Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT58562.3                         1702 END     2           0        0                40S ribosomal protein S6 [Xenopus tropicalis]
     2   1.0    0Xt7.1-TTbA078h22.3                        267 END     2           0        0                Hypothetical protein MGC76252 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012070008 Xt7.1-TTpA019a06.3 - 459 ESTs
                                                                       ...-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA019a06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221312                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCTCGGGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         4     8    11    14    51    56    84    88    94    97    99   101   104   106   112   114   114   117   118   120   125   130   129   132   133   137   135   141   138   141   138   142   138   144   138   144   138   144   143   146   143   147   145   147   145   150   151   154   154   157   156   158   155   158   158   160   158   160   158   160   160   161   161   163   160   165   163   166   162   166   164   167   163   168   167   168   167   168   168   169   164   168   165   168   166   168   168   170   169   172   170   172   166   171   166   170   165   173   171   174   167   174   169   174   169   174   168   175   166   172   166   174   159   174   163   171   155   169   160   171   155   167   155   166   153   165   150   161   149   161   140   160   145   157   138   153   127   145   126   144   125   141   120   139   119   134   110   125    95   106    91   101    86   100    87    99    79    92    85    92    83    91    85    91    86    89    86    88    88    91    90    95    91    97    87    94    91   100    94   101    95   104    95   104   108   118   106   120   110   121   129   143   134   145   132   148   137   149   150   163   156   170   154   171   169   183   173   187   180   199   189   206   204   222   216   231   215   234   218   238   220   239   221   238   229   243   228   244   220   243   226   246   228   247   231   246   225   245   219   243   230   243   222   242   224   242   220   237   220   236   222   237   224   235   224   234   219   232   217   232   221   233   205   229   217   228   209   227   210   226   217   227   211   223   212   223   212   222   211   221   196   220   200   219   207   219   206   218   204   216   206   215   192   215   203   215   199   213   197   209   195   207   193   205   179   202   182   197   185   196   184   193   184   193   182   194   172   192   165   180   162   178   154   175   151   172    74    97    50    57    10    12
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------T--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    T-----------
                                               BLH ATG     108    3582                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH MIN     108     328                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH OVR     108      95                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               CDS MIN     108      42                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               EST CLI      20      42                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               ORF LNG     108      12                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                                       PROTEIN --- Ci ---- 1e-009     FAA00211.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Sc ==== 5e-170     NP_010474.1 cytoplasmic chaperonin of the Cct ring complex (previously called TCP1 or TRiC),distantly related to Tcp1p and to Hsp60; Cct6p [Saccharomyces cerevisiae] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Ce ==== 0          NP_741153.1 chaperonin Containing TCP-1 (58.9 kD) (cct-6) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 0          XP_782717.2 PREDICTED: similar to chaperonin containing TCP1, subunit 6A isoform 2 [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dm ==== 0          NP_573066.1 CG8231-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_033968.1 chaperonin subunit 6a (zeta); chaperonin containing TCP-1 [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_001753.1 chaperonin containing TCP1, subunit 6A (zeta 1); chaperonin containing T-complexsubunit 6 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 0          NP_001006216.1 similar to chaperonin containing TCP1, subunit 6A (zeta 1); chaperonin containing T-complex subunit 6 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 0          NP_958447.1 chaperonin containing TCP1, subunit 6A (zeta 1) [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 0          AAH74165.1 MGC81949 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === ?? ==== 0          NP_001086080.1 MGC81949 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Xt ==== 0          AAH67921.1 Hypothetical protein MGC69492 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA019a06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGA---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------ATG---------------TGA---TAG---------------------ATG------------------------------------------------------------TGA---------------------TAA------------------TAA---------------TGA---------ATG------------------------------------ATG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   1           Tbd0 FL                     IMAGE:5336310.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCTATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg042n23.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FLt5                   TGas136k19.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAA
  5   1   2       chi Ski1 5g3  in                         CABJ9805.5p                                                                                                                                                                                                                                                                                                                                                                                            GGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCANAGGTCANAGCACTTGAAGTTTTGGAGCAAGTAAAGTG
  5   1   2       bld In60 5g                         IMAGE:8950961.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCATCCCTTAACATGTATTTATTCTCTTTAAAATTTCGTCCCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAGATGCTTTTTATCTCACTTGCAATGTGTCTCTGGATATGAAAAACAGAGTGATCTGGTTCTTCTACAAAGTGCAGATGACGTGAAAACTGCTAAGCAGAAAAGGTAATGGAGAGAGGGGTGAATAAATCATAAGTCCTAAGGCAGAAAAAA
  5   1   2       bld In63 5g                         IMAGE:8962146.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTATTTTTTTTTGCAAGTTCCCTTTTCATTCAAAATCGTCCCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAACACAAAACAGAAGTGATACTACGCTGATAGGAGGGCTTGTCTTGATCATGGAGCTCGTCATCCAGATATGAGAGCGTGTGAGATGCTTTTATCCTCACTTGCATGTGTCTCTGATATGAAAAACGAGGTGATTCTGGCTTCTTTCTACAAAGTGCAGATGAACGGTGAAAAACCTGCTTTAGC
  5   1   2       bld 1030 5g                         IMAGE:7093506.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGGAATGCCGGCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTACCCGACTTTTTACTGAAGCTGTTGTGGATTCTGTTTTGGTTTTCGACAACAAATGAGCTTTTGATTTAACATGGGTGAATTTTG
  5   1   2       bld HeRe 5g3  in                      EC2BAA1CC02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATG
  5   1   2       bld HeRe 5g3  in                      EC2CAA1CC02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAATGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGGATTTATACATGGTTGAAATTATGGAGATGA
  3  -1   2       bld Tail      in                         CBSW7345.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTCTCGGGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTG
  5   1   2   12  bld Tad5 5g3  in                         XZT65127.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGNATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTNGCATGTGTCTCTGGGATATGAAAAAACAGAGGTGAATTCTG
  5   1   2       bld Egg  5g3  in                   TEgg071m11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTCTTCTCGGGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAA
  5   1   2   14  bld Gas6 5g3  in                         ANBT1369.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCGGGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGGTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAAC
  5   1   2       bld Tbd0 5g3  in                       IMAGE:6977920                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCGGGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAAACACAAAACAGAAAGTGATACTACGCTGATAAAAGGGCTTGTCTTGGATCATGGAAGCTCGTCATCCAGATATGAAAGAAACGTGTTGAAGATGCTTTTTATCCTCACCTTGCAATGTGGTCTCTGGAAATTTGAAAAAAACAGAGGGTG
  5   1   2       bld TbA  5g3  in                   TTbA031g22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGGGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGANACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAG
  5   1   2   10  bld Tbd1 5g3  in                        CBXT13822.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTC
  5   1   2   12  bld Tad5 5g3  in                         XZT56528.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTTTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGGTGAAGATGCTTTTATCCT
  5   1   2       bld TbA  5g3  in                   TTbA010g05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAATAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAGATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGATGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGC
  5   1   2   22  bld Tad5 5g                              XZT21763.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGANACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTTGCATGTGTCTCTGGGATATGANAAAACAGAGGT
  5   1   2       bld Egg  5g                        TEgg127p13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTT
  5   1   2       bld TpA  5g3  in                   TTpA076i12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCGGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCTAAGCCCTCTATCCGATAGCCGAGGTAGCCCGAGCCCGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAGGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCTAGCTTACGGAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAGAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCGCATCATATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCGGATCTCTACGTCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCGGAGAAATGGACAGGGAGACTCTGATTAATGTGGCGAGGACTTCACTTCGCGCCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTGTGGCTAGTCTACAACCAAATGAGCCTATTGATT
  5   1   2       bld Gas1 5g3  in                     NISC_mq20c06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATG
  5   1   2   12  bld Gas7 5g3  in                         XZG54946.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGNCATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAAAC
  5   1   2       bld TpA  5g   ?                    TTpA006o21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGANAAAACAGAGGTGAATTCTGGGGTTCTCTACAAAGTGCAGATGAACGTGAAAAACT
  5   1   2       bld Neu0 5g                            IMAGE:6991862                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGGATATGAAAAAACAGAAGTGAATTCTGGGGTCTTCTACAAAAGTGCAGATGAAACGTGAAAACTGGTTAAAGCAGAAGAGAAAGTTTATTGGAAGAAAGGGTGAATAA
  5   1   2       bld TpA  5g                        TTpA042p10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGANANAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAG
  5   1   2   10  bld Spl2 5g3  in                        CBSS1228.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAG
  5   1   2       bld Egg0      in                         dad68f06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTGGTGGGGTTACCTGGGNACCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCGGGGGGCCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAACCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGCAGAACTGCTGAAACAAGCAAATCTCTACATCTCAGAGGGTCTGCACCCCAAA
  5   1   2       bld TbA  5g3  in                   TTbA072l04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGANAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTG
  5   1   2       chi Tbd0 5x                            IMAGE:6980973                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTTGAGGTTTTGAAGCAAGTTAAAGGTGTCCAANGAATGGGACAGGGAAATCTGAATTATGGTGGCAGGAATTCCCTTCCCACCAGGGTTCTGCTGAATAACCAAAATTTTAACCAAACCGTTTGGAAATCGGTTTGGGCTTTCACAACCAAAGAGGCCTTGGGTTTAACGGGGGAAAATTTGGGAGAAACCCCAACAAAATGGGTTCCCCG
  5   1   2   12  bld Gas7 5g3  in                         XZG38451.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGANATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGANAAAACAGAGGTGAATTCTGG
  5   1   2   12  bld Gas7 5g3  in                         XZG40567.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATC
  5   1   2   22  bld Tad5 5g                              XZT20670.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTTGCATGTGTCTCTGGAATATGANAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGGAAAAACTGGTTAAAGC
  5   1   2   22  bld Tad5 5g                              XZT25412.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTNGTGAAGATGCTTTTATCCTCACTTTGCATGTGTCTCTGGAATATG
  5   1   2   10  bld Thy1 5g3  in                        CBST4707.fwd .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGNCATGTGTC
  5   1   2   10  bld Tbd1 5g3  in                          CBXT610.b1 .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTC
  5   1   2       bld Tbd0 FL   in                    IMAGE:5336310.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCA
  5   1   2       bld Gas  5g                        TGas025o02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACA
  5   1   2       bld TpA  5g                        TTpA046c20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTNGGGTCTTCTACAAAAGTGCAGATGAAACGTGAAAACTGGTTAAAGC
  5   1   2       bld TpA  5g3  in                   TTpA076b08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGGTTCTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGC
  5   1   2       bld TbA  5g3  in                   TTbA001n16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATG
  5   1   2       bld TbA  5g3  in                   TTbA068c14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACTAAAGTGCAGATGAACGTGAAAAACTGGTTAAAG
  5   1   2       bld HdA  5g                       THdA035b04.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAAATCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAA
  5   1   2       bld HdA  5g3  in                   THdA053e07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGC
  5   1   2   14  bld Te5  5g3  in                        CAAO11380.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGGTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGNCATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGG
  5   1   2       bld TpA  5g                        TTpA040i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGGGAAGCCTGGGAGCCGNCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGC
  5   1   2       bld In63 5g                         IMAGE:8960185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGGGAAGCCTTGGGAGCCGCTAGCTTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGGTTGAAATTATGGGAGATGAAACACAAAACAGAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGATCATGGAGCTCGTCATCAGATATGAGAAGCGTGTGAGATGCTTATCTTCACTTGCATGTGTCTCTGATATGAAAACGAGGTGATCTGGATCTCTCAAGGCAATGACCGTGAACTGGTAAGCAAGAAGTTATTGAAAAGGGTGATAA
  5   1   2       bld Neu  5g                        TNeu018e04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTGTGAAGCAGCAAAGGTCAA
  5   1   2       bld TpA  5g                        TTpA020n18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAGTGCAGATGAAACGTGAAAACTGGTTAAAGC
  5   1   2       bld TpA  5x3  out                  TTpA032j05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGGTGAAGATGCTTTTATCCTCACTTTGCATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCT
  5   1   2       bld HdA  5g3  in                   THdA008k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGT
  5   1   2       bld HdA  5g                        THdA045b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTG
  5   1   2       bld Egg  5g3  in                   TEgg036m22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAA
  5   1   2       bld TpA  5g                        TTpA009d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGGAAGCCTGGGAGCCGCTAGCTGTTTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCT
  5   1   2       bld TpA  5g3  in                   TTpA050h01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTATTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACACAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCTATGTGTCTCTGGAATAT
  5   1   2       bld HdA  5g                       THdA028f16.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTT
  5   1   2       bld HdA  5g                        THdA032k05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAAAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTC
  5   1   2   14  bld Te5  5g3  in                          CAAO628.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTG
  5   1   2       chi 1030 5x                         IMAGE:7093951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGAAGGACTCACTTTGCCCAGGTTCTGCTGATTACCGACTTTTACTGAGCTGTTGTGATCTGTTTGGTATCGACACAATGAGCTATGATTATCTGGTGAATATGAGAGAACCAACAGAATGATCTCCTATAAGCTGCTGACTGACTCCTCGATGAGACGTGAAGTTACTCTGATGCTGAAGAACAGATCGTTCAAGCAGAGACGTACAATTGAAGACTCACAGGA
  5   1   2   10  bld Thy1 5g3  in                        CBST3939.fwd ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTT
  5   1   2   10  bld Thy1 5g3  in                        CBST9664.fwd ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCCAATGAGCCCTATGATTTATACATGGGTT
  5   1   2   10  bld Tbd1 5g3  in                        CBXT10690.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCT
  5   1   2   10  bld Tbd1 5g3  in                        CBXT17341.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGAT
  5   1   2   10  bld Eye  5g3  in                         CCAX1047.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATA
  5   1   2   20  bld Eye  5g                              CCAX3428.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAAACACAAAACAGAAAGTGATACTAC
  5   1   2       bld Gas  5g3  in                   TGas074f13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTG
  5   1   2       bld Gas  5g3  in                   TGas121b22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGA
  5   1   2       bld TpA  5g                        TTpA005h03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGT
  5   1   2       bld TpA  5g3  in                   TTpA006m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACA
  5   1   2       bld AbdN 5g                            IMAGE:7004025                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGGATATGAAAAAAACAGAGGTGAATTCTGGGGTTTCTTTCTACAAAAGTGCAGAATGAACGTTGAAAAACCTGGGTTAAAGCCAAAGAAGGAAGGTTAATTGNAAGAAAAAGGGTGGAATAAAAATCACTAGCCCCCA
  5   1   2       bld TpA  5g3  in                   TTpA033l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGC
  5   1   2       bld HdA  5g                        THdA021c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACT
  5   1   2   14  bld Gas6 5g3  in                          ANBT703.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTTTCTGGAAATATGAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGAT
  5   1   2       bld Gas8 5g3  in                         st103c06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGA
  5   1   2   10  bld Spl2 5g3  in                        CBSS2291.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAA
  5   1   2       bld TpA  5g3  in                   TTpA007h14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGACGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGC
  5   1   2       bld Gas  5g                        TGas018k19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACA
  5   1   2       bld TpA  5g                        TTpA078h09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGGTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAAC
  5   1   2       bld TbA  5g3  in                   TTbA050d23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCAT
  5   1   2       bld HdA  5g3  in                   THdA020o05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGCCTGGGAGCCGCTAGCTGATTCATTGTTTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTAC
  5   1   2       bld Gas8 5g3  in                          st85n20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAA
  5   1   2       bld Gas1 5g3  in                       IMAGE:6990607                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGTCTGGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGGTGAAGATGCTTNNTATCTCACTTTGCATGTGTCTCTGGATATGAAAAACAGAAGTGAATCTGGGNNTCTCTACAAGTGCAGATGACGTGA
  5   1   2       bld TpA  5g3  in                   TTpA016f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGANAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGC
  5   1   2   34  bld Te5  5x3  out                       CAAO11733.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTG
  5   1   2       bld TbA  5g3  in                   TTbA061g11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAAGCTGTG
  5   1   2       bld Gas8 5g3  in                          st15g13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCC
  5   1   2   22  bld Tad5 5g                              XZT34564.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGGTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGGATATGAAAAAACAGAAGT
  5   1   2       bld Tbd0 5g                            IMAGE:6980767                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGGTGAAGAATGCTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAACAGANGTGATN
  5   1   2   10  bld Spl1 5g3  in                         CABK2436.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCA
  5   1   2       bld Gas8 5g3  in                          st93e11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAA
  5   1   2       bld TbA  5g3  in                   TTbA016l12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGA
  5   1   2       bld TpA  5g3  in                   TTpA026o23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGCCGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGC
  5   1   2       bld In62 5g                         IMAGE:8955178.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCCGCTAAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAGAGGGCTTGTCTTGATCATGGAGCTCGTCATCCAGATATGAGAAGCGTGTTGAGATGCTTTTATCCTCACTTGCATGTGTCTCTGGATATGAAAAAGAGGTGAATTCTGGGTCTCTACAAAGTGCAGATGACGTGAAAACTGTAGCAAAGAAAGTTATGAAAGAGGGTGATAATCATAGCCTAAGCGAAATGTGTGGAGACGCAGTCATGGGATAATCAGGATCTGGACATCTGATGCTGGCAAAGATGGACTCAGCAGAAATGGAAATGACTGCTGGGTCCATCTAGAATCTGGTATACTCCACTGTAGCTA
  5   1   2       bld In62 5g                         IMAGE:8954471.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTTAAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAACAGAAGTGATACTACGCTGATAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCATGTGTTCTTCTGGAATATGAAAAACAGAGGTGATTCTGGGTTCTTCTACAAAGTGCAGATGACGTGAAACTTGTTAGCAAAGAAGTTATGAAGAAAGGGTGATAATCTTAGCCTAAGCGAATTGTTGGAAACGGCAAGGTTCATTGGTAAATCAAGCTTGACACTTCTTGAATCCTGTCA
  5   1   2       bld Egg  FL   in                   TEgg042n23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCTAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTA
  5   1   2       bld Gas  5g   ?                    TGas058b19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAA
  5   1   2       bld Gas8 5g3  in                          st99a20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGCTGATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACAATTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTG
  5   1   2       bld TbA  5g3  in                   TTbA030d13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGATTCATTGTCTCATTTGCTTCGGATTCTCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAAACGTGAAAACTGGTTAAAGC
  5   1   2       bld TbA  5g3  in                   TTbA030d15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACTGTGAAAACTGGTTAAAGC
  5   1   2       bld TbA  5g3  in                   TTbA030j13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGATTCATTGTCTCATTTGCTTCGGATCCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAGACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTTGCATGTGTCTCTGGAATATG
  5   1   2       bld Gas8 5g3  in                           st2c23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATTCATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGAT
  5   1   2   10  bld Mus1 5g3  in                         CABH7651.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATTGTCTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGNCATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCA
  5   1   2   10  bld Ova1 5g3  in                        CABE12363.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGANAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGA
  5   1   2   10  bld Sto1 5g3  in                         CABG9473.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCCCTTGCAATGTGTCTCTGGAATATG
  5   1   2       bld Brn1 5g3  in                          CABL692.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCGAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAANAACAGAGGTGAATTCTGGGTTCTTC
  5   1   2   10  bld Limb 5g3  in                        CBSU8332.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTTGCTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCATTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAA
  5   1   2       bld HdA  5g3  in                   THdA024c03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATCCCGGGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGC
  5   1   2   10  bld Hrt1 5g3  in                         CAAQ3063.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCGGATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAG
  5   1   2   10  bld Liv1 5g3  in                        CAAR11925.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGGTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTT
  5   1   2       bld HdA  5g                        THdA004b05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTCGCTTCCCGAGCCGGTCTCTACCCCCGTCTCTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTG
  5   1   2       bld HdA  5g3  in                  THdA036l19.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGCTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAGAGGGTGAAATAAATCATAGCCCTAAAGC
  5   1   2       bld Neu0 5g3  in                       IMAGE:6991834                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTTGAAGAAAGGGGTGAATAAAATCATAGCCCTAAAGCAGAAAAATGTGTGGGAGATAACGGGCAAAGGTTTCATTGT
  5   1   2       bld TbA  5g3  in                   TTbA003k09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGA
  5   1   2   10  bld Int1 5g3  in                         CAAP6254.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGC
  5   1   2   12  bld Tad5 5g3  in                         XZT38872.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAA
  5   1   2   10  bld Int1 5g3  in                         CAAP9300.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCGAGCCGGTCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTG
  5   1   2       bld TpA  5g3  in                   TTpA011p23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCGGCCTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCATTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAANGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCACCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAACGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGT
  3  -1   2       bld Int1      in                         CAAP9976.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCGAGAGGCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGGCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCA
  5   1   2   10  bld Tbd1 5g3  in                        CBXT20472.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATG
  5   1   2       bld Gas  5x3  out                 TGas090k18.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACCCCCGTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATA
  5   1   2   12  bld Tad5 5g3  in                         XZT28877.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGGTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAA
  5   1   2       bld Gas  5g                        TGas014n17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCACTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCAT
  5   1   2       bld TbA  5g3  in                   TTbA010n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCTATGGCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCA
  5   1   2       bld HdA       in                   THdA005c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTG
  5   1   2       bld Eye       in                         CCAX6395.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTG
  5   1   2       bld Tbd0                               IMAGE:6977089                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAAATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGGAATTCTGGGTTTCTTCTACAAAAGTGCAGAATGAACGTGAAAAAATGGTTAAAGCAAAGAAAAAAGTTTATTGAAAAAAAGGGGGAAATAAAACCTTAGCCCCTAAAAGCAGAAAAATGTGTGGAAAATACCGGGCAAAAGGTTT
  5   1   2       bld TbA       in                   TTbA014e11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAGCAGAAAATGTGTGG
  5   1   2       bld TbA       in                   TTbA014g24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTCTCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAAATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAAGCAAAAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCC
  5   1   2       bld Te5                                  CAAO5518.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCAGTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAAC
  5   1   2       chi Abd0                               IMAGE:7017288                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAAGCAATTGAATCCTAAAGCCGAAGTTGCCAGAGCAGCCCAAGCTCTCGGAATAAATATATCGGCAGCTAAAGGTCTTCAAGATGTTCTCAGATCGAATCTCGGTCCTAAAGGAACAATGAAGATGCTTGTTTCAGGAGCTGGTGACATCAAATTGACAAAAGATGGAAATGTTCTGTTACATGAAATGCAAATTCAGCATCCAACGGCGTCTTTAATAGCCAAAGTTGCGACAGCTCAAGATGACATCACAGGCGATGGCACTACATCCAACTGTCTCATCATCGGTGAACTACTCAAGCAGGCAGATCGGTACATTTCCGAGGGATTGCATCCACGTCTGGTGGCCGAGGGATTTGATCTGGCCAAGGTTAAAGCTCTAGAAATCCTTGAAGAGCTGAAGGTGGTGAGAGATATCGACCGTGATATACTGATCAACGTCTCTCGAACATCACTCCGTACAAAAGTCCATCCGGAATTGGCAGATCTCCTCACCGAGCATGTCGTGGACGCGGTCCTGGCGATCCGACAGAAGGACGCTCCTATTGATCTGCACATGGTTGAAATAATGGAAATGCAACACAAGACGGACATGGACACTAATCTCATCCGGGGAATTGTAATGGACCACGGTGGCCGACATCCGGATATGCCGAAGCGTCTGGAGAATGCTTGGATCCTCACTCTNCATG
  5   1   2       bld Tbd1      in                        CBXT16494.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGA
  5   1   2       bld Ovi1      in                        CABI12216.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCA
  5   1   2       bld TpA                            TTpA020j21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAAGCCCTCAATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCA
  5   1   2       bld Gas7      in                         XZG19336.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAAATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAAATATGAAAAACAGAAGTGAATT
  5   1   2       bld Eye       in                         CCAX8882.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGA
  5   1   2       bld Spl2      in                        CBSS2733.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGAC
  5   1   2       bld Eye       out                        CCAX5089.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTTATC
  5   1   2       bld HdA                            THdA011p07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGCCGAGGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGG
  5   1   2       bld HdA       in                   THdA032d16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGGTAGCCCGAGCCCAGGCGGGCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCATAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGAGGGCAATGTCTTGCTTCGTGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCGCCTCAAATGTTCTGATCATTGGAGAGCTGCTGAAACAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAACAAAGGTCAAAGCACTTGAAGTTTTGGAG
  5   1   2       bld Ova1      in                         CABE8711.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTAGCCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATG
  5   1   2       bld TbA                            TTbA045k16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCCCGAGCCCACGCGGCCCTGGCTGTGAACATCAATGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAGCCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCACGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCGACATCCAACAGCCTCGCTGATTGCTAAAGTATCCACAACACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCATAATAGTGACTGAAGGTTTTGAAGCATCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATAT
  5   1   2       bld TbA       in                   TTbA040j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTAGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAANATGTGTGGAGATACCGGCAAAGGTTTCATTGTGA
  5   1   2       bld TbA       in                   TTbA040j21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGAGCCCGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTCGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTG
  5   1   2       bld Egg0      in                         dad63f04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGCCCAGGCGGCCCTGGCTGTGAACATCAGTGCGGCAAGGGGGCTCCAGGACGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGA
  5   1   2       bld HdA       in                  THdA036l14.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGCGGCAAGGGGGCTCCATGACGTGCTCGCGGACCAACCTCAGGCCTAAGAGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAGATTCAAGCATCACGCGTCCTAGGTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCA
  5   1   2       bld TpA       ?                    TTpA011a14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACGCGGGGGCTCCAGGACGTGCTCCGGACCAACGCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGATCATGCTGAATTATCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCCTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAATGAGAGGGTGAATAAAATCA
  5   1   2       bld Ovi1      in                        CABI10030.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCGGCACGAGGGTGCTCCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAANATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATC
  5   1   2       bld Ova1      in                         CABE1837.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTTGCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTT
  3  -1   2       bld Spl1      in                         CABK6133.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCCTACAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCA
  5   1   2       bld Eye       in                         CCAX8779.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATA
  5   1   2       bld Ova1      in                        CABE13221.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCANAGAGAAGAAATATGGAGAGATTGACTTTGGCTT
  5   1   2       bld Ova1      in                         CABE4716.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCANAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCANAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAAATGCTAGGACATGCTGGTCTTGTCTATGAATACACACTGG
  5   1   2       bld Ova1      in                         CABE7219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCNAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGGTGATG
  5   1   2       bld HdA       ?                   THdA025m03.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCAACCTTACCAAAGATGGCCATGTCTTGTTTCATGATATGCGGATTCGACATGCAACTGCCTCTCTGATTGCTAAAGTAGCCACGGCACAAAATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAATCAAGCAGATCTCTACATCTCAAAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAGATTATGGAGATGACACACAANACAGAAAGTGATACTACGCTGATA
  5   1   2       bld Ova1      in                         CABE3265.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAAGCAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTANGACATGCTGGTCTTGTCTATGAATACACACTGGGGGGA
  5   1   2       bld Gas7      in                          XZG7237.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTANGAGCAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGAC
  5   1   2       bld Ova1      in                        CABE10860.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCANAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACC
  5   1   2       bld TbA                            TTbA074m13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGGCCCGGGGGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTANGACATGCTGGTCTTGTCTATGAATACA
  5   1   2       bld Ova1      in                         CABE4875.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGNCTAGGACATGCTGGTCTTGTCTAT
  5   1   2       bld Eye       in                         CCAX2948.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAAATGGAACCACATCCCATGTTCTGATCATTGAAGAGCTGCTGAAGCAAGCAGATCTCTACCTCTCAGAGGGTCTGCTCCCCAGAATAGTGACTGA
  5   1   2       bld Gas7                                 XZG21998.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTT
  5   1   2       bld Tbd1      in                         CBXT9963.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTA
  5   1   2       bld Bone      in                        CBTC7214.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCAACAGCCTCGCTGATTGCTAAAGTAGCCACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAG
  5   1   2       bld Gas7                                  XZG9990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACT
  5   1   2       bld TpA       out                  TTpA025h19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGAGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCT
  5   1   2       bld Te4       in                         CAAN4028.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCANAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCC
  5   1   2       bld TpA       in                   TTpA034h10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGATGGAACCACATCAAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATC
  5   1   2       bld Ovi1      in                        CABI13859.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATCGATTCGCAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGA
  5   1   2       bld Mus1                                 CABH4991.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATGTTCTGATCATTGGAGAGCTGCTGAAGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAG
  5   1   2       bld Thy1      in                       CBST12016.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCAAGCAGATCTCTACATCTCAGAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGA
  5   1   2       bld TpA       in                   TTpA066n22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCTACATCTCATAGGGTCTGCACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAAGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCGCACCTGAATGCTTATGACATGCTGGTCTTGTCTATGAATACACACTGGTGGGAAGACCAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATC
  5   1   2       bld Ova1      ?                         CABE13502.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACCCCAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAAATCAAGGGCCAAATAAGCACACAATAA
  5   1   2       bld Tad5                                 XZT62291.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGNGGGA
  5   1   2       bld HdA                            THdA019e19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACTGAAGGTTTTGAAGCAGCAAAGGTCAAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTG
  5   1   2       bld TpA                            TTpA035d16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCAAAGGTCAAGCACTTGAAGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAG
  5   1   2       bld Ova1      in                          CABE698.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGAGGGTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGAATGTTCAGTGGTTCCAGGCGCANGGG
  5   1   2       bld Abd0                               IMAGE:7017616                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTTTGGAGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGNNGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCT
  5   1   2       bld HdA                            THdA033a12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTGGAGCAAGTAACACTGTCCGTAGTACTGGAGAGGGAGACTCTGATTAATATGGCAAGGACTTAACTTCACACCGAGGTTCATGCTGAATTAGTCAACATTTTAACTGAAGCTGTTGTGGACTCTGTTATGGCTATTGAACAATCCAGTGAGCCTATTGATTTATACATGGTGGAAATTATGGATATGAAACACAAGGCAGAGGGTGATACTACCCTGATAAGAAGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAATCGTGTTGAATATGCTTCTATCCTCACTTGCAATGTGTCTCTGGAATATGCAAACACAGAGGTGAATTCTGGGTTCT
  5   1   2       bld Gas1      in                     NISC_mq09a03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAG
  5   1   2       bld Egg       in                   TEgg044j16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAGTAAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATAC
  5   1   2       bld HdA       in                  THdA029j20.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAAGTGTCCAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACANCTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAANGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGNCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAAGCACAGCCTAATGT
  5   1   2       bld Lun1      in                         CABD3735.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAGAAATGGACAGGGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTANAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAAGCTTTTGCTGATG
  5   1   2       bld Brn4      ?                         CAAL10149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGACTCTGATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCTATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAAATGCATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGGAGTAGCAATCGCTGATGCTCTTGTGAAAGCACAGCCTAATGTAAAAGGA
  5   1   2       bld Gas                            TGas004c13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGACTTCACTTCGCACCAAGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTANGACATGCTGGTCTTGTCTATGAATACACAC
  5   1   2       bld Ova1      in                         CABE6310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTTGGTGTCAGGCTTTTGCTGATGCACTTCTCATCATTCC
  5   1   2       bld Gas0      in                         dad25c10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCACTTCGCACCAAGCTCTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAAT
  5   1   2       bld Ova1      in                         CABE9677.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCACTTCGCACCAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCC
  5   1   2       bld Tad5      in                         XZT27197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGGTTCATGCTGAATTAGCCGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCTATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAAATGTAAAGGACGTGCCCCAACTTGGTGTC
  5   1   2       bld Te1       ?                          CBWN2881.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGACATTTTAACTGAAGCTGTTGTGGATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGG
  5   1   2       bld TbA       in                   TTbA058k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTTGTGCCATTCTGTTTTGGCTATTCAACAACCAAATGAGCCTATTGATTTATACATGGTTGACATTATGGAGATGAAACACCAACCACAAAGTGATACTACGCTGATAAAAGGGCTTGTCTTGCATCATGGAGCTCGTCATCCACATATGAAGAAGCGTGTTAAAAATGCTTTTATCCTCACTTGCAATGTGTCTCTGAAGTATGAAAACACACAGGTGAATTCTGGGTTCTTCTACCTAAATGCAGATGAACGTGAACAACTGGTTAAAGCAAATACAAAGTTTATTGAATAAATGGTGAATAAAATCATAGCCCTAAAGCACAAAATGTGTGGAGATACCGCCTAAGGCTTCATTGTGATATGTCACACTGGTATTGACCCATTTTCCTTGGATGCCCTT
  5   1   2       bld Ski1      in                         CABJ3245.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTCTGTTTTGGCTATTCGACAACCAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGC
  5   1   2       bld TbA       in                   TTbA024p05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACAAATGAGCCTATTGATTTATACATGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCA
  5   1   2       bld HdA       ?                   THdA028e20.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGCCGCGCCTATTGATTTATACATGGCTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACTGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAGCCAGCTCNATTGGTGTTGATTTAAACACTGGTGAAACTATGATTTCATCT
  5   1   2       bld HdA       in                  THdA029i06.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCAATGAGCCTATTGATTTATACATGGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCA
  5   1   2       bld Spl2      in                        CBSS3993.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGATTTATACATGGCTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAAGCACAGCCTAATGGTAAAGGACGTGCCCAACTTGGTGTTCANGCTTTTGCTGATGCACTTCTCATCAT
