Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 98%

 1012070027 Xt7.1-XZT61077.3 - 755 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3    23    25    31    31    39    40    42    43    45    45    46    46    49    49    51    51    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    52    53    53    54    53    54    53    54    53    54    53    54    54    54    55    55    56    56    56    56    56    56    56    56    56    56    56    56    56    56    56    56    55    56    55    56    55    56    55    56    54    55    54    55    55    56    55    56    55    56    55    56    56    57    57    58    56    58    56    58    57    59    57    59    57    59    56    59    57    59    57    59    56    59    55    57    53    56    54    56    54    56    52    55    48    50    42    44    31    38    32    37    31    35    17    18    16    18    15    17    12    14    11    14    11    12    10    11    10    11    10    11    10    11    10    11    10    11     9    10     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    11    11    12    12    11    11    10    10     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     8     8     8     8     7     7     7     7     7     7     8     8     8     8     9    10     8     9     8     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    12    13    12    13    12    13    12    13    13    14    14    14    14    14    14    14    14    14    14    14    13    13    14    14    14    14    14    14    14    14    15    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    16    16    15    15    15    15    15    15    15    15    15    15    13    13    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    14    14    15    15    15    15    15    15    15    17    17    17    17    17    17    19    19    19    19    19    19    21    21    20    21    20    20    19    19    21    21    21    21    21    21    21    21    21    21    20    21    20    21    20    21    20    21    19    20    20    21    20    20    20    20    21    21    20    21    22    22    23    23    23    23    23    23    22    23    22    23    22    23    21    23    23    25    23    25    22    24    22    24    22    24    22    24    24    25    23    24    23    24    23    24    23    24    24    25    24    25    24    25    25    26    25    26    24    25    24    25    24    25    24    25    24    25    23    24    22    23    22    24    22    24    22    24    22    24    21    23    21    23    22    23    22    23    22    22    22    22    23    23    21    22    20    20    18    19    19    19    19    19    20    20    20    20    20    20    20    20    20    20    19    19    19    19    20    20    21    21    20    20    18    18    18    18    18    18    18    18    19    19    19    19    19    19    20    20    19    19    18    18    19    19    19    20    20    20    18    18    19    19    19    19    18    19    18    19    19    19    19    19    19    19    19    19    17    18    17    18    17    17    18    18    17    18    18    19    19    21    19    21    20    22    21    22    21    22    21    22    22    23    21    21    21    21    22    22    22    22    22    22    22    22    21    21    19    20    20    21    21    22    21    22    22    23    22    23    21    22    21    22    21    23    21    23    21    24    22    25    22    25    22    25    22    25    22    25    23    26    21    24    20    22    20    22    20    24    20    24    21    25    21    25    20    24    18    23    19    23    19    23    19    23    21    24    21    24    21    24    21    24    21    24    23    26    22    26    22    26    23    26    23    26    21    23    21    23    21    23    21    24    20    23    21    23    19    21    20    21    20    21    22    23    22    23    24    26    24    26    24    26    22    25    24    25    24    24    24    24    25    25    26    26    26    26    25    26    25    26    25    26    25    26    25    27    25    27    25    27    25    26    25    26    26    27    27    28    25    28    27    29    28    30    28    30    26    30    26    30    25    29    25    29    24    28    24    27    24    27    24    27    23    26    24    28    23    27    23    27    24    28    24    29    22    29    24    29    26    31    26    31    26    31    26    31    24    31    26    32    26    32    27    33    27    33    29    35    30    37    30    37    29    36    26    33    34    35    26    35    28    37    27    36    27    36    26    36    27    37    28    38    30    40    30    40    31    41    32    41    32    41    40    40    30    40    30    41    33    41    34    41    35    41    35    44    36    45    36    44    37    44    34    42    34    41    33    39    33    39    33    40    34    41    34    42    34    41    33    40    35    44    36    45    36    46    39    48    39    48    39    48    39    48    35    43    36    45    36    48    38    51    39    54    38    55    39    57    39    57    40    57    40    58    41    58    42    60    43    61    43    63    46    68    46    70    45    73    45    74    45    77    44    76    43    76    43    78    44    80    41    81    42    80    42    85    42    85    42    84    42    84    42    84    42    84    42    83    43    81    43    81    44    81    44    81    44    79    46    82    46    82    46    82    47    83    47    82    48    82    49    81    60    81    61    82    59    80    59    79    59    79    59    80    61    82    62    87    68    90    67    91    68    90    69    89    69    88    70    89    69    90    68    91    69    91    71    91    62    85    62    86    62    85    63    87    64    87    64    87    65    87    64    88    66    88    69    89    69    89    72    90    74    92    76    91    75    91    77    92    76    91    77    91    74    89    77    89    78    89    74    83    75    83    75    84    78    86    78    86    74    84    75    84    81    90    80    92    81    93    77    91    79    92    80    92    83    96    84    98    87   100    89   102    94   111    96   116    98   118    98   120   137   164   154   183   156   190   164   199   171   207   194   220   208   236   223   254   272   296   270   304   281   305   280   306   286   312   288   316   344   379   349   388   353   392   358   396   355   398   364   405   362   405   365   405   366   409   371   413   373   415   375   419   371   418   363   418   371   419   373   418   358   411   360   410   388   412   390   412   387   414   392   413   382   412   383   410   388   409   388   410   388   411   383   409   387   409   392   409   373   408   388   410   378   409   388   409   362   408   371   408   383   405   386   403   380   402   381   399   368   396   375   391   368   387   367   381   362   379   367   377   354   376   358   374   361   371   355   367   355   363   350   357   170   351   179   349   172   344   171   340   169   328    87   177    50    60    15    17     5     8     3     6     3     5     3     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGGTGTTGATTCCATTAGACTGGCTTGGGAGGTCCCAGATGGGCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGTTACCTACTCAAGTCCTGAGGAGGGAGTAAAAGAGTTGTTCCCAGCTCCAGAAGGGGATGATGACACAGCAGAATTGCACGGTCTGAGGCCGGGCACAGAATACACTGTGAGCATCGTGGCATTGCACGATGACATGGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGGAATCCAGAGCACAGCAATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCTCCCACGCCTCCAAGCAGGAACCACAGAGTCTACCATTACCAACCTGGAGCCAGGCACAGAATATATTGTCTATATTATTGCTGTGAGAAACAATCAGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTGCCTCGCCTGGTTACACTTCCACACCCGGGCAAAGGCCCTGAAATCCTTGATGTTCCCACTGATGAAGAGAACACACCCCACATCACACAAATCAAGTTGGACAATGGTAATGGTATCCAACTGCCAGGCTCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGCAGCCACCTCGTGCTCGCATCACTGGCTATATCATTCGTTATGAGAAAGCTGGAGGGCTACTGAAAGAGCACCTCCCACGCCTCCAAGCAGGAACCACAGAGTCTACCATTACCAACCTGGAGCCAGGCACAGAATATATTGTCTATATTATTGCTGTGAGAAACAATCAGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTGCCTCGCCTGGTTACACTTCCACACCCGGGCAAAGGCCCTGAAATCCTTGATGTTCCCACTGATGAAGAGAACACACCCCACATCACACAAATCAAGTTGGACAATGGTAATGGTATCCAACTGCCAGGCTCTAATGGACAGCAGCCCAGTTCTGGCAATGAAGGGCAGCTTATAGAAGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTGCCAGTGAGGCCAGGGAAATTCACCCCTGGGCACTACCCACAGGAGAGGGTTGATATTGAGCTAGACACAGAGTTCCCTGTGCAGCGTGGAGATCTTGATGGTCCT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------C-C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------GA--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AC----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----C--C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                               BLH ATG     195    1852                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     195     234                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     195      66                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       5      69                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     195      49                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sc ---- 8e-010     NP_014050.1 Hypothetical ORF; Ymr317wp [Saccharomyces cerevisiae] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 8e-035     NP_001022640.1 LEThal family member (let-805) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 3e-042     NP_996413.1 CG1817-PD, isoform D [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 5e-067     XP_001180548.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dr ---- 0          NP_001013279.1 fibronectin 1b [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Mm ---- 0          NP_034363.1 fibronectin 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Gg ---- 0          XP_421868.2 PREDICTED: similar to fibronectin 1 isoform 1 preproprotein [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 0          AAH72841.1 Fibronectin protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === ?? ==== 0          NP_001081270.1 fibronectin protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 0          AAH95906.1 Fibronectin 1 [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 0          NP_997639.1 fibronectin 1 isoform 6 preproprotein [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT61077.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGA------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------TGA------------------TAA---------------TGA---------------------------------------TGA---------------------------------------------------TAG---------ATG---------TAA------TAG---------------------------------------------------------------TAA------------------------------------ATG---------TAA------------TGA------------------------------------------------------------------TGA---------------------------------------ATG------------------------------------ATG---------------------------------------------------TGA------------------------------------------------ATG---------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   1       chi Te3       in                         CAAM4074.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATATACTGCGCTGCCGGACTCCTGCCTCTGTCTTAGCGAAGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTGTAAGTGACCTACAGTTTTAGAGAAAAATGTCAGAGACACACAACTACTGTATGTAACAGAATAAAGCAATGTTCTGAATCATATAGTTTTGTGGGTATAATGCCTCCCGATGGAAATCAATGATCCTTTACACGTATCCACAGCTACAATGTTATTTCTTTTTCTCGCACAGCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAAGGAGTCAGTCTTATAAGATT
  5   1   1   14    - Brn2 5g3  in                        CAAJ11332.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCGAAGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGG
  5   1   1   14    - Te3  5g3  in                         CAAM8925.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCGAAGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGC
  5   1   1       chi Neu0 FL                            IMAGE:6996086                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCACAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGACCGACCTAAGGATAACATGATCTGGGACTGGTCGTGTATTGTAGCTGGAATGGGACCCATTACCTGTAAAATTGGCAATCCGATGCCATTAAGGAGGGCAGTCCTATAAAATTGGGGGACACCCTGGGGCCAGGCCCACACTGAAAACTGGGGGGGGTATTATGGCCAACAAGTGTGTTCTGCCCTTGGGAAAATTGGGTAAAGGGAATAAATGGAACCTTGTCTATACCCCCTCTTTGTTGGAGAATTATGCCTCTCGAATTAATTACCCGGCTGGGGGATATTCCATAATGTTTAACTGGGTTCGTTACCTTCGGGGCAAAAAAGCCCATTACTTGAGGACTTGGTAATGAATGGGGTGGCACCGGGATACAATGCCCTTGGGAAAAGAAAGGAGAGTGGGGGAAAAAAAATCCAATATTGTCCCCTTTCCTAATATAATTACACATTTCTATATGGACCCC
  5   1   1   14    - Brn2 5g3  in                        CAAJ20714.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAAGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGGAA
  5   1   1   14    - Te3  5g3  in                        CAAM10219.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAAGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGT
  5   1   1   14    - Te3  5g3  in                        CAAM14891.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAAGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGT
  5   1   1   14    - Te3  5g3  in                        CAAM15678.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAAGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTT
  5   1   1   14    - Te3  5g3  in                         CAAM5527.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAAGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGANACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTTGGGATATCCTAT
  5   1   1   14    - Te3  5g3  in                         CAAM8618.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAAGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGGTGGTCAGACCTG
  5   1   1   14    - Brn2 5g3  in                        CAAJ17314.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTG
  5   1   1   14    - Brn2 5g3  in                        CAAJ23975.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGT
  5   1   1   14    - Brn2 5g3  in                          CAAJ587.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGA
  5   1   1   14    - Te3  5g3  in                        CAAM14860.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGNGGGTATATGCTAGAATGTGTCTGCCTTGNAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCA
  5   1   1   14    - Te3  5g3  in                        CAAM15248.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGNGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAAGCCTTATCAGGGCTGGATG
  5   1   1   14    - Te3  5g3  in                         CAAM2448.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTTCGTCCCGGACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTG
  5   1   1   14    - Te3  5g3  in                         CAAM2608.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTTCGTCTCCCAGCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCTTATCAGGGCTGGATGATGGTGGACTGTACATGCT
  5   1   1   14    - Te3  5g3  in                         CAAM6004.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGANATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTG
  5   1   1   14    - Te3  5g3  in                         CAAM7705.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAG
  5   1   1   14    - Brn2 5g3  in                        CAAJ17537.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATNGC
  5   1   1   14    - Te3  5g3  in                        CAAM16212.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCCGTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTA
  5   1   1   14    - Te3  5g3  in                         CAAM3889.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGA
  5   1   1   14    - Te3  5g3  in                         CAAM6877.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCGCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAG
  5   1   1   14    - Te3  5g3  in                         CAAM7442.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCGTCTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGNGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCCTGCAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAG
  5   1   1   14    - Te3  5g3  in                        CAAM14429.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCTCGCACCTCTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGTCCTATCA
  5   1   1   14    - Te3  5g3  in                         CAAM8156.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGG
  5   1   1   14    - Te3  5g3  in                         CAAM8861.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATG
  5   1   1   14    - Te3  5g3  in                         CAAM1198.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGG
  5   1   1   14    - Te3  5g3  in                        CAAM13874.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGGAA
  5   1   1   14    - Te3  5g3  in                          CAAM646.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACCTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAG
  5   1   1   14    - Te3  5g3  in                         CAAM1842.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTTGCGCTTTTATCGCTTTCTTTTCCTTTCCCTCCACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGNGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGTCAGCCCCGTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTAAGTAGT
  5   1   1   24    - Brn2 5g                             CAAJ24310.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAA
  5   1   1   14    - Te3  5g3  in                        CAAM13871.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTG
  5   1   1   14    - Te3  5g3  in                         CAAM4842.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAG
  5   1   1   14    - Te3  5g3  in                         CAAM9509.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTTTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAA
  5   1   1   14    - Te3  5g3  in                         CAAM7973.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTTATCGCTCTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTG
  5   1   1   14    - Te3  5g3  in                        CAAM14963.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTATCGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGC
  5   1   1   14    - Te3  5g3  in                        CAAM15991.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGG
  5   1   1   14    - Te3  5g3  in                         CAAM2024.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGG
  5   1   1   14    - Te3  5g3  in                         CAAM5488.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTTTCTTTCCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTG
  5   1   1   14    - Te3  5g3  in                         CAAM5427.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTCTTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAA
  5   1   1   14    - Te3  5g3  in                         CAAM2631.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTTCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTT
  5   1   1   14    - Te3  5g3  in                         CAAM1542.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCTTTCCCTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTG
  5   1   1   14    - Te3  5g3  in                         CAAM1519.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGT
  5   1   1   14    - Te3  5g3  in                         CAAM6136.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTGCTAGTTATTCCTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCT
  5   1   1   14    - Te3  5g3  in                         CAAM6223.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGACCCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAATACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAACAGATGCAATGACCAGGA
  5   1   1   14    - Brn2 5g3  in                        CAAJ12700.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCNGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGANAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGACACCAGAACTTCTTATAGAATTGGAAATTCATGGAGTAAGACTGACACCAGAGGAAATCTCTTGCAATGTATCTGTACTGGCAAT
  5   1   1   14    - Brn2 5g3  in                         CAAJ6379.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGACACCAGA
  5   1   1   14    - Brn2 5g3  in                        CAAJ23272.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTT
  5   1   1   14    - Te3  5g3  in                         CAAM1734.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTC
  5   1   1   14    - Brn2 5g3  in                        CAAJ23665.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTT
  5   1   1   14    - Te3  5g3  in                        CAAM15153.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGG
  5   1   1         - Gas1      in                     NISC_mq12h01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGGGAAAGGTGCAGTGGAATGGCAGCTTGAAAAAAGTCCAAAGAAAGAAGAAAATAAATAAAATAAGAATCCAAAACTAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGACAC
  5   1   1         - Fat1      in                         CABC5763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAGCCAGCAGAAAGGATGTTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGACACCAGAACTTCTTATAGAATTGGAAATTCATGGAGTAAGACTGACACCAGAGGAAATCTCTTGCAATGTATCTGTACTGGCAATGGGCGAGGAGAGTGGAAATGTGATAGACATTCCTCTGCACAAGTAACTGGTACTGGCTCAAACCCCATCACANACATTCAAACTACCCTCTTCCAGCCTGATTCAGAGCTGGAGCCCTATGGTCACTGTGTGACTGACAAT
  5   1   1         - Te3       in                         CAAM8656.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTATGACAATGGCAAGTACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGACACCAGAACTTCTTATAGAATTGGAAATTCATGGAGTAAGACTGACACCAGAGGAAATCTCTTGCAATGTATCTGTACTGGCAATGGGCGAGGAGAGTGGAAATGTGATAGACATTCCTCTGCACAAGCAACTGGTACTGGCTCAAACCCCATCACAAACATTCAAACTACCCTCTTCCAGCCTGATTCAGAGCTGGAGCCCTATGGTCACTGTGTGACTGACAATGGGGTCTTGTATTCTTTGGGTATG
  5   1   1         - Te3                                  CAAM4677.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACTACCAAATCAACCAGCAATGGGAGCGCACCTACCTAGGGAACACACTGGTGTGTACTTGTTATGGCGGAGGCAGAGGTTTCAACTGCGAAAGCAAACCAGAGTCTGAAGAGACCTGCTTTGACAAATACACTGGTGTTACTTACCGGGTCGGTGAAACATATGAGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGACACCAGAACTTCTTATAGAATTGGAAATTCATGGAGTAAGACTGACACCAGAGGAAATCTCTTGCAATGTATCTGTACTGGCAATGGGCGAGGAGAGTGGAAATGTGATAGACATTCCTCTGCACAAGCAACTGGTACTGGCTCAAACCCCATCACAAACATTCAAACTACCCTCTTTCAGCCTGATTCAGAGCTGGAGCCCTATGGTCACTGTGTGACTGACAATGGGGTCTTGTATTC
  5   1   1         - Te3       in                         CAAM2826.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCGACCAAAGGATAACATGATCTGGGACTGTACGTGTATTGGAGCTGGAAGGGGACGCATTAGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGACACCAGAACTTCTTATAGAATTGGAAATTCATGGAGTAAGACTGACACCAGAGGAAATCTCTTGCAATGTATCTGTACTGGCAATGGGCGAGGAGAGTGGAAATGTGATAGACATTCCTCTGCACAAGCAACTGGTACTGGCTCAAACCCCATCACAAACATTCAAACTACCCTCTTCCAGCCTGATTCAGAGCTGGAGCCCTATGGTCACTGTGTGACTGACAATGGGGTCTTGTATTCTTTGGGTATGAGATGGCTGAAGGCACAGGGCAGCAAGCAGATGCTCTGTACCTGCCTTGGTAATGGTGTGAGCTGTGAAGAAACTGTTGAAACCATCACATTTGGTGGTAATGCCAATGGTGAGCCATGTGCCATTCCTTTCACTCATGATGGCAAGACCTATTATTCCTGCACA
  5   1   1         - Te3       in                         CAAM2402.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAAGGGGACGCATTAGCTGTACAATTGCAAATCGCCGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGACACCAGAACTTCTTATAGAATTGGAAATTCATGGAGTAAGACTGACACCAGAGGAAATCTCTTGCAATGTATCTGTACTGGCAATGGGCGAGGAGAGTGGAAATGTGATAGACATTCCTCTGCACAAGCAACTGGTACTGGCTCAAACCCCATCACAAACATTCAAACTACCCTCTTCCAGCCTGATTCAGAGCTGGAGCCCTATGGTCACTGTGTGACTGACAATGGGGTCTTGTATTCTTTGGGTATGAGATGGCTGAAGGCACAGGGCAGCAAGCAGATGCTCTGTACCTGCCTTGGTAATGGTGTGAGCTGTGAAGAAACTGTTGAAACCATCACATTTGGTGGTAATGCCAATGGTGAGCCATGTGCCATTCCTTTCACTCATGATGGCAAGACCTATTATTCCTGCACAGGAGAGGGTCGTCAGGATGGAAAATTGTGGTGTG
  5   1   1         - Te3       in                         CAAM4772.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTGTACAATTGCAAATCGTTGCCATGAAGGAGGTCAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGACACCAGAACTTCTTATAGAATTGGAAATTCATGGAGTAAGACTGACACCAGAGGAAATCTCTTGCAATGTATCTGTACTGGCAATGGGCGAGGAGAGTGGAAATGTGATAGACATTCCTCTGCACAAGCAACTGGTACTGGCTCAAACCCCATCACAAACATTCAAACTACCCTCTTCCAGCCTGATTCAGAGCTGGAGCCCTATGGTCACTGTGTGACTGACAATGGGGTCTTGTATTCTTTGGGTATGAGATGGCTGAAGGCACAGGGCAGCAAGCAGATGCTCTGTACCTGCCTTGGTAATGGTGTGAGCTGTGAAGAAACTGTTGAAACCATCACATTTGGTGGTAATGCCAATGGTGAGCCATGTGCCATTCCTTTCACTCATGATGGCAAGACCTATTATTCCTGCACAGGAGAGGGTCGTCAGGATG
  5   1   1         - Te3       in                        CAAM15424.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTCTTATAAGATTGGGGACACCTGGCGCAGGCCACATGAAACTGGGGGGTATATGCTAGAATGTGTCTGCCTTGGAAATGGTAAAGGAGAATGGACCTGCAAGCCCGTTGCTGAGAGATGCTATGATAACACAGCTGGGATATCCTATGTAGTTGGTCAGACCTGGGAAAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGACACCAGAACTTCTTATAGAATTGGAAATTCATGGAGTAAGACTGACACCAGAGGAAATCTCTTGCAATGTATCTGTACTGGCAATGGGCGAGGAGAGTGGAAATGTGATAGACATTCCTCTGCACAAGCAACTGGTACTGGCTCAAACCCCATCACAAACATTCAAACTACCCTCTTCCAGCCTGATTCAGAGCTGGAGCCCTATGGTCACTGTGTGACTGACAATGGGGTCTTGTATTCTTTGGGTATGAGATGGCTGAAGGCACAGGGCAGCAAGCAGATGCTCTGTACCTGCCTTGGTAATGGTGTGAGCTGTGAAGAAACTGTTGAAACCATCACATTTGGTGGTAATGCCAATGGTGAGCCATGTGCCATTCCTTTCACTCATGATGGCAAGACCTATTATTCCTGCACAGGAGAGGGTCGTCAGGATGGAAAATTGTGGTGTGCAACAACCTCCAACTATGACACTGACAAGAAGTATTCATTCTGNCATGAGCAGCGTGCACTTGTACAGACA
  5   1   1         - Te3                                  CAAM3835.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGCCTTATCAGGGCTGGATGATGGTGGACTGTACATGCTTGGGAGAAGGCAGTGGACGAATCACATGTTCTTCCAAAAACAGATGCAATGACCAGGACACCAGAACTTCTTATAGAATTGGAAATTCATGGAGTAAGACTGACACCAGAGGAAATCTCTTGCAATGTATCTGTACTGGCAATGGGCGAGGAGAGTGGAAATGTGATAGACATTCCTCTGCACAAGCAACTGGTACTGGCTCAAACCCCATCACAAACATTCAAACTACCCTCTTCCAGCCTGATTCAGAGCTGGAGCCCTATGGTCACTGTGTGACTGACAATGGGGTCTTGTATTCTTTGGGTATGAGATGGCTGAAGGCACAGGGCAGCAAGCAGATGCTCTGTACCTGCCTTGGTAATGGTGTGAGCTGTGAAGAAACTGTTGAAACCATCACATTTGGTGGTAATGCCAATGGTGAGCCATGTGC
  5   1   1         - Te3       in                        CAAM16463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGGACACCAGAACTTCTTATAGAATTGGAAATTCATGGAGTAAGACTGACACCAGAGGAAATCTCTTGCAATGTATCTGTACTGGCAATGGGCGAGGAGAGTGGAAATGTGATAGACATTCCTCTGCACAAGCAACTGGTACTGGCTCAAACCCCATCACAAACATTCAAACTACCCTCTTCCAGCCTGATTCAGAGCTGGAGCCCTATGGTCACTGTGTGACTGACAATGGGGTCTTGTATTCTTTGGGTATGAGATGGCTGAAGGCACAGGGCAGCAAGCAGATGCTCTGTACCTGCCTTGGTAATGGTGTGAGCTGTGAAGAAACTGTTGAAACCATCACATTTGGTGGTAATGCCAATGGTGAGCCATGTGCCATTCCTTTCACTCATGATGGCAAGACCTATTATTCCTGCACAGGAGAGGGTCGTCAGGATGGAAAATTGTGGTGTGCAACAACCTCCAACTATGACACTGACAAGAAGTATTCATTCTGCAATGAGCAGCGTGCACTTGTACAGACACGTGGTGGTAACTCCAATGGAGCTCTTTGCAACTTTCCATTTTTGTACAACAACCGCAACTATACAGACTGCACCTCTGAAGGTCGGAGGGACAGTATGAAGTGGTGCGGGACTACTGCCAACTATGATGCCGATCAAAAATTTGGATTCTGTCCCATGGCAGCTCATGAGGAAATATGCACTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGNGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCCTGGGGAATGGACTTGTGTGG
  5   1   1         - Te3       in                        CAAM14678.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCAACTGGTACTGGCTCAAACCCCATCACAAACATTCAAACTACCCTCTTCCAGCCTGATTCAGAGCTGGAGCCCTATGGTCACTGTGTGACTGACAATGGGGTCTTGTATTCTTTGGGTATGAGATGGCTGAAGGCACAGGGCAGCAAGCAGATGCTCTGTACCTGCCTTGGTAATGGTGTGAGCTGTGAAGAAACTGTTGAAACCATCACATTTGGTGGTAATGCCAATGGTGAGCCATGTGCCATTCCTTTCACTCATGATGGCAAGACCTATTATTCCTGCACAGGAGAGGGTCGTCAGGATGGAAAATTGTGGTGTGCAACAACCTCCAACTATGACACTGACAAGAAGTATTCATTCTGCAATGAGCAGCGTGCACTTGTACAGACACGTGGTGGTAACTCCAATGGAGCTCTTTGCAACTTTCCATTTTTGTACAACAACCGCAACTATACAGACTGCACCTCTGAAGGTCGGAGGGACAGTATGAAGTGGTGCGGGACTACTGCCAACTATGATGCCGATCAAAAATTTGGATTCTGTCCCATGGCAGCTCATGAGGAAATATGCACTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTA
  5   1   1         - Te3       in                         CAAM6546.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGCCCTATGGTCACTGTGTGACTGACAATGGGGTCTTGTATTCTTTGGGTATGAGATGGCTGAAGGCACAGGGCAGCAAGCAGATGCTCTGTACCTGCCTTGGTAATGGTGTGAGCTGTGAAGAAACTGTTGAAACCATCACATTTGGTGGTAATGCCAATGGTGAGCCATGTGCCATTCCTTTCACTCATGATGGCAAGACCTATTATTCCTGCACAGGAGAGGGTCGTCAGGATGGAAAATTGTGGTGTGCAACAACCTCCAACTATGACACTGACAAGAAGTATTCATTCTGCAATGAGCAGCGTGCACTTGTACAGACACGTGGTGGTAACTCCAATGGAGCTCTTTGCAACTTTCCATTTTTGTACAACAACCGCAACTATACAGACTGCACCTCTGAAGGTCGGAGGGACAGTATGAAGTGGTGCGGGACTACTGCCAACTATGATGCCGATCAAAAATTTGGATTCTGTCCCATGGCAGCTCATGAGGAAATATGCACTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTG
  5   1   1         - Te3       in                         CAAM5996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCACTGTGTGACTGACAATGGGGTCTTGTATTCTTTGGGTATGAGATGGCTGAAGGCACAGGGCAGCAAGCAGATGCTCTGTACCTGCCTTGGTAATGGTGTGAGCTGTGAAGAAACTGTTGAAACCATCACATTTGGTGGTAATGCCAATGGTGAGCCATGTGCCATTCCTTTCACTCATGATGGCAAGACCTATTATTCCTGCACAGGAGAGGGTCGTCAGGATGGAAAATTGTGGTGTGCAACAACCTCCAACTATGACACTGACAAGAAGTATTCATTCTGCAATGAGCAGCGTGCACTTGTACAGACACGTGGTGGTAACTCCAATGGAGCTCTTTGCAACTTTCCATTTTTGTACAACAACCGCAACTATACAGACTGCACCTCTGAAGGTCGGAGGGACAGTATGAAGTGGTGCGGGACTACTGCCAACTATGATGCCGATCAAAAATTTGGATTCTGTCCCATGGCAGCTCATGAGGAAATATGCACTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGC
  5   1   1         - Brn2      in                        CAAJ20688.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGCTGAAGGCACAGGGCAGCAAGCAGATGCTCTGTACCTGCCTTGGTAATGGTGTGAGCTGTGAAGAAACTGTTGAAACCATCACATTTGGTGGTAATGCCAATGGTGAGCCATGTGCCATTCCTTTCACTCATGATGGCAAGACCTATTATTCCTGCACAGGAGAGGGTCGTCAGGATGGAAAATTGTGGTGTGCAACAACCTCCAACTATGACACTGACAAGAAGTATTCATTCTGCAATGAGCAGCGTGCACTTGTACAGACACGTGGTGGTAACTCCAATGGAGCTCTTTGCAACTTTCCATTTTTGTACAACAACCGCAACTATACAGACTGCACCTCTGAAGGTCGGAGGGACAGTATGAAGTGGTGCGGGACTACTGCCAACTATGATGCCGATCAAAAATTTGGATTCTGTCCCATGGCAGCTCATGAGGAAATATGCACTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAAA
  5   1   1         - Te3       in                         CAAM9906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGATGGAAAATTGTGGTGTGCAACAACCTCCAACTATGACACTGACAAGAAGTATTCATTCTGCAATGAGCAGCGTGCACTTGTACAGACACGTGGTGGTAACTCCAATGGAGCTCTTTGCAACTTTCCATTTTTGTACAACAACCGCAACTATACAGACTGCACCTCTGAAGGTCGGAGGGACAGTATGAAGTGGTGCGGGACTACTGCCAACTATGATGCCGATCAAAAATTTGGATTCTGTCCCATGGCAGCTCATGAGGAAATATGCACTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAAC
  5   1   1         - Te3       in                         CAAM5604.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACTGACAAGAAGTATTCATTCTGCAATGAGCAGCGTGCACTTGTACAGACACGTGGTGGTAACTCCAATGGAGCTCTTTGCAACTTTCCATTTTTGTACAACAACCGCAACTATACAGACTGCACCTCTGAAGGTCGGAGGGACAGTATGAAGTGGTGCGGGACTACTGCCAACTATGATGCCGATCAAAAATTTGGATTCTGTCCCATGGCAGCTCATGAGGAAATATGCACTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGAAATCCTGTATGAGGGGGCATTTGATCAGCA
  5   1   1         - Brn2      in                        CAAJ19177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCAATGAGCAGCGTGCACTTGTACAGACACGTGGTGGTAACTCCAATGGAGCTCTTTGCAACTTTCCATTTTTGTACAACAACCGCAACTATACAGACTGCACCTCTGAAGGTCGGAGGGACAGTATGAAGTGGTGCGGGACTACTGCCAACTATGATGCCGATCAAAAATTTGGATTCTGTCCCATGGCAGCTCATGAGGAAATATGCATTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAG
  5   1   1       chi Te3       in                         CAAM8965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGCTTTGTACCCTTTATTCAGAACTTCACTGGGAAATGCGTCAGTAAATCCGCACACCATAAAAAGACTTCGGCTCCGCGGTTCCATTGGTTTTATAGTCTCCGGGGCGATTTAAAAATGCGCTGGGGGGCCCTGACCGGGCTGCTCCTAGCCCTGTGCCTGTGTGCAGTGGTACGTTCCGCCCCATCAAGCAAGAAGCGCAGGCAGGCGCAGCAGCAGCAAGTAGTGCAACCCCATGGATCACCGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGG
  5   1   1         - Fat1      in                         CABC4569.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAACTTTCCATTTTTGTACAACAACCGCAACTATACAGACTGCACCTCTGAAGGTCGGAGGGACAGTATGAAGTGGTGCGGGACTACTGCCAACTATGATGCCGATCAAAAATTTGGATTCTGTCCCATGGCAGCTCATGAGGAAATATGCACTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCCACTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTA
  5   1   1         - Brn2      in                        CAAJ24289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGACTACTGCCAACTATGATGCCGATCAAAAATTTGGATTCTGTCCCATGGCAGCTCATGAGGAAATATGCACTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGNGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCCACCATGGTGGCCACATCTGAGTCTGTAAC
  5   1   1         - Te3       in                         CAAM8038.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGGAAATATGCACTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGAAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGT
  5   1   1         - Te3       in                         CAAM8098.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAATATGCACTACTAATGAGGGAGTCATGTATAGAGTTGGTGATCAGTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAAC
  5   1   1         - Te3       in                         CAAM1871.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGGTGATCACTGGGACAAGCAGCATGATCAAGGCCACATGATGCGATGTACTTGTGTTGGAAATGGTCGTGGGGAATGGACTTGTGTGGCTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTT
  5   1   1         - Te3       in                         CAAM5070.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTATTCTCAGCTTAAAGACCAGTGCATTGTGGATGGGATAACTTATGATGTGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGNGTCTCTGCATCTGACACAGTGTCTGGCTTCCCGTGTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAACACTGCCACTTCAGTCAGTATCC
  5   1   1         - Te3       in                         CAAM3902.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAACAGTTCTTTTACGAAACGCCATGAGGAAGGACACATGATGAACTGTACCTGCTATGGGCAGGGTCGTGGCAGATGGAAGTGCGATGCTATAGACCAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCANGCCGTAGATACAATGTGAATGTGTATCAGATAACTGA
  5   1   1         - Te3       in                         CAAM9976.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATGCCAGGATACTGAAACCCGACAGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATG
  5   1   1         - Te3       in                        CAAM14373.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAACCCGACCGTTCTATCAGATTGGAGATTCCTGGGAAAAGCATTTGCAGGGAGTACGGTACCAGTGTTACTGCTATGGCAAAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCATACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGT
  5   1   1         - Te3       in                         CAAM4939.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGAATTGGTGAATGGCATTGCCAGCCTCTATCAACATCCCCAGCTGGGACTGGACCCGTTCAGGTTATTATCACAGAGAGTTCCAATTTCCCTAATTCTCACCCTATACAGTGGAATGCCCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCA
  5   1   1       chi AbdN                               IMAGE:7004407                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAATGCCCCACAGCCATCACACATTAAGAATACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTTCCCAAGCCGTAGATACAATGTGAATGTGTATCAGAATACTGAAAGAGGGTGAAAAGAGCCTCATCCTATCAACCTACTCAGAACAACTGGCACCTGGAAGCCCCCCCCCGACCCTAATGTGGAAAATGGTTGAATGAAACCTCCCTTCCTGGATCCAAATGGGACCAAAACCCCTCAAGCTTCCCCGTCACCAGGGGATACCAGGGGTTGGTTATTACAGTCCCAATCTTGTTAAAAAGGGCCCCCCCCCCCCCCAAATTTTAAAACCCTCCCCCAAAGTAACTGGGAAACTTTTCCCGGGGGAGCCCCCGAAAATTAAAACTTGCTCCCCCCCGGGAAAATTGGAAAACCCAAATTTTTTTCCCAACTCCTTTTGGCCCGGGGGAAAAA
  5   1   1         - Te3       in                        CAAM10058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCACAGCCATCACACATTAAGAATTACATCCTGCGCTGGAAGCCTAAACTGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTTCAGCAAGGACAACTGGAAACTCACAGACAGTTATAGTACCATCTCCCACTGACTTACATTTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCC
  5   1   1         - Te3       in                        CAAM16266.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACTGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGGACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAATTACCATCAT
  5   1   1         - Te3       in                         CAAM4879.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGACTGGCCCATGGAAACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGC
  5   1   1         - Te3                                 CAAM14903.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACAAGCCACTATTCCAGGACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATAT
  5   1   1         - Te3       in                         CAAM6727.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACACCTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGG
  5   1   1         - Brn2      in                        CAAJ11852.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGAACTCTTATACCATCTCTGGCTTGAAACCTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTG
  3  -1   1         - Liv1      in                        CAAR10000.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGAATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCNCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCA
  5   1   1         - Te3       in                         CAAM4922.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCTGTATGAGGGGCAATTGATCAGCATTCTGCAGTATGGAAACAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATA
  5   1   1         - Te3       in                        CAAM10015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGGAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTTATCGTGG
  5   1   1         - Te3       in                         CAAM6291.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGGTCACAACCTTTGACTTTACCACCACTTCTACCATTCACCGCTCCAGTCAAACTGAGACAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGT
  5   1   1         - Te3       in                         CAAM5188.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGAGAAACTACCCCACTTCCACCATTGGTGGCCACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGA
  5   1   1         - Te3                                  CAAM2039.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGACACATCTGAGTCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAG
  5   1   1         - Te3       in                        CAAM10293.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTGTAACAGAAATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCNAACTCGATGCTCCATCAGACTTGCAGNTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCCAGCCAAAATTGGTCGNTACCTGCTGTCTGTAGGTCAAACCCCGGG
  5   1   1         - Gas                            TGas023a08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTACTGCTAGCAGTTTTCTGGTATCCTGGGTCTCTGCATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTC
  5   1   1         - Brn2      in                        CAAJ16399.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATCTGACACAGTGTCTGGCTTCCGTGTTGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGAC
  5   1   1         - Te3       in                         CAAM7863.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTCCGTGTCGAATATGAGCTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGT
  5   1   1         - Brn2      in                        CAAJ18396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGAGTGAGGATGGAGATGAGAAACGCTACCTAGAACTTCCAAACACTGCCACTTCAGTCAGTATCCCAGACCTCCTCCCAGGCCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAACCCGGG
  5   1   1         - Fat1      in                         CABC2024.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGTATCCCAGACCTCCTCCCAGTGGCGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTG
  5   1   1         - Te3       in                         CAAM6109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTAGATACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAAGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAGGCAATCAGCAAGTGCTAGCACTAC
  5   1   1         - Te3       in                        CAAM15490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAATGTGAATGTGTATCAGATAACTGAAGAGGGTGAAAAGAGCCTCATCCTATCAACTACTCAGACAACTGGTAGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCT
  5   1   1         - Te3       in                         CAAM6844.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAACTGCACCTGATGCACCCCCCGACCATAATGTGGAAAATGTTGATGACACCTCCATCCTGATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACANACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCC
  5   1   1         - Te3       in                         CAAM3937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCAAATGGACCAAACCTCAAGCTCCCGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTANCACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGC
  5   1   1         - Te3       in                         CAAM9696.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTCACAGGATACAGGGTTGTATACAGTCCATCTGTAGAAGGCAGCAGCACAGAGTTAAACCTCCCAAGTACTGCAACTTCAGTGAGCCTGACTGAGCTGCTCCCAGGAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAG
  5  -1   1         - Liv1      in                        CAAR10000.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATTGAATACAATATTACAATCTATGCAGTGGAAGACAGTTTAGAAAGTGTTCCCATCTTATTCAGCAAGGGACAACTGGAACTCCACAGACAGTTATAGTACCATCTCCCACTGACTTACAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCCACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAG
  5   1   1         - Te3       in                         CAAM6704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAATTAGTGGAAGTTACCGATATAAAAATTACCATCATGTGGAACCCCCGACAAAGTGAGGTTTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCG
  5   1   1         - Lun1      in                        CABD11155.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTGGATACCGAGTTGTTGTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGNGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAG
  5   1   1         - Neu                            TNeu003k24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGAAACCTGTAAGTCCCTCTGACCGTGATGTGCAGAATCTCCCCGTGAGCAGGAACACTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCT
  5   1   1         - Te3       in                         CAAM6888.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTTGCCGAGGTGGTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTT
  5   1   1         - Te4       in                         CAAN3877.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCA
  5   1   1         - Te3                                 CAAM15480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTAACTTGCACCCTGGCAGGACCTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGT
  5   1   1       chi Tbd0      in                       IMAGE:6977095                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGGACTATACCTTTGAGGTGTATGCAGTTAATCGTGGACAAGAGAGTGAACCCCTGGCTGGAGACTTCACTACCAAACTCGATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCAACCCAGCCAAGGTGGGGACGCACCTCGGGAAGTCATATCCCAGTCAGGCTGCATCGCGATCTCTGGGCTAACCCCTGAACTCAAACACCTGTGCTGCCTCTCAGCTCCTCAACAGATCAGTTGACCATGGCCTTCTCTCCCGCCGAGATGACCCTCCCTACGCTCACTAGCCTCATCTCCTCCTCCTATGACCCATCTTTCGTCCGTTCCTGCAGCGATCAGCAGCATCCACACCACACGTCTCCCTCCGCGTCTAGCACTTTCCCCCCCCACCTGCTATTCGCCTTCTCCCCTTCCCTCTACCCTCTTC
  5   1   1         - Te4       in                        CAAN10465.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACTACCAAACTCCATGCTCCATCAGACTTGCAGTTTACAGATGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGA
  5   1   1         - Te3       in                         CAAM8247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTAACTGACTCTACAGTTGTTATTATCTGGAGACCACCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCACTTCTATCGAACTATCAAGTT
  5   1   1         - Te4       ?                          CAAN8508.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCAAGCCAAAATTGGTCGTTACCTGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTANAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCAACTTCTATCGAACTATNCAGTTTCCTGGTACGATATTCTCCCGTG
  5   1   1         - Lun1      in                        CABD14289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAATCGGCACGAGGGCTGTCTGTAGGTCAAACCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGA
  5   1   1         - Te3       in                         CAAM9227.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGGAGGCCAGCCGAGCCAATTTCACATTAACCCCTCTGCCACAAACCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATNCAGTTTCCTGGTACGATATTCTCCCGTGAA
  5   1   1         - Brn2      in                        CAAJ13288.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCACGCGTCCGCCCACGCGTCCGCCACAAGCTGGAGAGTCTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGNGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACAT
  5   1   1         - Te3       in                         CAAM9768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTCCCCAGGCACAGAGTACACCATTTCACTTGTTGCCCTCAAAGGCAATCAGCAAAGTGCTAGCACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCACCATGGTGGTTTTATCAAACTTGCTTCCCT
  5   1   1         - Te3       in                         CAAM9197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACTACTGGTGTCTTTTCAACATTGGAACCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACCGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCCTTCACGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCCTCATGGTGTAGCTAAGACTTACTTGGACTCTTCCACTGGCATTGACTTTT
  5   1   1         - Te3       in                         CAAM1270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTGTGGGATCAATTCCACCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCCTCATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCCATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCG
  5   1   1         - Te3       in                         CAAM7289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGGGTCCAAGTTACCACTATGGTAGTCTCTGTGACTTCAGTGTTGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGAGATACCCCAACTGACTGACCTAAAGTATGACGATGTAACTGACACAAGCATTGACCTGAGGTGGACGCCCCTTAATTCCTCCACCATTATCGGCTACCGAATCACGGTGGTTGCGGCGGGAGAATCCGTCCCTATCTACGAGGAATTTGTGGGCCCCACAGATGGGTATTACAAAGTTTCAGGATTGGAACCCGGCATTGACTATGAGATCAGCGTGATAACACTTATTAGCGGCGGAGAGAGCGCCCCGACCACAATCGTACAGCACACGGCTGTTCCACCTCCCACTAATTTGCGCTTCACCAATGT
  5   1   1         - TpA       in                   TTpA051k23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCCCCTTACAACACTGAAGTCACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGAGATACCCCAACTGACTGACCTAAAGTATGACGATGTAACTGACACAAGCATTGACCTGAGGTGGACGCCCCTTAATTCCTCCACCATTATCGGCTACCGAATCACGGTGGTTGCGGCGGGAGAATCCGTCCCTATCTACGAGGAATTTGTGGGCCCCACAGATGGGTATTACAAAGTTTCAGGATTGGA
  5   1   1         - Fat1      in                        CABC10823.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACAGAGACTACCATAGTGGTAACTTGGACCCCTGTGCCCAGAATCGGGTTTAAGCTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGG
  5   1   1         - Te4       in                         CAAN2841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGATGTTCGACCCAGCCAAGGTGGGGAGGCACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACT
  5   1   1         - Brn2      in                        CAAJ19027.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACCTCGGGAAGTCATATCCGAGTCTGGCAGCATTGTGATCTCTGGCCTAACCCCTGGAGTCGAATATATGTACAGCATATCTGTTCTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCTACTGGCATTGACTTTTCTG
  5   1   1         - Te3       in                         CAAM1827.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATATCTGTTCCTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCAT
  5   1   1         - Liv1      in                        CAAR10536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTAAGGATGGCGTTGAGAGGGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTTCATGGTCAAC
  5   1   1         - Te4       in                         CAAN2251.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACATTCCCATCACCAAGACTGTTGTCACACCTGTCGCTCCTCCAACCAACTTGCGCCTCCAACCAAGCAGAGATTCTGCTACACTTACTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGG
  3  -1   1         - Int1      in                        CAAP11187.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGACTGACCTAAAGTATGACGATGTAACTGACACAAGCATTGACCTGAGGTGGACGCCCCTTAATTCCTCCACCATTATCGGCTACCGAATCACGGTGGTTGCGGCGGGAGAATCCGTCCCTATCTACGAGGAATTTGTGGGCCCCACAGATGGGTATTACAAAGTTTCAGGATTGGAACCCGGCATTGACTATGAGATCAGCGTGATAACACTTATTAGCGGCGGAGAGAGCGCCCCGACCACAATCGTACAGCACACGGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCCTCTCTACACACTCACCATCTCTTGGGAAGCACCT
  5   1   1         - Tad0                               IMAGE:6982430                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGACACAAGCATTGACCTGAGGTGGACGCCCCTTAATTCCTCCACCATTATCGGCTACCGAATCACGGTGGTTGCGGCGGGAGAATCCGTCCCTATCTACGAGGAATTTGTGGGCCCCACAGATGGGTATTACAAAGTTTCAGGATTGGAACCCGGCATTGACTATGAGATCAGCGTGATAACACTTATTAGCGGCGGAGAGAGCGCCCCGACCACAATCGTACAGCACACGGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTTCATGGTNCACAGGAGAGTTTGCCACTTTCTGGACAGNCAGCCACTGTATCTG
  5   1   1         - Te4       in                        CAAN10806.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGTTTACTGGGACAGTAGCATTTCACCAGGAATCACTGGATACAGAATTACCACTGCACCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTC
  5   1   1         - Te4       in                        CAAN10808.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCACTCCAATGCAGGTTGGCAATTCCCTGGAAGAGGAGGTTGGTCCAACTCAGACATACTGCCTCTTTGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTC
  5   1   1         - Spl1      in                         CABK1306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGCCCCACAGATGGGTATTACAAAGTTTCAGGATTGGAACCCGGCATTGACTATGAGATCAGCGTGATAACACTTATTAGCGGCGGAGAGAGCGCCCCGACCACAATCGTACAGCACACGGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCCACACTGCAACCATCAGAGGGGTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATG
  5   1   1         - Lun1      in                        CABD13707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTCGTGCCGAATTCGGCACGAAGGAGAACCTGAGCCCTGGTGTAGAGTACAATGTCAGCGTGTATGCAGTAAAAGGGGAAGAGGAGAGTTCACCTCTCTCCCAGATCTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGNGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCG
  5   1   1         - Tbd0      in                     NISC_nl21f06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGATTGGAACCCGGCATTGACTATGAGATCAGCGTGATAACACTTATTAGCGGCGGAGAGAGCGCCCCGACCACAATCGTACAGCACACGGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCAACTGATTTGGAAGTGACCTCCTCCTCT
  5   1   1         - Brn3      in                         CAAK5689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTCTTCAAGCTGTTCCACCTCCAACTAATTTGCGCTTCACCAATGTTGGCCCTGACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACACTTACCATGTTCACATGACAGATGTTGACCAACCNACTGACATGGCTGTCACAGATA
  5   1   1         - Liv1      in                         CAAR3021.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACACCATGCGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCANACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGGTCAATGGTCTCCTCCTCCAGGCCCAGTCACTGGGTACAGGGTCACTAGTGTCCCAAAAAGTGGCC
  5   1   1         - Neu                            TNeu032b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCGTCACCTGGTCACCTCCAACTTCTATCGAACTATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGT
  5   1   1         - Liv1      in                        CAAR11777.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCAAGTTTCCTGGTACGATATTCTCCCGTGAAGAAGCCAGATGATGTGACAGAACTCTCCCTCTCTCCATCTACCAACATGGTGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTC
  5   1   1         - Liv1      in                         CAAR5182.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTCTCTCCATCTACCAACATGGTGGGTTTTATCAAACTTGCTTCCCTTCACCGAATATTTAGTCAGCGTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCT
  5   1   1         - Te1       in                         CBWN7403.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTCATTCTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGCTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCC
  5   1   1         - Te4       in                         CAAN1874.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGTTTATGAGGAGCGAGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCAGGTCGTTTCCCAGATCAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACA
  5   1   1         - Te4       in                         CAAN3297.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGAGTAGTGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCT
  5   1   1         - Neu                            TNeu069e01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTTTATACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTTCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCAT
  5   1   1         - Neu                            TNeu140d17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCCCTCAATGGTGTAGCTAAGACTTACTTGGACTCTCCAACTGGCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATG
  5   1   1         - Brn3      in                         CAAK8035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCATTGACTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAACAATTCCAGC
  5   1   1         - Liv1      in                         CAAR7880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGAGGCTTTTCTGAAATTACTCCCAATTCATTTACTGTGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAACAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGGG
  5   1   1         - Te4       in                        CAAN10890.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCACTGGATTGCTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGANACTGCAGTTACAACAATTCCAGCACCCACAAATCTTCAGTTCTCTCCAGTGACACCAAGTGCCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGGGT
  5   1   1         - Te4       in                        CAAN11423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCACGTGCCCCTATCACTGGCTACAGAATTCGGTACCAGTTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAACAAT
  5   1   1         - Brn2      in                        CAAJ13436.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAAACATTGACCATCCCAAAGGACTGACATTCACTGATGTGGGTGTTGATTCCATTAGACTGGCTTGGGAGGTCCCAGATGGGCAGGTCACCCGCTACAGGGTTACCTACTCAAGTCCTGAGGAGGGAGTAAAAGAGTTGTTCCCAGCTCCAGAAGGGGATGATGACACAGCAGAATTGCACGGTCTGAGGCCGGGCACAGAATACACTGTGAGCATCGTGGCATTGCACGATGACATGGAGAGCAAGCCGATGATTGGAATCCAGAGCACAGCAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGG
  5   1   1         - Fat1      in                         CABC5744.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTAGAAAGTGGAGCTGGGCGACCCAAGGAGGAGCGGGTACCTCCATCCCGGAACTCTATTACCCTTACCCACCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAACAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGGGTACCTTGTACGTGTCAACCCTAAAGAGAAAACTGGGCCTATGAAGGAAGTAGACTTTCACCTGGTGTGACTGCTACAACTGTAACTGGTCTG
  5   1   1         - Te3       in                         CAAM2422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGTAAGGGTCATAGAGTTCCGGGATGGAGGTACCCGCTCCTCCTCATTCCAGGTTCAGAATACATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGACACTGCAGTTACAACAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGCGTACCTTGTACGTGTCAACCCTAA
  5   1   1         - TpA       out                  TTpA071i14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATAATTGTCAGTATCATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAACACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAAAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAACAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAATGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAAACATTGACCATCCCAAAGGACTGACATTCACTGATGTGGGTGTTGATTCCATTATACTGGCTTGTGAGGTC
  5   1   1         - Te4       in                         CAAN7742.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGCATTCAATGGTCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAACAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGGGTACCTTGTACGTGTCAACCCTAAAGAGAAAACTGGGCCTATGAAGGAAGTTAGACTTTCACCTGGTGTGACTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTTAATGTGTATGCTCTTAAAGAT
  5   1   1         - Egg       in                   TEgg065l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATGGTCAACAGGAGAGTTTGCCGCTTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAATTCCAGGAACATCACAATCACTGCAACCATCACAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCGACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAAACATTGACCATCCCAAAGGACTGACATT
  5   1   1         - Lun1      in                        CABD14027.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGAGGCAACAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAACAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGGGTACCTTGTACGTGTCAACCCTAAAGAGAAAACTGGGCCTATGAAGGAAGTTAGACTTTCACCTGGTGTGACTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTTAATGTGTATGCTCTTAAGGATACCCTGACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTAAGTCCACCT
  5   1   1         - Ovi1      in                         CABI5892.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGAGAGTTTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAAACATTGACCATCCCAAAGGACTGACATTCACTGATGTGGGTGTTGATTCCATTAGACTGGCTTGGGAGGTCCCAGATGGGCAGGTCACCCGCTACAGGGTTACCTACTCAAGTCCTGAGGAGGGAGTAAAAGAGTTGTTCCCAGCTCCAGAAGGGGATGATGACACAGCAGAATTGCACGGTCTGAGGCCGGGCACAGAATACACTGTGAGCATCGTGGCATTGCACGATGACATGGAGAGCAAGCCGATGAT
  5   1   1         - Fat1      in                         CABC7337.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGCCACTTTCTGGACAGCAAGCCACTGTATCTGATGTCCCAACTGATTTGGAAGTGACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAACAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGGGTACCTTGTACGTGTCAACCCTAAAGAGAAAACTGGGCCTATGAAGGAAGTTAGACTTTCACCTGGTGTGACTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTTAATGTGTATGCTCTTAAGGATACCCTGACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTAAGTCCACCTCG
  5   1   1         - Brn3      in                         CAAK3200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAAACATTGACCATCCCAAAGGACTGACATTCACTGATGTGGGTGTTGATTCCATTAGACTGGCTTGGGAGGTCCCAGATGGGCAGGTCACCCGCTACAGGGTTACCTACTCAAGTCCTGAGGAGGGAGTAAAAGAGTTGTTCCCAGCTCCAGAAGGGGATGATGACACAGCAGAATTGCACGGTCTGAGGCCGGGCACAGAATACACTGTGAGCATCGTGGCATTGCACGATGACATGGAGAGCAAGCCGATGATTGGAATCCAGAGCACAGCAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGGGTACCTTGTACGTGTCAACCCTAAAGAGAAAACTGGGCCTATGAAGGAAGTTAGACTTTCACCTGGTGTGACTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTTAATGTGTATGCTCTTTAGGATACCCTGACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTAAG
  5   1   1         - Te1       in                         CBWN5925.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTATGAAGGCATCTTTTGTTCACCAAAAATTCTAGTGTAATAATCAACAAAACTCACCTTCATGTGTCTTGTTCTATATATTAGAGGCAATCGATAAAGTTACCTAATGCCAGTAAATCAGATATACAGGTCACAAACTCTATGCTGAGAGAAACTATGGCCTCATAATTTACTGTGTATTTAAAGGCAAGTAAAGCAATGATGAACGGAACTGGATTGTGGGTATATTTTCCCTTATCAGTGCTGTTGCTCTATAAATGTAATTGGTTAGATGCCTGATCAAGAATGATTTGCTGGAATATATTGATCTCTAACTTGGGTAATCATGGGATGCCACTTGATGCTCGGCAGTAAGCAGATATCTGCAATAGTAGGTACGGTTGCAACCATGTTGTTCATGGTTTCTATGCTTGATACTTGCTCATGTCATCATACATTTGTAGAGTTTGATATGAGCCGTAAGGGATTAATTATACTGAAAGTAATGTGGGTGCAAATGGCACCAGTTCTGCAACCAAAAGCAACGAATCAAAAATGACATTTGGTCAGTATGAAAATGAATCTGATTGGTTGCTATGATTAACTGCATGTTAGTACCTGTGTTAGTAAATTAGCCCTTTGGCCTTTTTTTAATGCCTGAAAGTAAATTGTCATCTTTAAAATATTGTAAATGTTTT
  5   1   1         - Tad5      in                         XZT38676.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACCTCCTCCTCTCCTAACACACTCACCATCTCTTGGGAAGCACCTTCAGTGAATGTACGTTACTACAGGATCACCCATTCCCAGACAGGAGGTCATGGTCCAGAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAAACATTGACCATCCCAAAGGACTGACATTCACTGATGTGGGTGTTGATTCCATTAGACTGGCTTGGGAGGTCCCAGATGGGCAGGTCACCCGCTACAGGGTTACCTACTCAAGTCCTGAGGAGGGAGTAAAAGAGTTGTTCCCAGCTCCAGAAGGGGATGATGACACAGCAGAATTGCACGGTCTGAGGCCGGGCACAGAATACACTGTGAGCATCGTGGCATTGCACGATGACATGGAGAGCAAGCCGATGATTGGAATCCAGAGCACAGCAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCT
  5   1   1         - Gas                            TGas100g24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAAACATTGACCATCCCAAAGGACTGACATTCACTGATGTGGGTGTTGATTCCATTAGACTGGCTTGGGAGGTCCCAGATGGGCAGGTCACCCGCTACAGGGTTACCTACTCAAGTCCTGAGGAGGGAGTAAAAGAGTTGTTCCCAGCTCCAGAAGGGGATGATGACACAGCAGAATTGCACGGTCTGAGGCCGGGCACAGAATACACTGTGAGCATCGTGGCATTGCACGATGACATGGAGAGCAAGCCGATGATTGGAATCCAGAGCACAGCAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGGGTACCTTGTACGTGTCAACCCTAAAGAGAAAACTGGGCCTATGAAGGAAGTTAGACTTTCACCTGGTGTGACTGCTACAACTGTAACTGGTCTGATG
  5   1   1         - Neu       in                   TNeu123e06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGGCCCAGACGGAGGTCATGGTCCATAGAAGGAGTTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTATCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAAACATTGACCATCCCAAAGGACTGACATTCACTGATGTGGGTGTTGATTCCATTAAACTGGCTTGGGAGGTCCCAATGGGCAGTCACCCGCTACAGGGTTACCTACTCAAGT
  3  -1   1         - Fat1                                 CABC4313.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAATTATGGCCTCATAATTTACTGTGTATTTAAAGGCAAGTAAAGCAATGATGAACGGAACTGGATTGTGGGTATATTTTCCCTTATCAGTGCTGTTGCTCTATAAATGTAATTGGTTAGATGCCTGATCAAGAATGATTTGCTGGAATATATTGATCTCTAACTTGGGTAATCATGGGATGCCACTTGATGCTCGGCAGTAAGCAGATATCTGCAATAGTAGGTACGGTTGCAACCATGTTGTTCATGGTTTCTATGCTTGATACTTGCTCATGTCATCATACATTTGTAGAGTTTGATATGAGCCGTAAGGGATTAATTATACTGAAAGTAATGTGGGTGCAAATGGCACCAGTTCTGCAACCAAAAGCAACAAATCAAAAATGACATTTGGTCAGTATGCTACAAGTTAGAAAATGAATCTGATTGGTTGCTATGATTAACTGCATGTTAGTACCTGTGTTAGTAAATTAGCCCTTTGGCCTTTTTTTAATGCCTAAAAGTAAATTGTCATCTTTAAAATATTGTAAATGTTTTGGAGGAGCCATTGTATTGGTATAAACTGACCATGTCTTTCGATAACTAAACTAAGAAAAAAAACGGGTCTGTCTTTAAGGAGCTTTCTTACAACTACCACAAAACCTTGACATACCAATAGATAATACCAAGATTGTTCTCTGCAAAGCCTCTGTTCCTTAAAGACACTTACGTTGGCTTCCTTAAAAAGTGTTTCTAGTGGCAGATTCCAGTTTTATACTGATTTTAGTAGGCAGTTAGATCAACTTCTTTACCTACTGTTGACAAATCTGCAATGATTGNTGCAGCTGC
  5   1   1         - Neu                            TNeu044m19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTACAGTTCCAGGAACATCCAACACTGCAACCATCAGAGGGTTAAATCCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAAACATTGACCATCCCAAAGGACTGACATTCACTGATGTGGGTGTTGATTCCATTAGACTGGCTTGGGAGGTCCCAGATGGGCAGGTCACCCGCTACAGGGTTACCTACTCAAGTCCTGAGGAGGGAGTAAAAGAGTTGTTCCCAGCTCCAGAAGGGGATGATGACACAGCAGAATTGCACGGTCTGAGGCCGGGCACAGAATACACTGTGAGCATCGTGGCATTGCACGATGACAT
  5   1   1         - Spl1      in                         CABK3221.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAAACATTGACCATCCCAAAGGACTGACATTCACTGATGTGGGTGTTGATTCCATTAGACTGGCTTGGGAGGTCCCAGATGGGCAGGTCACCCGCTACAGGGTTACCTACTCAAGTCCTGAGGAGGGAGTAAAAGAGTTGTTCCCAGCTCCAGAAGGGGATGATGACACAGCAGAATTGCACGGTCTGAGGCCGGGCACAGAATACACTGTGAGCATCGTGGCATTGCACGATGACATGGAGAGCAAGCCGATGATTGGAATCCAGAGCACAGCAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGGGTACCTTGTACGTGTCAACCCTAAAGAGAAAACTGGGCCTATGAAGGAAGTTAGACTTTCACCTGGTGTGACTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTTAATGTGTATGCTCTTAAGGATACCCTGACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTAAGTCCACCTCGAAGACCTCGTGTTCAAGATGTGACCGAGACCACAGTTACACTGTCCTGGCGCACTAAAACAGAGACCATCACTGGCTTCCAGATTGATGCTATACCTGCCGGAGGTCAGAATCCCATCANGAGAACAGTTGATGCAGATCTCCGTTCTTTTACTATCACAGGTCTGCAGCCTGGCACAGACTACAAGATCTATCTGTACACCCTAAATGACAATGCTCGTAGCT
  5   1   1         - Te4       in                         CAAN9779.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAGGAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAACAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGGGTACCTTGTACGTGTCAACCCTAAAGAGAAAACTGGGCCTATGAAGGAAGTTAGACTTTCACCTGGTGTGACTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTTAATGTGTATGCTCTTAAGGATACCCTGACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTAAGTCCACCTCGAAGACCTCGTGTTCAAGATGTGACCGAGACCACAGTTACACTGTCCTGGCGCACTAAAACAGAGACCATCACTGGCTTCCAGATTGATGCTATACCTGCCGGAGGTCAGAATCCCATCA
  5   1   1         - Liv1      in                          CAAR455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGTAAGCTACACCATCACTGTTTATGCAGTGACTGGGCGAGGGGATAGTCCTGCCTCTAGCAAACCACTTACCATTGTTCACATGACAGATGTTGACCAACCAACTGACATGGCTGTCACAGATATCCAGGATCACAGCATTCATGTCAAATGGTCTCCTCCTCCAGGCCCAGTCACTGGTTACAGGGTCACTAGTGTCCCAAAAAGTGGCCAAGGAGAAACCTTTTCCCAGGTCGTTTCTCCAGATCAAACTGAAGTGACGATTGTGGGCCTGCAACCAGCTGTGGAGTATGTGGTGAGCATATACTCACAAGGTGAAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAACAATTCCAGCACCAACAAATCTTCAGTTCTCTCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTATCCATCTCAGTGGGTACCTTGTACGTGTCAACCCTAAAGAGAAAACTGGGCCTATGAAGGAAGTTAGACTTTCACCTGGTGTGACTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTTAATGTGTATGCTCTTAAGGATACCCTGACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTAAGTCCACCTCGAAGACCTCGTGTTCAAGATGTGACCGAGACCACAGTTACACTGTCCTGGCGCACTAAAACAGAGACCATCACTGGCTTCCAGATTGATGCTATACCTGCCGGAGGTCAGAATCCCATCAGGAGAACAGTTGATGCAGATCTCCGTTCTTTTACTATCACAGGTCTGCAGCCTGGCACAGACTACAAGATCTATCTGTA
  5   1   1         - Gas                            TGas013a17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGTGAGCATATACTCCAAGTGAAATGGCGAGAGCGAGCCTCTGGTTGAAACTGCAGTTACAAACATTGACCATCCCAAAGGACTGACATTCACTGATGTGGGTGTTGATTCCATTAGACTGGCTTGGGAGGTCCCAGATGGGCAGGTCACCCGCTACAGGGTTACCTACTCAAGTCCTGAGGAGGGAGTAAAAGAGTTGTTCCCAGCTCCAGAAGGGGATGATGACACAGCAGAATTGCACGGTCTGAGGCCGGGCACAGAATACACTGTGAGCATCGTGGCATTGCACGATGACATGGAGAGCAAGCCG