1   1         - Gas8      in                          st59l20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCGTTGGCTAGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAA
  5   1   1         - TbA                            TTbA015k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGAGGACGTGCGCCTAGGGTGATCCCTTTACTCCCCCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCAGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAACGATGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCATAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTATCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCACAAGTTGACCTTGTAATATTGTACTCTGCACCAAAGGAAGCATATGCTTATGTTCATCGGT
  5   1   1         - Gas8      in                          st60l20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAGGACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATG
  5   1   1         - TbA       in                  TTbA006c21.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACGTGCGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAAAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACA
  3  -1   1         - Liv1      in                         CAAR4494.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCTAGGGTGATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAG
  5   1   1         - Egg                            TEgg120p13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAATTCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCT
  5   1   1         - Egg                            TEgg079k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCA
  5   1   1         - TpA                            TTpA035c08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACC
  5   1   1         - TpA                            TTpA035c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACNATTCAACGTGTTGGAATACCT
  5   1   1         - Te1       in                        CBWN17082.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGATATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCTGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAAT
  5   1   1         - In63                            IMAGE:8959114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCCCACCAGAGAGTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGTTTCAGCAGGATCATTTGAAGTTCTTGTGCGACCAATGTAGCTGCTCGTGGATTGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAGGAGCAGATGCTTATGTTCATCGGTCAGGCGCACAGGAGAGCCGACGCACAGGATCTGCATATCCCTTTATGATCAGAGAGCATTATCTCGATGTGGAGAGGAGACGAATCCATTCACCGTGTGATACTCTAATGGATGTGCAAATCATCAAGTGCTGTAAGTGCCAATATAGG
  5   1   1         - HdA       in                   THdA041e08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGAGTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATG
  5   1   1         - In63                            IMAGE:8960721.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGCTTATTTCAGATCACAAATGAAATCTTGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGCGCACAGGAAGAGCTGGACGCACAGATCTGCATATCCCTTTATGACAGAAGAAAGCATTATCCTCCGATGTGAGAGGAGCACGGAAATCCAATCAACGTTGGAATACTCTTATGGATGTGCCAAATCATCCAATGCTGATGCCAATAAGAGTCCTTTG
  5   1   1         - Abd0      in                       IMAGE:6999977                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTAGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCAAA
  3  -1   1         - Int1      in                         CAAP1669.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCTATTCAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAA
  5   1   1         - Hrt1      in                         CAAQ8032.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTAAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATAT
  5   1   1         - Ova1      in                         CABE6651.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATG
  5   1   1         - Tail      in                         CBSW9521.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATACCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTCTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTGTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCG
  5   1   1         - Spl2      in                        CBSS6436.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACC
  5   1   1         - Ova1      in                         CABE8106.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCCGCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTA
  3  -1   1         - Mus1      in                         CABH6696.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGCATCACTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACAAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTG
  5   1   1         - TbA       in                   TTbA035j17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCA
  5   1   1         - Thy1      in                        CBST1424.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACC
  5   1   1         - Egg                            TEgg090j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAGCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGT
  5   1   1         - AbdN                               IMAGE:7021387                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAAATATAGTTCAGGTCTTCAGTGGTAGTCACGGAAAATCCATCATCATTTGTGAATTCAAATTAGAAGCTCAACAATTAGCCACAAACTGGTGGGTCATTAAAAACAGTCTGCCAAAACCATTATCATGGGGGACCTTCCCAAGCTAAGAGGGAAAGGGGATAGTCCCTCCTTGGAATGGGTTTTTCCAGGGCCGGGTAATCCCTTTTGGCAAGGTTCTCTTCGAGTTTGCCAAAACCCTAATAGTGTAATCCTTGGCTCACGCGTTGAGAAATCTTGAAGAATTAATATCCCCAACAGAAGAAGATTATTGAAACTCTACTTCGAATAGACTATAAATTTGGGTCACACCTGGTTTGAGCATGCCGCAAAGAAGGGGAGACAGTCCGAGAAAATTGGCTCCCTTATTGGAGGGTCTCACGCCCGCTGCTGCACAAGAGGGGGCTGCTCATCTATACGTGTATAAGTGATTCCTCGAGGGAAAGGTCGTACGACGTGGGGAAATTTCTGAGGGCATTAATGTGCCCCTCTTATGAATGTCAAGAATCTCTAGAGTATATACAAAGATGTGCGCTTCTTAATACATATGTCCAGAAAAAAGTGCTTGGTAAACTGGGGTAAAACTGCGCGGGGTACAAATCGGCGCATATAGTGCCAAAGCCGTGAGGTGATGTGAACAAAATATCGCTTCTCACCTGTCTTATGCGGTAAGAGTATGGTCTCCTAATATATCATCTCTCGAA
  5   1   1         - Ovi1      in                        CABI14222.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGAAGGTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAAACCAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTT
  5   1   1         - Spl2      in                        CBSS8379.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCTGTTGTTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTAT
  5   1   1         - Spl1      in                          CABK550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTCTACGGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGGATCACATTCAAACGTGTTGGAATACTTTCCT
  5   1   1         - Tad5      in                         XZT33584.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCNAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATAC
  5   1   1         - Thy1      in                        CBST6135.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGAACTCCATATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGC
  5   1   1         - Eye       in                         CCAX1962.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCAACAGCAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTTATGAACCAAGAGAAAGGCA
  5   1   1         - Liv1      in                         CAAR4284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCCTTATGAATGTTGCCAAATCATCCAGTGCTGATGNCATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAAGATACGCCCCAG
  3  -1   1         - Spl1      in                          CABK544.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGTTTTCTCCATTAAGGAGGGATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTNNATGAT
  5   1   1         - TpA       in                   TTpA019j09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGGGGTTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATACAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCA
  3  -1   1         - Int1      in                         CAAP2763.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGCGAGAGGCTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCANAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGC
  5   1   1         - Int1      in                         CAAP1635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTTGACTTTTTAGTTGGCACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGNAATGTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGATACGCCCAGGAGCTGATTG
  5   1   1         - Int1      ?                          CAAP6083.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCGGCACGAGGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCCTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATANAGTCCTTGGATTCAGTTCCAGCTGATGTGATTG
  5   1   1         - Gas7      in                         XZG58702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACACCTGGCCGTGTGAGAGATCTTGCCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGTTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCACCATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATANAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTG
  5   1   1         - Tbd1      in                         CBXT4449.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCA
  5   1   1         - Thy1      in                        CBST6328.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCTGGCCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTACACCAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACCAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACCATGTGGCT
  5   1   1         - Int1      in                         CAAP9317.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGTGTGAGAGATCTTGTCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTAAAGAATACGCCCAGAGCTGATTG
  5   1   1         - Tad5      in                         XZT66463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGACGCGTGGGCGGACGCGTGGGTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGATACGCCCAGGAGCTGATTG
  5   1   1         - Gas                            TGas083p22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCAAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGA
  5   1   1         - Lun1      in                         CABD4834.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGATTCAATCGGCACGAGGCTCACTGTTTTAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGA
  5   1   1         - Spl1      in                         CABK4955.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAAACTACCGTTTGGACCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTG
  5   1   1         - Gas7                                 XZG11606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAAACTACCGTTTGGACCTCACTGTTTTAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCCTTATGAATGNTGCCAAATCATCCAGTGCTNGATGCATAAAGTCCTTGGATTTCAGTCCAGCTGATGTGATTGAGCA
  5   1   1         - Hrt1      in                         CAAQ8112.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCGGCACGAGGCTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATAC
  3   1   1         - Int1      in                        CAAP11960.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTCACTGTTTTAAAGCATGTGGTACTAGACGAAGTTGACATGATGTNTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATGAGAAGA
  3  -1   1         - Spl1      in                         CABK5696.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGAGAGGCAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAG
  5   1   1         - Spl2      in                        CBSS7247.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGTTTTAAGCATGTGGTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACC
  5   1   1         - Liv1      in                         CAAR9423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTACTAGACGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGAC
  5   1   1         - Neu                            TNeu028n03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         NCGAAGTTGACATGATGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAG
  5   1   1         - Spl2      in                        CBSS5887.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGGTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAG
  5   1   1         - Tad5      in                         XZT71796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTGATATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGTGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTG
  5   1   1         - Gas                            TGas013l23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGATTGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACCGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCANGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAAC
  5   1   1         - Gas7      in                         XZG33779.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCAT
  5   1   1         - Eye       in                         CCAX2217.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCTTCTCGGAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAG
  5   1   1         - Int1      in                          CAAP617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAATTCGGCACGAGGGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTGTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACA
  5   1   1         - Int1      in                         CAAP5790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACACGCTCTTTGCTCACATGGAAG
  5   1   1         - Lun1      in                        CABD12642.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCGATTCAATTCGGCACGAGGCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGT
  5   1   1         - Spl1                                 CABK3594.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAAGTCGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCACATGNAAGCGGGGTATGTGACAATACGTTG