  5   1   2       bld TpA       in                   TTpA066e14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTTATACATGGTTGAAATNTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCNCAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCA
  5   1   2       bld TbA                            TTbA025b03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTATACATGGGTTGAAATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCANGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCANAACTCTGGTTATGACCCCCA
  5   1   2       bld Gas                            TGas001g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTTATACTGGTTGAAATTATGGAGATGAAACACAAAACANAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAACAGAAAAGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAAGACATGCTGGTCTTGTCTATGAATACACACTGGGG
  5   1   2       bld Te5                                 CAAO10378.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGTCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCTATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCAAGGTGCTTGCCCAAACTCTGGTTATGACCC
  5   1   2       bld Tbd1      in                        CBXT14740.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAG
  5   1   2       bld Gas7      in                         XZG34123.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCC
  5   1   2       bld Ova1      in                         CABE4475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGA
  5   1   2       bld Gas       in                   TGas125j07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAAGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATG
  5   1   2       bld Eye       in                         CCAX6410.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGC
  5   1   2       bld TpA       in                   TTpA058b14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAAAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGANGCANGAATTTGGGANTACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTAC
  5   1   2       bld Tad5      in                          XZT4449.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGTGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCA
  5   1   2       bld Gas                            TGas043k18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATACTACGCTGATAANAGGCTTGTCTTGNGATCTGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGNNTCTCTGGAATATTGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAACAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTC
  5   1   2       bld TpA       in                   TTpA019a06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGATACTACGCTGATAAGAGGGCTTGTCTTGGATCATGGAGCTCGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCANGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACT
  5   1   2       bld HdA       out                  THdA001m03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTTGTCTTGGATATGGAGCTCGTCATCCATATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCTATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAAGCGCACGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAAGCTTTTGCTGATGCACTTCTCATCATTCCCCAGGTGCTTGCCCAAAACTCTGGTTATGACCC
  5   1   2       bld Eye       in                         CCAX9290.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTCATCCAGATATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAA
  5   1   2       bld Tbd1                                 CBXT3892.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGAAGCGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATTGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGT
  5   1   2       bld Te5       in                        CAAO12838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGTGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTTAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGANTACTACAGTGTTAAGAAGCAGCTGCTTCATT
  5   1   2       bld Tad5                                 XZT39246.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATT
  5   1   2       chi Hrt1      in                         CAAQ8331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTAGTTATAACCAATGAAAGTAATGTAGTTGGCAGTAGAGGTTCTTGTTTGCCATGCCTGCCTTTGAAACAATAATTGGCTGGTCTTTTTTAGCAGGCCAATAAGCTTACTCCCAAAAACATTAACAGGTGAGCCAAGTCTAAAGCAGGAAAGCGATTTAGATG
  5   1   2       bld HdA       out                  THdA050i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGACAAACTGGTTAAAGCAGAGAGAAAGTTTA
  5   1   2       bld HdA       in                   THdA006n01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTCTCTGGAATATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGA
  5   1   2       bld HeRe                              EC2CAA2CH06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAAAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAACCACAAGCC
  5   1   2       bld Gas7      in                         XZG59246.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCT
  5   1   2       bld Tad5      in                         XZT53104.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATG
  5   1   2       bld Tad5      in                         XZT61237.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAAAAACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTA
  5   1   2       bld Tad5      in                         XZT10074.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACAGAGGTGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATG
  5   1   2       bld Gas                            TGas016c07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAATTCTGGGTTCTTCTACAAAAGTGCAGNATGAACCGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCANGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAACACTGGTGAACC
  5   1   2       bld HdA                           THdA009o03.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAATTCTGGGTTCTTCTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGTCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTG
  5   1   2       bld Egg                            TEgg092f05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGTTCTTCTACAAAAGTGCACGATGAACGTCGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTCGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCTATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAAGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATG
  5   1   2       bld Ovi1      in                         CABI6007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTACAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAAAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGGATGTCTTCTCTG
  5   1   2       bld Ova1      ?                          CABE8917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAAGTGCAGATGAACGTGAAAAACTGGTTAAAGCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCCTGTGGTGGATGAGATTATGAGAGCGGGAATGTC
  5   1   2       bld Int1      in                          CAAP594.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATATTTGTGTATGTTTGCGTTTTGCTAATTAGCTGACCACGTGGGGTGAATAGTGCCATACCTGACATAGCACAAACTGCTGGATATTTATGCAGTTTGATCATACAGGTAGATGGCAAAATTGTACTGAACTAACAGATTGGCCTACTGCCTCAATTGTAGGTCAGCAACCCCATATGCTCCCAGATTTTTAGTCATTATTTACCTTTTCCTTTGTTGCTGATCAGCAGAAAATCAGCAGATCTCATCTGTGAAATATTGTTACATGTGACAAACATTAGAGAACTTGTTCACTGTGCCGTTACATGTTATTCCTTCTCTCTTTTCTGTTTTAATGTTCTCATCAATTCTGACACTTTTTGCATTTATAGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGGTAATCACGTTACCAATGCATTTCTTGATATTTGAGTTTCACTTGATACACACATGATAGAACATGCTTTTATATGCTTATCTTTTCCCCAATATTATATAAGCAACATATTGACTAATGCATTTTTAAAGTTAAAGTTGTATATTTTACCTTTGCATAGCAAGTATATGCATTCTAAAATTTCCACTTATTTGATGACACATCATAAAAAGGAAAATCTAGCACCACTACTTATTTTCCAATTAACTGGTTATTTTTGTGAAATTGGTGCTCATGCTAAATCTTTCCTATGCTTTTATTTTTTAGTACTGTGATTGCAAGCAATATCCTGTTGNTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGATATAGCCTTGTTGTGACACT
  5   1   2       bld Tbd1                                CBXT13718.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGAGAGAAAGTTTATTGAAGAGAGGGTGAATAAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCT
  5   1   2       bld TbA       in                   TTbA044o22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCGGGTGAATAAGATCTTAGCCCTAAAGCAAAAGATGTGTGGAGATACCGGCCAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAAACAATATATATGGAGAGATTGACTTTGGCTTGTGGTGGCAGTGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACCCAATGGGGGAAGAACAATTCACTTTTATATAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAACCACACGATAACACAAATTAAAGATGCCATAATGGATGGACTTCGTGCTGTAAAGAATGCAATTGAATATTGTTCACTGGTTCCAGGCGCAGGGGCACTGGAAGTAACAATCGCTGATGCTCGTGTGAAGCACAAGCCTAATGTAAGAGGACGTGCCCAACTTGGTGTTCGAGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCACGAGACACTTGT
  5   1   2       bld TpA                            TTpA058m04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAATCATAGCCCTAAAGCAGAAAATGTGCTGTAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCTATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCACGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCGTTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCAGCTGAGGCATGAATTTGGG
  5   1   2       bld Te3       in                         CAAM9111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCTATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTAC
  5   1   2       bld Neu  5x3  out                  TNeu120m23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATCATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGACTACTGGAGTAGCAATCGCTGATGCT
  3   1   2       bld TpA       in                   TTpA066e14.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATAGCCCTAAAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA034h10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE4716.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCAGAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCT
  5   1   2       chi Thy1      in                       CBST12232.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAATGTGTGGAGATACCGGCAAAGGTTTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGANAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGA
  5   1   2       bld TpA       in                   TTpA074j13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGGAGATACCGGCAAAGGTTTCAATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGACAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATG
  3  -1   2       bld Ovi1      in                         CABI2091.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGANAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACG
  5   1   2       bld TpA       in                   TTpA066l02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGTGATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGANAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAAGTTATTCANATCTGANATTATTTGCGCTTTGCTCCCACTGATTTGCT
  5   1   2       bld Int1      in                        CAAP14353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAAATCAAAAGGGTATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGANAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCNAATCTGAAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACT
  5   1   2       bld Tbd1      in                        CBXT11211.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATT
  5   1   2       bld Brn4      in                        CAAL20832.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCTATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCCAATCTGAAATTATTTGCGCTTT
  5   1   0       add Neu       ?                    TNeu117a18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGCCTTTGAAACAATAATTGGCTGGTCTTTTTTAGCAGGCCAATAAGCTTACTCCCCAAAACAATTAACAGGTGAGCCAAGTCTAAAGCAGGAAAGCGATTTAGATGCAAGGTACCTTGCTGTTTTTGCCATGTCTCCAATTCCTGCCTAGTTCCAGTATAGTGTCATGGCCAGTTTGCAAACCAATCTTTCCTACAATCTCCTTTCCAAGATAAGTCTTCATGTTGATTTGTCATTCTAATTTGATTTGTCATTCTGTATGCCAAACAAAATCTGTTTTACCACCATTTATCAGCATTGTACAATAGCATCTCTGCATGCAGACTTCACTTCACTGTAGGAGTACCCAGAAGAGCAAATAATTCCTTACTGCCATTCAGGAAAAGGGTGGGAGAGACCCAGAGAGCTCATTCATTTTTACTTAATCTGGTTTTTCTCTACAATATAAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTGAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACT
  3   1   2       bld Int1      in                          CAAP594.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTACTGAACTAACAGATTGGCCTACTGCCTCAATGTAGGGTCAGCAACCCCATATGCTCCCAGATTTTTAGTCATTATTTACCTTTTCCTTTGTTGCTGATCAGCAGAAAATCAGCAGATCTCATCTGTGAAATATTGTTACATGTGACAAACATTAGAGAACTTGTTCACTGTGCCGTTACATGTTATTCCTTCTCTCTTTTCTGTTTTAATGTTCTCATCAATTCTGACACTTTTTGCATTTATAGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGGTAATCACGTTACCAATGCATTTCTTGATATTTGAGTTTCACTTGATACACACATGATAGAACATGCTTTTATATGCTTATCTTTTCCCCAATATTATATAAGCAACATATTGACTAATGCATTTTTAAAGTTAAAGTTGTATATTTTACCTTTGCATAGCAAGTATATGCATTCTAAAATTTCCACTTATTTGATGACACATCATAAAAAGGAAAATCTAGCACCACTACTTATTTTCCAATTAACTGGTTATTTTTGTGAAATTGGTGCTCATGCTAAATCTTTCCTATGCTTTTATTTTTTAGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTAT
  5   1   2       bld Bone                                CBTC1815.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTA
  3   1   2       chi Tbd0 5g3  in                       IMAGE:6977920                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTTCTCTTAGTGGCCCCGCGGGGGAAAAAAATATATTGGGGGAGGGTTTCTCTTTTTGGGCGGGGGGGGGGCCCAACCCCACAAATATTTTGGGGGAGCCCCCCTCCCCCCCCAAAATTCTTTAGGGCCCTGGTGGTTTTGTTTAAGGAATACCCCATTGGGGAAGGAAAAAATCAATTTTTATGAACCAGGTGGGAAACCCACGGTTCTGGGACGCTATTATCAAAGGGCCAAATTAGCCCCCAATACCCAAATTTAAAGATGCCATAGGGGATGGACTTCGTGCTGTAAAGAATGCAATGAAGATTGTTCAGTGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTGTA
  5   1   2       bld Tad5                                 XZT24401.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGANAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAAC
  5   1   2       bld Te5       in                        CAAO11000.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGANAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATCAAATCTGAAATATTTGCGCTTTGCTCCACTGATTTGCTGAAGTTAC
  5   1   2       bld Tbd1      in                         CBXT4719.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATTGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTG
  3   1   2       bld Neu0 5g3  in                       IMAGE:6991834                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAAGGAAATTGTGGCACTTCGTAGAGCAAAAGAGAAGAAATATGGAGAGATTTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCNTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCNGAACCCCAT
  5   1   2       chi Tad0                               IMAGE:6983139                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAATAAATATGGCAGAGATTGACTTTCGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTTGGGGGAATAAAAATTCACTTTCATATAACACTGTGCCAACCCACGGTCTGCGACTCCATTAATCCCACGGCCAAATATGCACACAACAACCTCAATTATCCATGCCTACCTGCATTGCCCCCTCTGCCGTGAATCCCGCTATTGAACATTGTTCCACGGTTCCCTCCAGCACCGATCTCTTTATGTTCCAATCGCCCCATGTTCTCGACAACTACATCCCACCACCTTCCTCTATTTCCCTCATCTCAATTATTCCACGTCTCCTCCCACTTATCACTCCTCCCACTACTTTCCTCTATTATTCACTCCCTATCGTACCCTTTACTTCTCCCCACTTTGTTACTCACCTCTTTACCTACCCTTCAGAACTTCCATCTATTTCACCCCCACTCCCTCAATCTACCTGTCACTTCGCACTCCCCTATAAAACCCCTTCCTCCCACTCACTACTTTCTTGCACCCCACATCCTCTATCATCTCTCCTTCCTCTTCTCCCCTCTCTCCTCTTCCTTCTCCTCATCTAATACCTCTACCCCCTCCTCTTCCTCCCACTCCTCTTCTCTCTCCCTCTTCCTCTTTCCTTTCACACTTCTTCTTAAACTCTCCCCCTCCCTCTCTCCTACCTCCCTTCCCCCTCCCC
  5   1   2       bld HeRe      in                     EC2CAA21BF01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAACACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCT
  3   1   2       bld Egg       in                    TEgg044j16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg036m22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCNTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAA
  3   1   2      seed TpA       in                    TTpA019a06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                   TGas121b22.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTTCTTTGTACATAATATAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA                             TTbA014j19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGCAAAGAGAAGAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAA
  5   1   2       bld HdA                            THdA001n03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAGAGAAGAAATATGGACAGATTGATTTTGGCTTGTGGTGGCTATGCTATGAATTCTGTGCGAGGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAAT
  5   1   2       bld Gas                            TGas141o24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAGAGAAGAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATT
  5   1   2       bld Tbd1      in                        CBXT12924.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAATATGGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAA
  3   1   2       bld Lun1      in                         CABD3735.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACNTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAA
  3   1   2       bld Int1 5g3  in                         CAAP9300.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGATTGACTTGGGCTTGTGGTGGCAATGCCATGAATTCTGTGGGTGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTT
  5  -1   2       bld Int1      in                         CAAP9976.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAA
  3   1   2       bld Ova1      in                         CABE6310.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGATTGACTTTGGCTGTGGGTGGCAATGCCATGAATTCTGTGGATGACTTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  5   1   2       bld Liv1      in                        CAAR11527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACA
  3   1   2       bld Ovi1      in                        CABI13859.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACNCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAACCTCTCGCCCTAT
  5   1   2       bld Gas  FLt5 in                   TGas136k19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATCCCCGGCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACTGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCA
  5   1   2       bld Tbd1      in                          CBXT786.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTGAAATCTGAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTT
  3   1   2       bld TbA  5g3  in                    TTbA016l12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA  5g3  in                    THdA024c03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATGCCATGAATTCTGTGGATGACCTCACACCCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTGCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAGCGC
  3   1   2       bld Ova1      in                         CABE3265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Ski1      in                         CABJ3245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACNCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAGAAA
  3   1   2       bld HdA  5g3  in                   THdA008k06.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Ovi1      in                         CABI6007.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld TbA       in                    TTbA014e11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Ova1 5g3  in                        CABE12363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTGTCNTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Liv1      in                        CAAR11527.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAG
  3   1   2       bld HeRe 5g3  in                      EC2CAA1CC02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTGAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACA
  3   1   2       bld Gas8 5g3  in                          st85n20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATGAATTCTGTGGATGACCTCACACCTGAATGCNTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTGCTCCCACTGATTGC
  5   1   2       bld TpA                            TTpA002j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAAACACACTGGGGGAAGAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAACCTTGTTGTGACCCTTTTCTTATGATTCAGTTAGGAAGTTTAATTCAAATCTGAAATTATTTTGCGCTTTGCT
  3   1   2       bld Ova1      in                         CABE4875.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGAATTCTGTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Ova1      in                         CABE4475.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Gas8 5g3  in                          st15g13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTGGATGCCTCACCCTGAATGCTTANGACATGCTGGTCTNGTCTATGAATACACACTGGGAGAAGAAAAATTCACCTTTATAGAACAGTGTGAGAACCCACGGTCTGTGGCGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTAC
  3   1   2       bld Int1 5g3  in                         CAAP6254.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACNCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Ova1      in                        CABE10860.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGACCTCACACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Ova1      in                         CABE7219.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATGACCTCAACCTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Ovi1      in                        CABI12216.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGACCTCACACCTGAATGCTTAGAACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Ova1      in                          CABE698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGAACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAAAAAGCTCTTC
  3   1   2       bld Thy1 5g3  in                        CBST3939.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATTTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCT
  3   1   2       bld Gas  FLt5 in                    TGas136k19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas1 5g3  in                       IMAGE:6990607                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAATGCTAGGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAGAAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTGACAAATAAA
  3   1   2       bld TpA  5g3  in                    TTpA033l16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA                             TTpA041a24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA                             TTbA075a06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Egg  FL   in                    TEgg042n23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                   TTpA066l02.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA014g24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA050d23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld HdA       in                    THdA006n01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld HdA  5g3  in                   THdA036l19.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAATAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Brn1 5g3  in                          CABL692.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACNCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAACCTCTCGCCCTATAGGAG
  3   1   2       bld Gas       in                    TGas125j07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA001n16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAG
  3   1   2       bld TbA  5g3  in                    TTbA072l04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTTTCAAAAAAAAAAAAAAAAA
  5  -1   2       bld HdA       out                  THdA044o06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACNTTTGCTCTTCAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE1837.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTTAGGACATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  5   1   2       bld Tad0      in                       IMAGE:6983019                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGGACATGCTGGTCTTGTCTATGAATACACACTGGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCANTTAGGAAGTTTATTCCAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTATAAACTTTCTGTAAATCTTCTCCCACACCTGCCAACGATAGTAAAATTTGAAACTTCTATGTTTACATCATTTTTCTCTTTAAGGCACGCAAGTCCAGCCCACCT
  3   1   2       bld Tad0      in                       IMAGE:6983019                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACNCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACACAANCCCCTCTTTCTTGGTTTTTTTTCTCTGTTGTGCTTTTTTTTGTTTGTTTTTCTTCTTTTCTTCTTTTCTTTCCTTCCTCTTT
  3   1   2       bld Ova1      in                        CABE13221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Sto1 5g3  in                         CABG9473.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG38451.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACATGCTGGTCTTGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAGG
  3   1   2       chi Brn2      ?                         CAAJ17960.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGGAGGTTCAGaatttcaggaggtccatctcccagagactctattagaagctaataattctaagttttaaaacttatttccttttctctgcattaataaaacagtacattgtactttattctaactaacatataattaatcctattggatttatgcttaaattatttttttgtaaacttaaggtatggagatccaaattaaagaaagaccccttatctggaaaacaGGTGCCATACCTGTACATGTACTTACAATCCTATATAATACCCCTTGATTTAATTCTACATGAACATTAAACACACCATCAGGTAACATCATTTTAAACATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Gas7      in                         XZG59246.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG34123.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTTTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Te5  5g3  in                          CAAO628.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTATGAATACACACTGGGAGAGAAAAATTCACTTTTATAGAACAGTGTGAGAACNCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCT
  3   1   2       bld Ski1 5g3  in                         CABJ9805.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld Liv1 5g3  in                        CAAR11925.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCACTG
  3   1   2       bld TpA  5g3  in                    TTpA050h01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA       out                   THdA049g09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTTTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Spl2 5g3  in                        CBSS1228.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGAATACACACTGGGAGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTC
  3   1   2       bld HeRe      in                     EC2CAA21BF01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAACACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCT
  3   1   2       bld TbA       in                    TTbA040j19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGATTCAAGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCTATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAGCTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCGGGAATGTCTTCTCTGAAAGGATGAATATAGCCTTGTTGTGACACTTTTCTTATGATTCAGTTAGGAAGTTTATTCAAATCTGAAATTATTTGCGCTTTGCTCCCACTGATTTGCTGAAGTTACTTAATAAACTTTCTGTAAAATCTACTCCCACAGCTGTAAAACGATAGCAAATATTGAAAACTTTCAATGTTTAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCCTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAAAGCGC
  3   1   2       bld Te4       in                         CAAN4028.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGGTCTGTGACGCTATTAATCAAAGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCCATAAGGGATGGACTTCGTGCTGTAAAGAATGCAATTGAAGATTGTTCAGTGGTTCCAGGCGCAGGGGCACTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCTAATGTAAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTTCTCATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACACTTGTAAAACTTCAGACAGAATATGCAGA