  5   1   1         - Tail      in                        CBSW11909.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGGAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTGTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAG
  5   1   1         - Fat1      in                         CABC6641.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAATATTATCTGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTANACAACGCTCTTTGCTNCACATGGGAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCCAACTTAAGCTATGCATGGCG
  3  -1   1         - Lun1      in                        CABD12361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAAATCACAACTTNAGCTATGCATGGCGATCAATTAA
  5   1   1         - Sto1      in                        CABG11581.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAACAACGCTCTTTGCTCAACATGGAAACGGGGTATGTGAC
  5   1   1         - HdA       in                  THdA026f07.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTGTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCANGTGCAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAAC
  5   1   1         - Eye       in                         CCAX8688.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAG
  5   1   1         - Neu       in                   TNeu099k20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGATCCTGAAGAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTGCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCGTTATCTTCGAATGTGGAGAGGAGCACGGGAATCACATTCAAAC
  5   1   1         - Neu       in                   TNeu090b10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAAATCCCCAGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTGTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATC
  5   1   1         - TpA       in                   TTpA052h04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGACTCTTCTTTTCTCTGCACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTATCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTGTGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGAT
  5   1   1         - Mus1      in                         CABH7504.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACTCTTCTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCNAATTCACAACTTAAGCTATGCATGGCGATCAATAAAGAAC
  5   1   1         - HdA                            THdA042e08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACTCTTCTTTTCGCTGCAACATGTCCAGACTGGATGTAGAATGTGGCTAAAAAATATCTGATACAACACTTTGAATGAATTGATTTGAGTTGGACATAGCAAGTCAGACGGCTGCCATCACTGATTAGCATTTGGCCATTGAGTGATACCAGGTCCC
  5   1   1         - Ski1      in                         CABJ4972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTTCTCTGCAACATGTCCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCA
  5   1   1         - Gas7                                  XZG9079.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGCAGTTAACCAAAGAGGAAGAGGAAATAAATCAAGAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGNGCGACGTCCATTNAACAACGCTCTTTGCTNCACATGNAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAGCTATGCATGGCGATC
  5   1   1         - Tad5                                 XZT54268.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGACTGGATGTACAATGTGGCTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCA
  5   1   1         - Gas7                                 XZG12369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTAAAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTANACAACGCTCTTTGCTCAACATGNAAGCGGGTTATGTGACAATAACGT
  5   1   1         - Thy1      in                        CBST4488.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAATATATGAAAAAACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTANACAACGCTCTTTGCTNCACATGGAAGCC
  5   1   1         - Spl2      in                         CBSS550.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGTTTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGNGCGACGTCCATTANACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAA
  5   1   1       chi Spl1      in                         CABK8793.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGTAAAGCCTAATCCTTTCTATATAGCCTGAAAGTAATTTGTTCTTTATAAGCGTCATGAAATGTTGAAAACCTTCATTTGCATTTACACGTAACAGTCAACAATATTATCAAATGTGGAAAACCACACTTAAATTAGAATTTGCCATAAAACTGCTCACTATAAAAACTCTTCACAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTAATTAATTTTTGCTTTCATTATCTATACAGAATGAACAGAATCCTAGTATATATGCTCTCTGTGTGGTGGGGACAGTTTATCAGCGTTAATATTATAGCGTCATCTCT
  5   1   1         - Limb      in                       CBSU10066.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTGTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGG
  3  -1   1         - Sto1      in                        CABG12032.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGA
  3  -1   1         - Mus1      in                         CABH5913.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCCGTCTGAAACCTGCAGTCAATGCAGGAGGGCT
  5   1   1         - Tad0      in                       IMAGE:6981837                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCANCATGGAAGCGGGGTATGTGANCATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATNCATTTAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTTCTGAAAGGATTCCATGGGTGTGTTTTTTTGGATGTCCGGTTCCTGAAAAACCTGCCAGTCAATGCCAGGAAGGGCTGGGA
  5   1   1       chi Tad5      in                         XZT38558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATTGACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTNCACATGGAAGCGGTATGACAATTATTCACCTTCTGTATTAGACTTTCTTCTAGAATCTGCTAGTGTACACAGCAGCATAAAATGGGATGTAATATTCTGTGCCAGTAACTCGCTGGTGGGCCTGTAGTTTGTGC
  5   1   1         - Gas1                               IMAGE:6990022                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACTTGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAAAACGCTCTTTGCTCAAATGGAAACGGGTTATGTGACA
  5   1   1         - HeRe      in                     EC2CAA42DE03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTGTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACGGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCACACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCAAATGCTGATGCAATAAAG
  5   1   1         - Limb      in                        CBSU2863.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAANATTCATAGA
  5   1   1         - Fat1      in                         CABC5617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTNCATGC
  5   1   1         - Spl1      in                         CABK2186.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCACTGTTGAGCATTTGGCCATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACTGCAGT
  5   1   1         - Te5       in                         CAAO5109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTTGAGTGTACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCANATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCCTGAGGATTCCATGNGTGT
  5   1   1         - Brn4      in                        CAAL23044.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAGGCGGTGGCAGTTTACAGTTGCAACT
  5   1   1         - Panc      in                        CBTA4255.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGAGTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAATGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTG
  5   1   1         - Thy1      in                         CBST885.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCANATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAANNGATCCATGNGTGTGTGTTTTGATGTCCGTTCTGAAACCTGCAGTCAATGCAGGA
  5   1   1         - Neu5      in                         ANHP2097.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCANATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAANATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAA
  5   1   1         - TbA                            TTbA033a06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACCAGGTCCCAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGGTGTGTGNTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCANGAGGGCTGGAAAGATACAANGCGGTGGCAGTTTACAGTTGCAACTGAATTACCCGCGATTCAAGAATCTGAGAGAAACTTTGA
  5   1   1         - Spl1      in                         CABK8498.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAGGCAGCGGTCCTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATAC
  5   1   1         - BrSp      in                    EC0CBA005DE08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCAGCGGTCCTTGGAGATATAGTTCAGGTGTACAGTGGTAGTCACGGAAAATCCATCATCCTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTGGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTAATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACCGCCCAGAGCTGATTGAGAAGAAAGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAA
  5   1   1         - Mus1      in                        CABH12282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCGATTCGTTGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGNGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAATTACCCGCGATTNCAGAATCTGAGAGAAACTTTGATGGT
  5   1   1         - Ovi1      in                         CABI6979.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGAGGGAGATATAGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAATTACCCGCGATTCAAGAATCTG
  5   1   1         - Tad0                               IMAGE:6985168                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAATTCCGGGATGTTCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAAATTAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAAGATCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACTGCAGTCAATGCAGGAG
  5   1   1         - Spl2      in                        CBSS5988.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGAGGTCAGTTGTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTACA
  3  -1   1         - Int1      in                         CAAP6030.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGNGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAAATTACCCGCGATTTCAGAATCTGAGAGAAACTTTGAT
  3  -1   1         - Mus1      in                         CABH6947.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGGTCTACAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAATTACCCCGCGATCAGAATCTG
  5   1   1         - TbA       in                   TTbA041a06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGTGGTAGTCACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAATTACCCCCGCGATCAGAATCTG
  5   1   1         - Int1      in                         CAAP3336.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATCGATTCGGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTTGCACTGAATTTACCCACGATTCAGGAATCTGAGAGAA
  5   1   1         - Int1      in                         CAAP3144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATCGATTCGGGAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTTGCACTGAATTACCCACGATTCAAGAATCTGAGAGAAACTTTGATGGTCCAAGGATGGAGGTTTT
  5   1   1         - Tail      in                         CBSW1838.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACGGAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCT
  5   1   1         - Lun1      in                        CABD12128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAATTACCCGCGATTTCAGAATCTG
  5   1   1         - Ova1      in                         CABE4069.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACCCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGCAGCACGCGAATCACATTC
  5   1   1         - Tad5      in                         XZT49572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAATCCATCATCTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAAATACCCGCGNATCAAGAATCTG
  5   1   1         - Tbd1      in                         CBXT8754.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGAGCGTGGGTTTTGTGATTCAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCAACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGT
  5   1   1         - Liv1      in                         CAAR2017.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATCATCTTTTGTGATTCAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAATTACCCGCGATTCAAGAATCTGAGAGAAACTTTGATGGTCCAAGGAATGGAGGTTTTGG
  5   1   1         - Gas7      in                         XZG63112.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAAATACCCGCGATTCAAGAATCTGAGAGAAACTTTGATGGGTCAAGGAATGGAGGTT
  5   1   1         - Tail      in                          CBSW780.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAAGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAA
  5   1   1         - Te1       in                         CBWN2196.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATTAGAAGCTCACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGA
  5   1   1         - Liv1      in                         CAAR7916.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATATTGATTCTAAAATTCATAGAATGTGTCTCCTGAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAAACCTGCAGTCAATGCAGGAGGGCTGGAAAGATACAAGGCGGTGGCAGTTTACAGTTGCAACTGAATTACCCG
  5   1   1         - Kid1      in                         CABA4835.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACGAATTAGCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGACCTCCAGCAAAAGGAAAGGGAAGTCATCTTGAAGGGTTTCAGGCAGGGATCATTTGAAGTTCTTGTTGCGACCAATGTAGCTGCTCGTGGATTGGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGGCGCACAGGAAGAGCCGGACGCACAGGAATCTGCATATCCCTTTATGAACCAAGAGAAAGGCATTATCTTCGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATTCAGTTCCAGCTGATGTGATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCATATTTCTGGGGCGACGTCCATTAAACAACGCTCTTTGCTCAACATGGAAGCGGGTTATGTGACAATAACGTTGAAGAGCTCAGTGCAAATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGA