Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 229.0    0Xt7.1-CABJ9377.3                          229 PI      76        527      940                hypothetical protein LOC549535 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012070067 Xt7.1-TNeu126c10.3.5 - 954 ESTs
                                                                       .-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu126c10.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACGTCAGTTGCCGGCCGGCCTTATATAAGGTGTGTGCGCGCTGCGTGTTACTTCCCTTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTCGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCTTTAACTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTGTTTGGGGGTGGAGTTATTGGGCACATTGCTTCTCTAGAGCGGGCAGCCTAACTTTTGTTTTTCAGCCTTGATTCCTCTCTGCAAATCCCCTATTTGGCTAACTTGTGTTTTTGGTCTGACCCTTGTGGTGTGCAAAACCTTATTTGCCCTCCCTGTTTTGCCACACTGCGACACTCTACAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTTGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGTGCATGGCCTTCAATAAAGATCTTTAACTTGG
                                                  Xt7.1-CHK-1008221136                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTTGCCGGCCGGCCTTATATAAGGTGTGTGCGCGCTGCGTGTTACTTCCCTTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTCGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCTTTAACTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAxxxxTGTGTTTGGGGGTGGAGTTATTGGGCACATTGCTTCTCTAGAGCGGGCAGCCTAACTTTTGTTTTTCAGCCTTGATTCCTCTCTGCAAATCCCCTATTTGGCTAACTTGTGTTTTTGGTCTGACCCTTGTGGTGTGCAAAACCTTATTTGCCCTCCCTGTTTTGCCACACTGCGACACTCTACAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTTGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGTGCATGGCCTTCAATAAAGATCTTTAACTTGGTAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     3     3     3     3     3     5     3     7     3     9    12    20    95   103   125   139   142   161   160   177   174   190   189   199   191   201   199   205   199   205   201   206   204   208   204   207   202   207   206   209   205   210   210   215   211   218   213   220   214   221   217   222   219   226   223   229   223   229   226   229   225   231   233   239   237   243   237   243   244   249   247   253   253   259   254   263   255   263   254   264   255   265   253   266   256   268   257   268   251   264   249   264   251   267   245   265   253   272   248   271   254   273   252   274   250   271   243   273   244   272   248   274   244   266   233   255   226   252   220   246   212   242   211   242   204   237   203   235   202   235   181   220   181   216   161   208   167   208   172   205   166   200   162   196   160   190   151   188   153   187   153   183   145   184   147   177   146   175   134   166   132   163   130   155   129   154   129   151   128   150   123   145   127   149   124   148   130   151   123   144   117   143   112   136   110   134   102   119    96   116    97   115    98   116   100   118    99   118   101   120    99   122   100   118   104   119   105   123   104   123   104   123   105   124   107   127   106   127   107   130   107   134   113   141   113   142   116   145   112   142   119   150   131   171   144   184   147   190   156   193   153   195   168   209   185   225   184   224   189   232   206   249   211   263   252   292   264   305   272   313   279   322   289   333   280   336   298   346   302   348   305   354   321   380   375   430   404   454   400   467   400   481   443   493   439   493   455   494   458   497   433   496   457   495   463   494   450   494   454   499   434   500   457   498   444   501   462   495   468   496   470   497   457   498   437   498   458   497   463   496   455   496   467   493   465   493   453   491   460   493   457   493   438   486   443   487   449   485   390   482   432   480   429   477   440   479   436   477   415   465   433   466   436   464   210   451   207   441   206   436   197   428   191   416   175   402   178   397   153   365    83   174    56    80    28    48    16    30    14    27     9    23    10    19    10    15    10    13    10    13    11    12    11    12    11    12    12    13    12    13    14    15    15    16    15    16    16    16    16    16    16    16    16    16    17    17    17    17    17    17    18    18    18    18    19    20    20    20    20    20    21    21    21    21    22    22    23    23    23    23    24    24    25    25    25    25    26    26    26    26    25    26    25    27    25    27    25    27    24    28    26    28    26    28    26    28    25    27    25    28    26    28    25    27    24    27    26    26    26    26    26    26    26    26    24    24    24    24    24    24    23    23    22    22    21    22    21    22    21    22    21    22    21    22    20    21    21    21    21    21    20    20    20    20    17    17    16    16    17    17    17    17    17    17    17    17    17    17    17    17    15    17    17    17    16    16    16    16    16    16    15    16    15    15    15    15    12    15    12    15    12    15    12    14    12    14    12    14    12    13    11    12
  5   1   2  SIG                                    Xt7.1-TNeu126c10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTCGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCTTTAACTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2                                           Xt7.1-XZT52538.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCAAAAGGCAAAATTTAACTTGTACCCCCTCCCCCATTACCAAAACTGCAATCCCATAAAGACATCCCACATTTGTTGCATGCTTCTAGCTCTGATACTTGCAACGCATTCTGCCACTTACCCCCCAGGGTTGCGTTGAGGGGTTGACTTGTTGGAGACGCACATTGGCAGTAATATAATGGGAGCAGCTCATTTAGTTGGAAGCCTTTTGTTAGACAAATTGGTGAGTACTGGCACATGAATGGGTGTAAAGCAAAGGGAGAGGAAGCAGAACTCCTCTAGCCTTAGGTTTCACGATCCTCCCTCACCTGTATCGTAGTGGTCATGTCGAGACCTGCCAGAGGGGACAAATTCTCAAGTGAATCCTGGTTTCTCGCAAGCGCTTGCCTAGACGACACGCAGCACACAGCAATAAACTCTGGCTCCCAAATGCCTGTATTCATAGGGGCGGGTGTTCCCAGGATGTGTGCGCTTGTCGCTCAACTTGTAAGGTCTTGGCAAGACAAAAGCAGTGGGTGGCCAGATTTCTGAGCTTCTAATGAATGTGTGAGGTGGACCACTTCCAGTTTTCTTGAAGGTCCTCGAACTGAGCACATGAGGAGGCTGCTGTTGGCGCCAGTGGCTGTACTGCTGACAAGCAATCAGAGGTCACTTGACTATTAATAATGGGAGACTTTGGGCAGTGCAAACTACTGGTAAGGTGTGTGTGTTTGGGGGTGGAGTTATTGGGCACATTGCTTCTCTAGAGCGGGCAGCCTAACTTTTGTTTTTCAGCCTTGATTCCTCTCTGCAAATCCCCTATTTGGCTAACTTGTGTTTTTGGTCTGACCCTTGTGGTGTGCAAAACCTTATTTGCCCTCCCTGTTTTGCCACACTGCGACACTCTACAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCGACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTCGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCTTTAACTT
  5   1   2  SIG                                    Xt7.1-TNeu116m23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGGTTAGTACGTTCAATCTGTTTTTGCTCGGTGAAAGCCAATGAACGGACGACTGTTGTGAAATGTCATTGTTTTAAAGAAAGTGATTTGCTTTCTTTAACCTCTGCAATTCTCTTGAGTTTTGTTTTTCACAAAGGTGCGGTCTTTGTGGCAAGGCCTAGGCATGACATTCGGAGGACGCAAGGGGATGGAGGACTAGTGGAAATTGGCTGTCTGCTTCCAGTTGTGTAGAGAAGTGGAAAGCTGAGCATCGTGTGCCAGTATCTTCAAAAGGCAAAATTTAACTTGTACCCCCTCCCCCATTACCAAAACTGCAATCCCATAAAGACATCCCACATTTGTTGCATGCTTCTAGCTCTGATACTTGCAACGCATTCTGCCACTTACCCCCCAGGGTTGCGTTGAGGGGTTGACTTGTTGGAGACGCACATTGGCAGTAATATAATGGGAGCAGCTCATTTAGTTGGAAGCCTTTTGTTAGACAAATTGGTGAGTACTGGCACATGAATGGGTGTAAAGCAAAGGGAGAGGAAGCAGAACTCCTCTAGCCTTAGGTTTCACGATCCTCCCTCACCTGTATCGTAGTGGTCATGTCGAGACCTGCCAGAGGGGACAAATTCTCAAGTGAATCCTGGTTTCTCGCAAGCGCTTGCCTAGACGACACGCAGCACACAGCAATAAACTCTGGCTCCCAAATGCCTGTATTCATAGGGGCGGGTGTTCCCAGGATGTGTGCGCTTGTCGCTCAACTTGTAAGGTCTTGGCAAGACAAAAGCAGTGGGTGGCCAGATTTCTGAGCTTCTAATGAATGTGTGAGGTGGACCACTTCCAGTTTTCTTGAAGGTCCTCGAACTGAGCACATGAGGAGGCTGCTGTTGGCGCCAGTGGCTGTACTGCTGACAAGCAATCAGAGGTCACTTGACTATTAATAATGGGAGACTTTGGGCAGTGCAAACTACTGGTAAGGTGTGTGTTTGGGGGTGGAGTTATTGGGCACATTGCTTCTCTAGAGCGGGCAGCCTAACTTTTGTTTTTCAGCCTTGATTCCTCTCTGCAAATCCCCTATTTGGCTAACTTGTGTTTTTGGTCTGACCCTTGTGGTGTGCAAAACCTTATTTGCCCTCCCTGTTTTGCCACACTGCGACACTCTACAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTTGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGTGCATGGCCTTCAATAAAGATCTTTAACTTGGTTAAAAAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAGCAATAAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGCCTGTATTCATAGGGGCGGGTGTTCCCAGGATGTGTGCGCTTGTCGCTCAACTTGTAAGGTCTTGGCAAGACAAAAGCAGTGGGTGGCCAGATTTCTGAGCTTCTAATGAATGTGTGAGGTGGACCACTTCCAGTTTTCTTGAAGGTCCTCGAACTGAGCACATGAGGAGGCTGCTGTTGGCGCCAGTGGCTGTACTGCTGACAAGCAATCAGAGGTCACTTGACTATTAATAATGGGAGACTTTGGGCAGTGCAAACTACTGGTAAGGTGTGTGTGTTTGGGGGTGGAGTTATTGGGCACATTGCTTCTCTAGAGCGGGCAGCCTAACTTTTGTTTTTCAGCCTTGATTCCTCTCTGCAAATCCCCTATTTGGCTAACTTGTGTTTTTGGTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTGCGACACTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTAGGTTAGTACGTTCAATCTGTTTTTGCTCGGTGAAAGCCAATGAACGGACGACTGTTGTGAAATGTCATTGTTTTAAAGAAAGTGATTTGCTTTCTTTAACCTCTGCAATTCTCTTGAGTTTTGTTTTTCACAAAGGTGCGGTCTTTGTGGCAAGGCCTAGGCATGACATTCGGAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCTTTAACT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGTTAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -AC---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----T-------
                                               BLH ATG     115    1417                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH MIN     115     335                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               EST CLI      66      54                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Bf ---- 1e-042     AAM18861.1 unknown [Branchiostoma floridae] ------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 4e-077     BAA36711.1 DEAD-Box Protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN --- Cs ---- 3e-084     BAB12216.1 vasa homolog [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 4e-162     NP_001041134.1 F58E10.3a [Caenorhabditis elegans] ---------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Sc ---- 4e-167     NP_014287.1 ATP-dependent RNA helicase of DEAD box family; Dbp2p [Saccharomyces cerevisiae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 0          NP_648062.2 CG10077-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Sp ==== 0          XP_780035.1 PREDICTED: similar to DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 isoform 1 [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 0          NP_997777.1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 0          NP_990158.1 DEAD-box RNA helicase [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ==== 0          NP_031866.2 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 0          NP_004387.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5; DEAD/H (Asp-Glu-Ala-Asp/His) boxpolypeptide 5 (RNA helicase, 68kD); DEAD/H box-5 (RNA helicase, 68kD);RNA-dependent ATPase [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 0          NP_001084230.1 p68 RNA helicase [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 0          AAH82849.1 DDX5 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xt ==== 0          AAH63223.1 Hypothetical protein MGC76265 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu126c10.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------ATG---------ATG------------------TAA---------------------------------------------------------------TAG---------------------------------------------------------------------TGA---------------TGA------------------------------------------------------------TGA------------TAA------------ATG------------------TAA------TAA------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------ATG---------ATG------------------TAA---------------------------------------------------------------TAG---------------------------------------------------------------------TGA---------------TGA------------------------------------------------------------TGA------------TAA------------ATG------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2  SIG                                    Xt7.1-TNeu126c10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTCGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCTTTAACTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008268852                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTCGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCTTTAACTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg028e13.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTTGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGTGCATGGCCTTCAATAAAGATCTTTAACTTGGAAAAAAAAAAAAAAAAAAAA
  5   1   1           Tbd0 FL                     IMAGE:5379210.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTTGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGTGCATGGCCTTCAATAAAGATCTTTAACTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   16  add Gas7 5g3  in                          XZG3097.5p CTCAGCAGTAGGAACAAACCTTGAGCGGGAAGGCTTTCCCGCAGCCCCTCATGGGGCCCACTTGCACTTACTAATGGGGACTCTATGTAGCCCATATATGTATGAGGCAATATAGTTGTACCCATTGGGTGTGCCTGGCGGGGCTAATAAGGGAACACAGCCTTACTGGCCTTGCCTCATCCCACGCAACACACACTGACTAACATGAGCCACAGATAATAAAATTCCGGGAAAAGGCGCATTGCCGGTCACATGGTCACATCGCTTAGTCTCTGCCGCCATCTTTACTTTGGGCCGGTGTCCCGCTACCAGTACGTGGTCGATATCCCGCTACAAAAGCGGGAGCAGCCGCTGCCCCACGCTCACGGTTCAGTTTGCAATATCGTTGGGGCGGAAGCCAGGAAAAAGGTTAACACCGAGCGGCTGGTCGGTTTTTCTACTTGTTGGACAGGTTTCCCTGAAGCAATATGGCGGCGGTAGGTCAAGGCCCCGCCCCGCGGAGGAATATGGTGACGTCAGTTGCCGGCCGGCCTTATATAAGGTGTGTGCGCGCTGCGTGTTACTTCCCTTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCCATGAAGCA
  5   1   1       add Gas  5x                        TGas004k07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                        CGGAAGCCAGGAAAAAGTTAACACCGAGCGGCTGGTCGGTTTTTCTACTTGTTGGACAGGTTTCCCAGAAGCAATATGGCGGCGGTAGGTCAAGGCCCCGCCCCGCGGAGGAAATATGGTGACGTCAGTTGCCGGCCGGCCTTATATAAGGTGTGTGCGCGCTGCGTGTTACTTCCCTTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTATTCCCCTGGTACTTCCCCCATAGTAACTGCCCTATTGTGTGGCATCTGTCTGCCTGGGTATATTCCCATAGTAACTGCCCTATTGTGTGGCATCTGTCTGCCTGGGTATATTCCCATAGCAACTGCCCTATTGTGTGGCATCTGTCTGCCTGGGTATATTCCCATAGTACCTGCCCTATTGTGTGGCATCTCTATCTGCCTGGGTATATTCCCATAGTACCTGCCCTATTGTGTGGCA
  5   1   2       add Gas  5g                        TGas013m20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTCCCTGAACAATATGGCGGCGGTAGGTCAAGGCCCCGCCCCGCGNGAGAATATGGTGACGTCAGTTGCCGGCCGGCCTTATATAAGGTGTGTGCGCGCTGCGTGTTACTTCCCTTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATC
  5   1   2       add Neu0                               IMAGE:6993533                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTCCCACTCCGCTGCCACCACTTCCAACAAAAGAAGCTGGTACGGTCCGATTTCGGAATGTAAGCCGCTCCCGGAACGTTCCTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCCATCACGAACATCCAGATGTTGTGAGACGGACACCGCACGAATGTGACCAATACCGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGACGCAAGTCTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCCCTGACCCCACTCCTATTCAAGGGCCGGGATGGCCAGCGGATCTCATTGAGCTGGATAAGGCTGGTGTTGCAATGACTGGAATCCCGAAAGACCCGTAACCTATCGACTTGCCTGGGATTGTTCCAAATCCACCCATCTACTCATTCTTTACCAAGACGAGGGAGAATGGTTCCAAATTCCATCTTGGCTGCCTTTTCCCCCAACCGCTTGGTAAATCCGTTTTTATTGCCCGGTCCCCATATCACGCTGGACCACTCTATTACTCCTCTAGCGCACCACCCCCTCTCCTCATATTTTCTTAATGTATCACCCACTCCTGGGAAACTTTCTCATTTGGTTGCGGCAATCCCTTCCTCTATCAATGTTGGTAGACTCATTCCGCACGCAAGTACTCCGTCTTGCACCTATTATTGCTCCCATATATTGAACAGGGGCATTCGCTCTCTGAACACACAATAATCCCACCGCCGCGACTATTTTGGCGGCATAAATATCATACGTTTTACGCTGGTTTTATAAATCGCCCCTACTCCCACATATTCCCCGAGTGTTTTTTATCCCCATTTTTGGCAACACTGTCGTTCCCCGGCGGCTAATTCGGAAACCCACCCAAACTATACGCTCATTAAACCGTTCTCGGTACTCGGGCGCGTTATCACCTTATAATCCCAATTTTTTTTCCCCCCCCTCTTTGCCGCCCACCTCTTATAACCCACACCCTTTGTTATCATATGTGATCACNAAATGCCCCAACTCCTGTACACCCTTTTGCGGGATATCCCCTTGTTTTGCTAAAANAACCCATTTCGCCCCATCTCCTTCCTATCCACCCAACTTCGTATTCATCGCGCCCCGCCACCTACTTTAATACTTTATTTCATCCCGCCTCTCTGTAATTTTCCGGTTGTACCCCGCTTCATATGATTTTCGTCCCCTTGCCCGCGTGATATTTTATTTTATATACCGCCTCTTCGTCCTGTATCCACAACN
  5   1   2       ext In63                            IMAGE:8957363.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTATTTTTTTTTAATTAATTCTTAAAAATAAATACTCCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGGAAGGCTGATAGATTTTCTTGAGCAGAAAGACAATCTGACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGGATGCTTGAACATGGGGCTTTTGGAGG
  5   1   0       chi Fat1      in                         CABC1971.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGGTAAATCCCCTGCCCCTCATCTCTGCAGCTCTTTATGTTGTGTTGGAATCGGCCTGACCGCTCTGTCTCCCTATAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGAACCGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGAC
  5   1   2       add In62                            IMAGE:8956396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAATTTTAATTAAGGTTTTATATATTCGAATTCGTCCCGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGCTGATAGATTTCCTTGAAGCAGAAAGACCATCTGAACAGATGCACATATCTAGTGCTGGATGAGCTGACAGATGCTTGACAATGGGCTTTGAGCTCAGATCAGAAAGATAGTGCATCAAATCGACCTGAACGACCGACGCTGGATGTGGAGTGTCCCACGTTGGCTCAAAGAAAGG
  5   1   2       add In63                            IMAGE:8960171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTTGGTTCTTTTTTGAGTGATCTCTTCTATTCAAATTCGTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGGAAGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGATGAGCTGACGATGCTGGACATGGCTTTGAGCTCAGATCAGAAAGATAGTGATCAATTCGACTGAACAGAACGGAACGCCTGTA
  5   1   3        nb HeRe      in                     EC2CAA25DG05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGCCGGGGCCCTTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTAT
  3  -1   2       ext Te5       out                        CAAO8429.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGCGATCTAGAACTAGGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGAT
  5   1   3        nb 1030                            IMAGE:7091527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCCCTTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTG
  3   1   3        nb HeRe                             EC2CAA36BA02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCCCTTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCAAGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAAATGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCC
  5   1   3        nb 1030                            IMAGE:7091085.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCCCTTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTG
  5   1   3        nb Neu                            TNeu009i23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGGGATTCCCCGGGCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTGCTGGGATTGTGCATATGAACCATGAGGCATTGCTACAGCGAGGAGATGGTGCAATTCTTTTGGTGCTGGCACCAACC
  5   1   2       ext HeRe      in                      EC2BAA1BF07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCCTTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGA
  5   1   3        nb HeRe      in                      EC2CAA1BF07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCCTTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCATGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACC
  5   1   2       add Gas7      in                         XZG18808.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCACGCGTCCGGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGTCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTA
  5   1   3        nb Gas1      in                       IMAGE:6989776                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCGGGATCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTTGAGCANNGAAGACCNATCTGAACAGATGC
  5   1   3        nb Gas1                               IMAGE:6986691                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCCCGCGAATTCCCCGGGATTGTACAGCCGCTCCCGGAACGCCCTTATGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACTTGATCTTGAAGAAGAGTTGAAATCTGCATTGCTTCACCCGGAAGGCTGAAAATTTCTTTGAGTCAGAAAAACAATCTGAACAGATGCACTTATCTATGGTGGATGAACCTGACGGATGT
  5   1   3        nb 1030                            IMAGE:7025743.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTG
  5   1   3        nb 1030                            IMAGE:7029512.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCTGCCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCACACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTG
  5   1   3        nb Tail      in                         CBSW9547.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCNCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGNGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAA
  5   1   3        nb Egg                            TEgg103p09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAA
  5   1   3        nb Neu                            TNeu111j19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAG
  5   1   3        nb Egg                            TEgg113d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTG
  5   1   3        nb Tbd0                               IMAGE:6978618                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGATCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCAAAGGGNACACAGATACGTGATCTAGAAAGAAGAAGTGAAATCTGCATTGCTACACCGGAAAGCTGATAGATTTCTTTGAGCAGGAAGACCATCTGAACAATGCAATATCTAGTGCTN
  5   1   3        nb Abd0                               IMAGE:7017907                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAA
  5   1   2       add Gas7      in                         XZG22867.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGG
  5   1   3        nb Thy1      in                       CBST13427.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGCCCTCCCGTCTGTCAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGAGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCA
  5   1   3        nb Gas       in                   TGas056i22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAATAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAAGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAAGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGAGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGAGAATTGGCTCAACAAGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGT
  5   1   3        nb Gas       in                   TGas122f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGAATTGGCTCAACAGGGTTCACAAGTGGCAGCTG
  5   1   3        nb Tbd0                               IMAGE:6979916                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGATCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCTTTTGAGGTCCACCTGTATTTATGGGGGGAGCTCCAAAGGGGACCACATATACGTGATCTAGAATAAGGAGTTGAAATCTGCATTGCTACCCCCCGGAGGCTGATAAATTTCCTTGAAGCCGGAAAAACCAN
  5   1   3        nb Gas7      in                         XZG23218.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCA
  5   1   2       add Gas7      in                         XZG62678.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGC
  5   1   2       add Gas7      in                         XZG65999.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACT
  5   1   3        nb Thy1                                CBST5077.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCCTGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGC
  5   1   3        nb Egg                            TEgg110k10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGT
  5   1   2       add Gas       in                   TGas064k22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGGGCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCTCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCT
  5   1   3        nb Gas                            TGas110a15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTT
  5   1   3        nb Gas                            TGas112g02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGGGCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTT
  5   1   2       ext Gas       in                   TGas114p12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGGGCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGGCTCACAGGTTCAAACAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTT
  5   1   3        nb Gas                            TGas129l24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAAGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTA
  5   1   3        nb Gas1      in                       IMAGE:6990463                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCCACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACANCCGGAAGGCTGATAGATTTCCTTTGAGCANGGAAGACCNATCTGACAGATGCACTATCTAGTGCTGGATGAACTGACGGATGCTGACATGGCTTGAGCTCGATCAGNGATA
  5   1   3        nb Neu                            TNeu019k19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCT
  5   1   2       ext TbA       in                  TTbA008k04.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGT
  5   1   3        nb HdA       in                   THdA047c10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACA
  5   1   3        nb Brn2      in                         CAAJ6278.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGANAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACA
  5   1   3        nb Brn2      in                          CAAJ645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTA
  5   1   2       ext Gas7      in                         XZG33942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTAGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGCCCCAAAGAAGTCAGCAACTTGCT
  5   1   3        nb Thy1      in                        CBST8299.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCNCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGNGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTAC
  5   1   3        nb Egg                            TEgg144i01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGGCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAACTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGAC
  5   1   2       add Neu       in                   TNeu051j09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGT
  5   1   2       add Neu0      in                       IMAGE:6992165                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCGAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGCATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAAGTCCACCTGTATTTATGGGGGAGCTCCAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAAGCTGATAGATTTCCTTGAAGCATGAAAGACCATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTTCGACTGGACGAAAGACCCTGAATGTGAAATGCCACTTGGCGCCAAAGAAATCAGGCGAACTTGGCTGAAGAACTTCCCTCACGAAAATATC
  5   1   3        nb Abd0                               IMAGE:7017733                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGGATCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGNGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCTTGNA
  5   1   2       add AbdN                               IMAGE:7024101                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGNGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCCGCAGAATGTGACCNATACNGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTTCCAGCCAATCTCATGGGAGTGGGTAAAACGGAGAAACTCCCCTGACCCCCCTTCCTATTCAAGGGCAAGGGATGGCCCATGGGCCCTAAATGGGGCCGGAAAATGGTTTGGGGTTTCCAAAAACCGGGAATCCGGAAAAAAACCCCTTTTTCTTATTTTCCTTTCCCGGGGGGATTTGCCCATATATAAAACCCTTTAAGCCCTTTTTTCTTAGGGGGGGGGGAAAAGGGGGCCCCAATTTTTTTTTTGGGGGCGGGGGGCCCCCCAACCCCGGGGGAAAGTTGGGCCCCCCAAAGGGGTTTCACAACAAAGGGGGGCCCCCCTTATATTTTTTGGGAAAACATTTTTTCCTTTTTTTTGGGGGCCCCCCCCCTCTTTTTTTTGTGGGGGGGGGGCCCCTCCCCAGGGGCGGCCCCCCAAATTTTTTTTTTTTTTTTTTAAAAAAAGAGAGGGGGAGAATTTCTGTGTTTTTTGCCCCCCCCGCGGGGGGGGGGGGGAAAAATATTTTTCTTGGTGGTGGGGGAGGAAAAAACACCTTCTTTTAAAGAAAAGGG
  5   1   3        nb Neu0      in                     NISC_ng06b12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTG
  5   1   3        nb Te1       in                         CBWN5562.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCG
  5   1   3        nb Neu       in                   TNeu072c13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAATAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGATGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTG
  5   1   2       add Tbd0                               IMAGE:6980034                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATNCACCCATCACCCATTCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCCAGGGAATTGCCTCAACAGGTTCAACAAGTGGCAACTGATTATGGAAAAGCTGTCGTTTGAGGTCACCTGTATTTATGGGGAACTTCAAGGGACCCCAATCCTTGTTCAAAAAAGGATTTAAATCCGTT
  5   1   0       chi Gas                            TGas005h06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTCCCGTCTGTACAGCCGCTCCCGGNACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCANGATAGTTATTTAATC
  5   1   3        nb Gas                            TGas046m14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCGGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCG
  5   1   3        nb Gas1      in                       IMAGE:6990205                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGATCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCANGAAAGACCATCTGAACAGATGCACATATCTAGTGCTGGATGAAAGCTGACGGATGCTTTGACATGGCTTTGAGCTCAGATCNAAAAN
  5   1   3        nb Gas1      in                     NISC_mq12a10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATT
  5   1   3        nb Brn4      in                        CAAL10427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCCTTGAGCAGGAAAGATTAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATC
  5   1   3        nb Te3       in                         CAAM3965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGANAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCANATTCGACCTGACAGACAGACGCTGATGTGGAG
  5   1   2       add Te5       in                         CAAO4416.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGGCTTGAGCCTCAGATCAGAAAG
  5   1   3        nb Thy1      in                        CBST8378.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGNGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACA
  5   1   3        nb Gas                            TGas120p09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGAACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATAT
  5   1   3        nb Tbd0      in                       IMAGE:6977205                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAGAGGAGTTGAATCTGCATTGCTACCCCCGGAGGCTGAAGATTCCTTTGAGCAGAAGACCATCTGACAATGACTTTCTATGGTG
  5   1   2       add Tbd0                               IMAGE:6978567                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGGACACAGATACGTGATCTAGAAAGAGGAGTTGAATCTGCATTGCTACACCCGGAGGCTGATAAATTCCTTGAAGCAGGAAGACCAATTGAACGAGCACTTTCTATGCTGATGACCTACGGAGCTGACTGGCTTGACCTCATCAAAAAATGGAC
  5   1   2       add Tbd0                               IMAGE:6978569                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGATGTTCGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGATATGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCGAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAATGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCCCCTCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCCATTCCTTTGGTGCTGGCACCAACCTAGGGAATTGGCTCAACAGGTTCAACTAGTGGCAGCTGAATATGGGAAAACTTGTCCTTTGAGGCCCACCTGTATTTACGGGGGACTCCCAAGGGACCCCAAATTCCTGTTCTATAAGAAGAGTTGAAACCGCATTGGCTCCCCGGAAGGCTGATAATTTCCTTGAAGCAGAAAAAACAATCCGAACAATGCCCTTCCCAGGCTGGAGGAATTTACCGATGCTTGAATGGCTTTGACCCCAAATCAAAAATATGAACAN
  5   1   0       chi Neu0                               IMAGE:6993076                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGATGTCTGTACAGCTGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACCGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTTCTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACCGATTCGTGATCTAGTAAAGAGGAAGTTTAAATCCTGCATTGGGCTCAACCCCGGAAGGCTGAATAAATTTCCCTTGGAAGCAGGGGAAGACCAATTCTTTAATTTGTTTGCCCTTATTCTAGGTGGCTGGGATGGAAACCTGAAACCGGGATGCTTTGACCTTGGGGCTTTTTAACCCCCCTCATTCTGAACAGAAAAGTGGGAATCCAAATTTGCGACCCGGGAACAAAAAGAAACCCTAGTAGTTGTGGAAATGCCCATTTTGGGCCCCA
  5   1   0       chi Neu0                               IMAGE:6994104                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCTTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGGACACAGATCCGTGATCTTAAAAGAGGAGTTGAAATCTGCATTGCTACCCCCCGGAAGGCTGAAAGATTTCCTTGAAACCGGGAAAGACCCAATCCGGAACAGAATGCACCATATCTTAGTGCGCTGGGTTGAAACCTTGAACCGGCATGCCTTTGGACATTGGGGCCTTTTGGAGGCCCTCTCAGAATTAAGGAAAAAGATTTGGTGGGGACTCGCCAATTTTCTGA
  5   1   3        nb Abd0                               IMAGE:7017883                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTTGAATCTGCATTGCTACACCN
  5   1   3        nb Neu0 5g3  in                     NISC_ng26a03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGANAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTT
  5   1   3        nb Gas                            TGas014b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAG
  5   1   3        nb Gas                            TGas050a20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGGCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTT
  5   1   4      seed Gas7      in                         XZG56318.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCANGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGT
  5   1   2       add Egg       in                   TEgg010n24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGG
  5   1   3        nb Egg       in                   TEgg025a03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCCCTT
  5   1   3        nb Egg                            TEgg138p09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGG
  5   1   3        nb Gas       in                   TGas074j20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTT
  5   1   3        nb Neu       in                   TNeu076n07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTG
  5   1   3        nb Neu                            TNeu103n19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATTATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCAC
  5   1   3        nb Neu       in                   TNeu104a23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTG
  5   1   3        nb Neu                            TNeu138p15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTG
  5   1   3        nb Neu                            TNeu138p16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCGTCTGTACATTCGCTGCCGGAACGCCCTTTGAATAACCCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATGTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTGCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTGCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAG
  5   1   3        nb Gas1                               IMAGE:6988784                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGNGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTTGAAGCAGGNAAAGACCAAATCTGAACAGATGCNACATATCTAAGTGCTTGGATGAAAAGCTGACCGGGATGCCTTGACAATGGGGCTTTTGGAGCCTTCCAGATCCAGAAAAGAATAGTGGGAATCAAAATTTCCGACCTGTGAACGAA
  5   1   3        nb Gas1      in                       IMAGE:6990922                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGANATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCTTTGAGCANGAAGACCATCTGACAGATCACATATCTAGTGCTGATGAGCTGACNGATGCTGACATGGCTTGAGCTCGATCAGAAGAAGTGATCAATC
  5   1   3        nb Gas1                               IMAGE:6988799                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGGCTTTGAAGCCTCAGGATCAGAAAAGATAGGTGGATCAAATTCCGAACCTGGACT
  5   1   3        nb Neu0                             NISC_ng02h01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGT
  5   1   0       chi Gas                            TGas007c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGGCACCGCATACACTTTCTTTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTCGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCTTTAACTTGGTTNAAAAAAAAAAAAATT
  5   1   3        nb Gas                            TGas027n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGA
  5   1   3        nb Neu                            TNeu003n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGNACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCANACCAGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCT
  5   1   3        nb Neu                            TNeu033g12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTT
  5   1   3        nb Neu                            TNeu038h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTCAGTATGGGAGAGCTTGTCGTTT
  5   1   3        nb Brn3      in                         CAAK4962.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGTCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGT
  5   1   3        nb Te5       in                        CAAO10819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGNGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCCTTGAGCANGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGG
  5   1   3        nb Te5                                  CAAO8051.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGC
  5   1   3        nb Gas7      in                         XZG21592.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCTTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTG
  5   1   2       ext Gas7      in                         XZG50367.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGC
  5   1   3        nb Tad5      in                         XZT71933.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGANAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCA
  5   1   3        nb Limb      in                        CBSU1166.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGAACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGANAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGG
  5   1   3        nb Te1       in                         CBWN5689.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGACTGATAGATTTCCTTGA
  5   1   3        nb Tbd1      in                        CBXT16619.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAG
  5   1   3        nb Egg       in                   TEgg075i19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGG
  5   1   3        nb Egg       in                   TEgg077c21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGA
  5   1   2       add Gas       in                  TGas096j06.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCAC
  5   1   3        nb Neu                            TNeu052j12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTG
  5   1   2       ext Neu       in                   TNeu126c10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTC
  5   1   3        nb Neu                            TNeu127f09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTGCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTG
  5   1   3        nb Neu       in                   TNeu130a11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGT
  5   1   2       add Gas1                               IMAGE:6990122                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTCACTCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAGGGACACAGATAGTGATCTAGAAGAGGAGTTAATCTGCATTGCTACCCCGGAGGTGATGATTCCTGAGCAGAAGCCATCTGACGATGCCTATTATCTGATAACGACGATCTACTGGCTTTACCAATAAAA
  5   1   2       add In63                            IMAGE:8957394.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATTTTATTTTTTTGCTAATCTCTTTAATTTAAAATTCGTCCCCCCGGATTCAACGACAGGGACCGCGCCCGGGACTTGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCCTTGAAGCAGGAAAGACCAATCTGACAGATGCACATATCTAGTGCTGGATGAGCTGACCGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGATCAAATTCGACTGACAGACCGACGCTGATGTGGGAGTGCCACTTTGGCTCCAAAAGAAGTTCAGGCCA
  5   1   2       add In63                            IMAGE:8960038.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTTTTAAATTAGAACTTATAACCTAATATAAAAAATCCCGCCTGCCCGGATTCACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAAAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAATGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTTGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCCAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAATCTGCATTGCTACACCCGGAAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAAGCTGAACCGGATGCTTGACATGGGCCTTTGATCTCAGATCCGAAAGATATGGATCGATCGACTGACGGACGGACGCTGATGTGGAAGGTCACTGGCCAAGAAGTCAGGCAACTTGCGTGAAGAACAT
  5   1   3        nb Egg       in                   TEgg063d23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGT
  5   1   3        nb Gas                           TGas083f01.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTCTGTACAACCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATT
  5   1   2       ext Gas7      in                          XZG4015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGANAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCC
  5   1   3        nb Spl2      in                        CBSS1659.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTG
  5   1   3        nb Te1       in                        CBWN10649.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGNGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGT
  3  -1   0       chi Gas       in                    TGas087h03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCTGTACAGCCGCTCCCGGAACGCCCTTTGTCTATCGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTTGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAAGGCATTTTAGTTGTT
  5   1   3        nb Neu0                               IMAGE:6995246                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGGCTTTGAGCCCCCAGATCAGAAAAGATAGTGGGATCAAATTTCGACCTGGACAGACAGAACGCCTGGATGTTGGAAGTGC
  5   1   3        nb Gas7      in                         XZG29993.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCCCCTGTATTTATGGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGAT
  5   1   2       add In62                            IMAGE:8955268.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAGATAGTGGATCAATCGACTGACGACGACGCTGATGTGGATTGCACTTGCTAAGAAGTCAGCACTGCTGAAAACTCCTCAAGATATGTTCATATAAATGTCCTGGAGCTCAATGCCACCAAATTCTCATGTGAGTGGTTTAATGGGAAGGAGTAAAAGCTTGTTCTTTGTAGTGAGCA
  5   1   3        nb Eye                                  CCAX7627.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGA
  5   1   3        nb Brn4      in                         CAAL7972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGC
  5   1   3        nb Gas8      in                          st28d03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTGTACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGG
  5   1   3        nb Gas                            TGas064h07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCTCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTT
  5   1   2       add Gas1                               IMAGE:6988967                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTCAAAATCCGGAACGCCCTTTGTGTAACTTTCCTGAAACGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGATGTCTTTACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGAAGAAGCTGGACGGGATGCTTGACATGGGGCTTTTGAAGCCTCAGGATCAGAAAGAATAGGGGGATTCAAATTTCCGACCCTGAACAAGAACAGACCGCCTGAATGTTTGGAAGTGCCCCACCTTTGGGCCCCAAAAAGAAAATTCAGGGCCAAACCTTTTGCCTTGAAAGAACCTTCCCCTCACAGAAGAATTTAATGTTTTCCCTAATTTAAAACAATTTTGGGTGTGCCCCCTCTGGGAAAACTCTCAAATGTGGGCCCAAACCCCCACCACAAAAATAATCCCCCCTTTCTCACAAAAATA
  5   1   3        nb Gas7      in                          XZG5572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACTCATCTGAACAGATGCACATATCTAGTGCTGGATGAAGC
  5   1   0       chi Gas7      in                          XZG6908.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGTAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGT
  5   1   3        nb 1030                            IMAGE:7026815.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTG
  5   1   3        nb Gas8      in                          st27m06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACA
  5   1   3        nb TbA       out                  TTbA070m22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGAC
  5   1   3        nb Gas8                                 st111b03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGC
  5   1   3        nb Thy1      in                        CBST7598.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCGCTCCCNGGAACGCCNCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCA
  5   1   3        nb Gas8      in                         st116j22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCNAAGGGACCACAGATACGTGATCTAG
  5   1   3        nb Gas8      in                          st26m06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCG
  5   1   3        nb Gas8      in                          st28m06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCG
  5   1   3        nb Gas8                                  st55n11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGG
  5   1   3        nb Gas8      in                          st97k02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGG
  5   1   3        nb Gas8      in                          st29m06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGCTCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACC
  5   1   3        nb Tad5      in                         XZT11376.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGCTCCCGGAAGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGANAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGAT
  5   1   3        nb Gas7                                 XZG11564.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCTCCCGGAACGCCCTTTGTGTACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTTAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGNGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTTCCTTGAGCAGGANAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAG
  5   1   3        nb Egg  FL   in                   TEgg028e13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTC
  5   1   3        nb Neu                            TNeu065i23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAG
  5   1   2       add In63                            IMAGE:8959157.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGAAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGTCCACCTGTATTTATGGGGAGCTCAAAGGGACCACAGATACGTGATCTAGAAGAGGAGTTGAATCTGCATGCTACACCGGAGCTGAAAATTTCTTGAGCAGAAGACAATCTGAACGATGCACTATCTAGTGCTGATGAGCTGACCGAGCTGACTGGCTTGAGCTCG
  5   1   3        nb Neu       in                   TNeu087b15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTGGGGGGAACATCCAATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTGCGAGGGCTTAACTGTGCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGA
  5   1   3        nb Lun1      in                         CABD8014.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCANATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAGTCAGGCAACTTGCTGAAGACTTCT
  5   1   3        nb Tbd0      in                     NISC_nl15b07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGAC
  5   1   3        nb Neu5      in                          ANHP473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTA
  5   1   3        nb Neu                            TNeu091c12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCT
  3   1   0       chi Gas       in                    TGas096j06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTCGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCTTTAACTGGTTAAAAAAAAAAAAAAAAAA
  5   1   2       add Gas1                               IMAGE:6986779                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAAGAAGAGGAGTTGAATCTGCATTGCTACCCCGGAAGCTGATAGATTTCTTGAACAGGAAGACCATCTGACAGATGCCTTCTATGCTGATAAGTGACGGTGCTGACTGGCTTGAC
  3  -1   3        nb Int1                                CAAP12776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCGACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGANAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGCCCCAAGGAGTCAGGCAACTTGC
  3  -1   3        nb Int1      in                        CAAP12967.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATC
  3  -1   3        nb Spl1      in                         CABK6449.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGT
  5   1   2       add Tbd0                               IMAGE:6977724                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGAACGCCCTTTGTGTAACGCCCTGCCCGGATTCTACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCATGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGCGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAAATTTCCTTGGAGCAGGAAAGACCAATCCTGACAGAAGCACTTATCCTTGTGCTGGAAGAAACCTGACCGGAAGCCTTGACATGGGGCTTTGGAGCCCTCAACATCAGGAAAGATGGGTGGGTTTAAAATTCCAACCTGGCCAAAACAATACGCTTTGAGGTGGAAGTTGCCACCTTTGGGCCCACAGAAAAAGTCAGGGCGAAATTTGCCTTGAAGAAACTTCCCTCACAAAAAATTATGTGTTCCTTTATTTTACCATAGGGGGGCCCCTAGGGAACGCCCCGCTGTGCCCAACCCACAAAAAATACCTTTCGCAAAATTGGGTTTGGATGTGC
  5   1   2       add Gas8      in                          st20a10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGTCGCACGAAAGATCGTTCCAACCCTCCACTGACGTTCAGGGCTGAATCGTCCGATAGAGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGA
  5   1   3        nb Lun1                                 CABD7033.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGANAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAAGTCAGGCACTTGCTG
  5   1   2       add Neu0                               IMAGE:6993850                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAACTGACCGGATGCTTGACATGGGGCTTTGAGCCTCAGATCAGAAGATAGTGGGAATCAAATTCGACCTNGACAGAACAGACGCCTGGATGGTGGAAGTGCCAACTTTGGCCCCCAAAGAAAGTCA
  5   1   3        nb Gas8      in                          st28c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGA
  5   1   3        nb Gas8      in                          st48f17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATA
  5   1   3        nb Mus1      in                         CABH9418.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGANAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCANATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGC
  5   1   3        nb In54                            IMAGE:8945906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCCAATTCTTTTGGTGCTGGCACCAAACCAGGGAATTGGCTCAACAGGTTCAAACAAGTGGCAGCTGAGTATGGGGAGAGCTTTGTCGTTTGAGTCCACCTGTATTTATGGGGGAGCTCCAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAAGCTGATAGAATTCTTGAAGCCAGAAAGAACATCTGACAGATGCACATATTCTAGTGCTGGATGAAGCTGACCGGGATGCTTGGACTGGGGCCTTTGAGCCTCAGATCCATAAAGAATAATGGATCTCAACA
  5   1   3        nb Te1       in                         CBWN7754.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCNCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGA
  5   1   3        nb Egg                            TEgg091c13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGAT
  5   1   3        nb Gas1                               IMAGE:6986350                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCCACCTGACAGACAGACGCTGATGTGGAGTGCCACTTTGGCCCAAAGAAATCAGGCAACCTTGCTGAAGACTTTCCTCCAGAGAATATGGTTCATATTTAACCATTGGTTGCCCTTGGAC
  5   1   3        nb Gas1      in                     NISC_mq25e12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCTTTGTGTAACGCCATGCCCGTGATTCACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAG
  5   1   3        nb Tbd0 FL   in                    IMAGE:5379210.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTA
  5   1   3        nb Neu       in                   TNeu115a06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGGTAAACGGCAGAACCTTACTGACCCCACTCCT
  5   1   3        nb TbA       in                   TTbA040b11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTTTGTGTAACGCCATGCCCGGATTCACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGAC
  5   1   3        nb Hrt1      in                         CAAQ3274.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGANAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCC
  5   1   3        nb Lun1      in                        CABD11147.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCANATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCANAGAAGTCAGGCAACTTGCTGAAGACTTCC
  5   1   3        nb Ski1      in                         CABJ6488.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTTTGTGTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGT
  5   1   0       chi Gas1                               IMAGE:6987265                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTTTTCGCCCCCGGATCTCACGACAGGGACCGCGCCCGGGACAGGGGATTTCGGAGGTGCGTCCTCGCTTATGGAGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTCTACTGACTGGATTTGGACACAACCTTACTTAATACAAACAAGGCATAGCCCCTGTTCACCCTCAACCCTTCCTACACCCGAGCAATCGCCCCCATACCTTGTCGTTGTCCTCCCAAAATCCGATATTTATTCATAATAATATCAAAAAGGGTCCACGTGCCCGTGGCCCATTCTGAACATCCTTGTGATAACTCCGCCTCCCCCTCTTATCTCCCATACCATTTTCCGGAAGTACCTAAAAATCTTTCCTTCTACACACCCTACTCCAATTAGTTTGTTTTTTT
  5   1   2       add Abd0      in                       IMAGE:7003210                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACTCTGNGGAGCGGCTTATGAAGAAGAAATGGAAACCTGGATGAACTGCCCAAATTTNGAGAAGAAATTTCTATCAGAACATCCAGATGTTGTGAGACCGACACCGCAGAATGTGACCCATACGGAAGAAGCCAAGAGATCCCCGTACGAGGGCTTAACTGTGCCAAGCCCGGTTTTGCATTTCATGGAACCAGTTTTCCCAGCAATTCTCCTGGAATGGTTTAAACGGGGAAAATTTCCCGTGACCCCACTCCCTATTTCAGGGGCCGGGAATGGCCCCGGGGGCTCCCAAATGGGGCGCGGAAATAAGGGGTGGGGGGTTCCCACAAAACCGGGGTCTCCGGAAAAAACCCCTTTTTTATTACCCACTTCTCCCCGGGGGGTTTTGCCCCCATAAAACACATAAAAACATTTTTTTTCCAAGGGGGGGGGGGAGGGGGGGCCCCCCCTTTTTTTTTTGGGGGGGGGGGCCCCCCCACACGGGGGAAGTGTGGTTCCCCCCAGGGGGTTTACAAAAAGGGGGGCCCCTTTCTTTTTTTGGGGGGGAAAATTCTCTTTTCTTTTTTTTAGGGGCCCCCCCCCCCTTTTTTTTTTTGGGGGGGNGGGGGGGTCCCCCCCCAGGGGGGCGGCCCCCCCCCAAATTTTTTGTGTTTTTTTTTAATTAAAGAAGGGGGGGGGGGAAAAAN
  5   1   0       chi Gas1                               IMAGE:6988147                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCCCCCACCCCGGAAATTGGGCTTCAACAGGTTCAACCAAGTGGGCAACCTGAAATATGGGGAAGAGGCTTTGGTCCTTTGGAAGGGCCCACCCTGTTTTTTTTTGGGGGGGGAAGCTTCCCAAAGGGGACCCCCCAAAAAACCGTGGAATTCCTAAAAAAAAAAGGGAGTTTGGAAAAATTCTTGGCCATTTGGGCTAACCACCCCCCGGGAAAAGGGGGTTGAAATAAAAAATATTCTCCTCTTGTGAAGACCCCCGGGAAAAAGAAACCCCCACTTTTTTGGAAAAACAAGGGATGTGGCCCCCAATTTATTCTTCTAGAAGGGGGCTCCCGGGAATATAAAAAAAACCTCTGCTAAACCCCGGGAAGAGGTCTCCTTTGTAAAAA
  5   1   3        nb Gas1      in                     NISC_mq19b06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGC
  5   1   3        nb TbA       in                   TTbA040j08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAAGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCA
  5   1   3        nb Fat1      in                         CABC7453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGANAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACT
  5   1   3        nb Te5       in                        CAAO12317.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACT
  5   1   2       add Gas1                               IMAGE:6988279                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATGCCCGGATTCAACGACTGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTTCGACCCTGACAGGAACAGACGCTGGATGTGGGAGNTGCCCACTTTGGGCCCCAAAGGAAAGTCAAGGCCAAACTTTGGCCTC
  5   1   3        nb Te5       in                         CAAO9870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGNGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCANGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACA
  5   1   3        nb Gas7      in                         XZG56171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAATAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCANATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCC
  5   1   3        nb Te1       in                         CBWN3538.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATGCCCGGATTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGC
  5   1   3        nb Gas8      in                          st29c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGCCCGGATTCAACGACNGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGANAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCANAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAANGAGGAGTTGAAATCTGCATTGCTACA
  5   1   3        nb Gas8                                  st16f05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGATTCAACGACAGGGAACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGC
  5   1   3        nb Neu                            TNeu010k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGNTTCAACGACAGGGACCGCGCCCGGGNACAGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTAC
  5   1   2       add In66                            IMAGE:8962884.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGAATTTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACTCGGAAGCTGATAGATTTCCTTGAAGCAGAAAGACCAATCTGACAGATGCACATATCTAGTGCTGATGAGCTGACGATGCTTGACATGGCTTTGGAGCTCAGATCAGAAGGATAGTGATCATCGACTGACGACGGACGCTGATGTGATGCCACTGCTAGAGTCAAGCACTGCTGAGACTTCTCAGAGATTATGTTCA
  5   1   3        nb Ovi1      in                        CABI13885.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCGGATTCACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTG
  5   1   3        nb Gas8                                  st50o16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGATTCACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAG
  5   1   3        nb Gas8      in                          st94i08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGATTCACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAG
  5   1   2       add TpA       in                   TTpA058g22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGCGTGGTACATCATGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGATAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGAC
  5   1   3        nb Egg                            TEgg131g24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACAC
  5   1   3        nb TpA       out                  TTpA035j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGATCCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGA
  5   1   3        nb HdA       in                   THdA048b21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACGACAGGGACCGCGCCCGGGACAGGGCGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGAT
  5   1   3        nb Int1      in                         CAAP9460.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCANATTCGACCTGACAGACAGACGCTGATGTGGAGTGC
  5   1   3        nb Liv1      in                         CAAR9693.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTC
  5   1   3        nb TbA                            TTbA073b22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATTCGGCAAATATGGAAACCCTGGGGAGCGGCTTA
  5   1   0       chi Gas                            TGas042d15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGACAGGGACCGCGCCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCANAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTC
  5   1   3        nb Gas7                                  XZG8369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCGCCGGGACGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTATGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCANATTCGACCTGACAGACAGACGCTGATGTGGAG
  5   1   3        nb Tbd0      in                     NISC_nl03e08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCG
  5   1   3        nb Gas8                                  st36b22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGGACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCG
  5   1   2       add In62                            IMAGE:8954499.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACAGGGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGCTTTGAGCCTCAGATCAGAAAGATAGTGATCAATTCGACCTGACAGACGACGCTGATGTGGAGTGCACTTGGCCCAAGAAGTCAGGCACTGCTGAAGACTTCCTAGAGATTTTGTCAATTACATGTGCCTGAGCTCATGCCACCACATATCTCGATTGTGATGGTGATGATGGGGAAGGATGAAAGCTGTCGTTGATGGAGATTTGATGAAAAAATAGACTATGTTGTGACCTAGCAATGTGACTGACTCAGTGAAGGATGGTGCTCAGGTAACTCTGTGTATAGCTA
  5   1   2       ext Fat1      in                         CABC5199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCATCGATTCAATTCGGCCGAGGGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCANAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGG
  5   1   3        nb Sto1      in                         CABG4375.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGATTTGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGANAGATAGTGGATCANATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTC
  3  -1   3        nb Int1      in                        CAAP14942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGAGGTGGTCCTCGCTTTGGGGGAAACCGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGNGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCANATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTTGGCCCAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCC
  5   1   3        nb TpA       in                   TTpA056c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAG
  5   1   2       add Gas1                               IMAGE:6986311                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGGGGCTTGGGTACCGGGGTCCGGGAATTCCCGGGGATTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAGAAGTCAGGCACTTGCTGAGACTTCTCAGAGATATGTTCTATTACATTGGTGCCTGGACTCATG
  5   1   3        nb Tad5      in                         XZT68812.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGGGGAGCGGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCANATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGAT
  5   1   2       add Tbd0      in                       IMAGE:6977321                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGCTTATGAAGAAAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGGGGAGTGCCACTTGGCCCCAAAAAAGTCAGGCCAACTTGGCGAAAAACTTTCCTCCGAAAATTAAGGTTCATATTTAACATTGGGTGGCCCTGGAAGCTCAATGGCCAACCCACAATATTCCTTCCAAAATGGTTGAAGGGGTGTAAAGGGAAGGGGGAAAAAGGGATGA
  3   1   3        nb HeRe      in                      EC2CAA1BF07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCTTATGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTTGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAAGATGGGGAGAAGGATGAAAAGCTTGTTCG
  3   1   3        nb Neu       in                    TNeu072c13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAGAAGAAATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGGAAAAAAAAAAAAAAAAAA
  5   1   3        nb TpA       in                   TTpA003l12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGGAACCTGGATGAACTGCCCAAATTTTAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACACGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTATGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACATGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAAGAAAGACCAATCTGAACAGATGCACATATCTAGAGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGAGAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCT
  3   1   3        nb Gas       out                   TGas090j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAAATGAACCTGGATGAATGCCCAAATTGAGAAGATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAGGGCTTGTTCGTTTGATGGAGGAAATTATGAGGAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu115a06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGGAACCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCCCCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGGAAAAAAAAAAAAAAAAA
  5   1   3        nb Fat1      in                          CABC904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTC
  5   1   0       chi Te1       out                        CBWN8545.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGATGAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGTCCTGAACTTTTTGGATGTGCCATTGCTCAGGTTGGTGTAATGGACATGTTGAAATTTCACAAATTTACAATTGGCCACGCGTGGACAACAGACTATGGCTGCTCAGA
  5   1   3        nb Eye       in                         CCAX4801.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAACTGCCCAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATT
  5   1   3        nb Neu                            TNeu020o20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACTGCCCAAATTTGAGAAGAATTTCTATCAANAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGG
  5   1   3        nb Gas7      in                         XZG23695.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAATTTGAGAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAA
  5   1   2       add In54                            IMAGE:8942733.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTGATGTAATAAAGATCACATCGATTCGATTCGTCCCGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCTCTGGAGCTCAGTGCCAACCACAATATCCTTTCAGATTGTTGATGTGTGTATGATGGGGAGAGATGAAGCTTGTTCGTTTGATGAGAATTATGATGAAAAAGAAAATAAGACCATATGTTTGTTGAACCAGAGGCCATGTGATGACTTGACTCGCAGGTGAGGAGATTGGGTTGACTGCCATTGGCAATCTATGGGTGCTA
  5   1   3        nb Thy1      in                        CBST4698.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAATTTCTATCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCANAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTAT
  3   1   3        nb Gas8      in                          st26m06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TNTCAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCNATACAGAAGAAGCAAAGAGATCNCCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGAGAAGGANAAAAGCT
  3   1   3        nb Sto1      in                         CABG4375.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGAACATCCAGATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCNCCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGG
  5   1   3        nb TbA       in                   TTbA077p18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGNGGAGCTCCAAAGGGACCACAGATACGTGATCT
  5   1   3        nb Neu       in                   TNeu119m04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATCCCCGGGGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCG
  5   1   3        nb Tbd1                                CBXT17965.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGTGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTG
  5   1   3        nb Neu                            TNeu022d16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAGACGGACACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTNTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTG
  3   1   3        nb Mus1      in                         CABH9418.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGACGGACACCGCAAGAATGTGACCATNACAGAAGAAGCAAAGAGATCNCCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTG
  3   1   3        nb Thy1      in                        CBST7598.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACCGCAAGAATGTGACCAATACAGAAGAAGCAAAGAGATCNCCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTAAAAAAAAAAAAAA
  5   1   3        nb Gas8                                  st18g09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAATGTGACCAATACAGAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGG
  3   1   3        nb Brn4      in                        CAAL10427.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGTGACCATACAGAAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTG
  3   1   2       ext Gas7      in                         XZG50367.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGAAGCAAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAAAAAAAAAAAGG
  5   1   3        nb Tbd1                                 CBXT4386.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGAGATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAG
  5   1   3        nb Gas7      in                         XZG23655.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATCACCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGAATGTTGATGTGTGTAATGATGG
  5   1   3        nb Gas7      in                         XZG50729.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGTACGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAGCTTG
  5   1   2       ext Liv1      in                         CAAR8039.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAGGGCTTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTCATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGGCTGCAAT
  3   1   3        nb Gas8      in                          st28m06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGCTTAACTGTCCAAAGCCAGTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGAGAAGGANAAAAGCT
  3   1   3        nb Gas       in                    TGas074j20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTTCGTTTGATGGAGGAAATTATGAGTGAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu104a23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCTGTTTGATGGAGGAAATTATGAGGAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8      in                          st27m06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTAACTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGAGAAGGAGAAAAGCT
  3   1   3        nb Gas8                                  st95i08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTAACTGTCCAAAGCCAGTTTTGCAGTTNCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGNCCAGTGGCTCTGAGTGGGCTGGATATNGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTNTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCNTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCANCAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCNCCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATNTGCATTGNTACACCCGGAAGGTTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGNTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGNCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCNTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATG
  3   1   3        nb Brn4      in                         CAAL7972.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGGGTG
  5   1   3        nb Gas8                                  st90g21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGTCCAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTCGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGG
  3   1   3        nb Tbd1      in                        CBXT16619.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTCCAAAGCCAGTTTTGCAGTTCCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTAAAAAAAAAAAAAAA
  5   1   3        nb Int1      in                        CAAP11454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAGCCAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAATATAAGACCATAGTGCTTGTTGAGACCA
  5   1   3        nb Brn3      in                        CAAK10527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTTTTGCAGTTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATG
  3   1   3        nb Gas8      in                         st116j22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCCATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGAGAAG
  3   1   3        nb HeRe      in                     EC2CAA15AG05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCATGAAGCAAGTTTCCCAGCCAATTTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTA
  5   1   3        nb HeRe      in                     EC2CAA15AG05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATGAAGCAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAG
  5   1   3        nb Neu       in                   TNeu117m15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGG
  3   1   3        nb Neu       in                    TNeu117m15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGGAAAAAGAAAAAAAAAAAAA
  5   1   3        nb Gas7      in                         XZG62143.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGAT
  3   1   3        nb Gas8      in                          st94i08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGAGAAGGATGAAAAGCT
  3   1   3        nb Te3                                  CAAM9318.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCCAGCCAATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGAGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAA
  3   1   3        nb HeRe                             EC2CAA38AG09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCCAATCTTCATGGAAGTGGTTAAACGGCCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAGTCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGAGAA
  3   1   3        nb Te1       in                         CBWN7754.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATCTCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAAAAAAAAAAA
  3   1   2       add Gas8      in                          st20a10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGAGAAGGAGAAAAGCTG
  3   1   2       ext HeRe      in                      EC2BAA1BF07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGTTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTTTTATTTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCTTACAGGGAGGAGATGGTCCAATTCTTTGGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCCCCTGTATTTATGGGGGAGCTCCAAAGGGCCCACAGATACGTGATTTAGAAAGAGGAGTTGAAATTTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATTTGAACAGATGCACATATTTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGCCCTGACAGACAGACGTTGATGTGGAGTGCCACTTTGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTCCCCGGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAATTTGGAGCCTAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                          XZG5572.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGGAAAAAAAAAAAAAAAGGG
  5   1   3        nb Brn4                                CAAL10589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGGAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGANATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGATCAAGAGGCGATGTGATGACTTGACT
  5   1   3        nb Thy1      in                        CBST8490.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGTGGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAG
  3   1   3        nb Gas8      in                          st29m06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTTAAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGA
  3   1   3        nb Tail      in                         CBSW9547.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACGGCAGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAAAAAAAAAAA
  3   1   2       ext Gas7      in                          XZG4015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAACTTCACTGACCCCACTCCTATTCAAGGGCAGGGATGGCCAGTGGCTTTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTTTTATTTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGGGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATTTAGAAAGAGGAGTTGAAATTTGCATTGCTACACCCGGAAGGGTGATAGATTTCCTTGAAGCAGGAAAGACCAATTTGAACAGATGCACATATTTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTTGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCCCAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAA
  3  -1   3        nb Ovi1      in                        CABI13961.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACTGACCCCACTCCTATTCAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGNGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTTCAGAGGTCTAGATG
  3   1   3        nb Te1       in                        CBWN10649.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAAGGGCAGGGATGGCCAGTGGCTCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAAAAAAAAAAA
  5   1   3        nb TbA       in                   TTbA035k03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGGCCAGTGGCTCCTGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACATATCCTT
  5   1   3        nb Gas7      in                         XZG27400.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAGTGGGCTGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTAGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAAATTGGTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAAAAAATA
  5   1   3        nb Gas                            TGas042e13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCGGGATATGGTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTG
  5   1   3        nb Neu                            TNeu052n19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGGTGTTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAAATTGTTGATGTGTGTAATGAT
  5   1   3        nb Gas                            TGas139c06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGCAATGACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTG
  5   1   0       chi Gas7      in                         XZG41408.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTGGATCCGGAAAGACCCTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTAGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCCACGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTAC
  5   1   0       chi Neu                            TNeu008i10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTCTTATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCC
  5   1   3        nb Liv1      in                        CAAR11310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTTATCTACTTCCTGGGATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGGTTAGTACGTTCAATCTGTTTTTGCTCGGTGAAAGCCATGAACGGACGACTGTT
  3   1   0       chi Te5       in                         CAAO4416.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGGAACTGCCGCACTATTATGATTGCCGCTGTTAGTCCTTCTTCGCTGTCCTACGACGACACTTACAATACGCTCAAGTACGCGAACCGAGCCAAGGACATAAAATCAGCAGTGAAGAGCAACGTAGTCAGCCTGGACAGTCACATTAGTCAATATGTGAAGATCTGCGAGCAAC
  3  -1   2       ext Spl1      in                        CABK10542.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTACTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGGTTAGTACGTTCAATCTGTTTTTGCTCGGTGAAAGCCAATGACGGACGACTGTTGTGAAATGTCATTGTTTTAAAGAAAGTGATTTGCTTTCTTTAACCTCTG
  5   1   3        nb Ski1      in                         CABJ7324.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGTCCATATCAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGGTTAGTACGTTCAATCTGTTTTTGCTCGGTGAAAGCCAATGAACGGACGACTGTTGTGAAATGTCATTGTTTTTAAGAAAGTGATTTGCTTTCTTTAACCTCTGNCATTCTCTTGAGTTNTG
  5   1   3        nb Gas7      in                         XZG46156.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGTCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAATTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCT
  5   1   3        nb Gas                            TGas009n03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGT
  5   1   3        nb Brn4      in                        CAAL19282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACTCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCA
  5   1   3        nb Int1      in                         CAAP2381.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATNCATTATGACTACCCGAACTCCTCA
  3   1   3        nb Gas                             TGas118f05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAACCATCAACCATTCTTACAGAGAGGAGATGGTCCAATTCTTCTGGTGCCGGCCCCAACCAGGGAATTGGCTCACCAGGTTCAACAGGGGGCAGTTGAGTATGGGAGAGCTTGTCGCATGAGGTCCACCTGTATTTATGGGGGAGCTCCTAAGGGACCACAGATACGTGATCTAGAAAGGGGAGTTGAAATCTGCCTGGCTACACCCGGAAGGGG
  5   1   3        nb Tad5                                 XZT31185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAACCATCAGCCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGGTTAGTACGTTCAATCTGTTTTTGCTCG
  5   1   3        nb Gas7      in                         XZG22633.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACCATTCCTACAGCGAGTAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGG
  5   1   3        nb Gas8      in                          st26n02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCATTCCTACAGCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGA
  5   1   3        nb Gas8      in                           st8e17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGAGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAG
  5   1   2       add Gas7      in                         XZG41636.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACATCAACCATCAACCATTCCTACAGCGAGGAGATGGTCCAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGNATATATCCACC
  5   1   3        nb Neu       in                   TNeu051b18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATTCTTTTGGTGCTGGCACCAACCACGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTATAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATTAGACCATACTGTTTGTTGAGACCAATAGGCGATGTGATGACTTGAC
  5   1   3        nb Eye       in                         CCAX8544.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGC
  3   1   3        nb Gas8                                  st96i08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCACCAACCAGGGANTTGGCTCANCANGTTCAACANGTGGCAGCTGAGTATGGGAGAGCTTGTCGTNTGAGGTCCNCCTGTANTTANGGGGGAGNTNCAAAGGGACCACNGATACGTGATCTNGAAAGNGGAGTTGAAATGTGCNTTGNTNCNCCCGGAAGGTTGATAGATTTCCNNGANGCAGGAAAGANCAATCTGAACAGATGCA
  5   1   3        nb Gas7      in                         XZG27053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTAGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCCGC
  3   1   3        nb HeRe      in                     EC2CAA25DG05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCACCAACCAGGGAATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGATGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCTAGATTGTTGATGTGTGTAATGATG
  5   1   3        nb Lun1      in                         CABD8824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATTGGCTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGC
  5   1   3        nb Gas                            TGas100n17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCAACAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCCAGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCA
  5   1   2       add Neu0                               IMAGE:6994516                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGTTCAACAAGTGGCAGCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCCGCGCAGCAAAACTGGCACCGCATACACTTTTCTTTACCCCAGGAAATATTTAAGCAAGTTTAATGACCCTGATCTCCCGTCCCTCCGGAGAAAGCAAAACCAAGGCCAATTCAACCCCCCAAAGCCTGCCTGCCA
  5   1   2       add In62                            IMAGE:8956151.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGGGAAATTAAGGGAGATCATACGATTCGAATTCGTCCCCCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAACTGGCACCGCATACACTTTCTTTACCCCAGGAATATTAAGCAAGTTAATGACCTGATCTCGTCCTCCGAGAAGCAAACCAGCATCACCCCAGCTGCTGCAGCTGGTGGAGGACGAGACGCTTCAGAGCAGAGAGCATGAACGACCGACGTGAACGTTTCTCTTTCAGCCAGCGGGTGGGTGTGCTACGGGTTAAT
  5   1   3        nb Gas       in                   TGas107p05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTGAGTATGGGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCCAGGTTGAGGAGGGATGGGTGGC
  5   1   3        nb Neu       in                   TNeu076i20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGAGCTTGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAAATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTG
  5   1   3        nb Neu                            TNeu001c07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAGCTTGTCGTTTGAGGTCCACCTGTGTGGATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCANATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAAATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAA
  5   1   3        nb Liv1      in                         CAAR3622.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGAGGCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCC
  5   1   3        nb Eye       in                         CCAX6182.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGA
  5   1   3        nb Gas7      in                         XZG42303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTTTGAGGTCCACCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCCAGGAATATAAAGCAGTAATGACCTGAT
  5   1   3        nb Ova1      in                        CABE11153.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGAGGTCCCCTGTATTTACTCGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAAC
  5   1   3        nb Gas7      in                         XZG50646.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCACCTGTATTTANTGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAAGCAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGG
  5   1   3        nb Te1       in                        CBWN13062.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGTATTTATGGGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTTCCAGAGGGTCTAGATGTGGGAAGATGTGAAATTTGTCATCAATTTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGATTTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAGT
  5   1   0       chi Gas7                                  XZG7969.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGGGGGAGCTCCAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTCGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTT
  5   1   3        nb Sto1      ?                          CABG4290.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGAGCTCCAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGC
  5   1   3        nb Bone                                CBTC2197.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCANAACTGGCACCGCATACACTTTCTTTACCC
  5   1   3        nb HdA       in                   THdA004g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGGGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCNATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGANTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCTATTATGACTACCC
  5   1   3        nb Gas       in                   TGas059k19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAAGTCTAGATGTGGAAGATGTGAAATT
  5   1   3        nb Neu       in                   TNeu054l06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACCACAGATACGTGATCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAG
  5   1   3        nb Gas7      in                         XZG43126.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGATCTAGAAAGCGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCA
  5   1   2       add Brn3      in                         CAAK6906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTAGAAAGAGGAGTTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAG
  5   1   3        nb Neu       in                   TNeu105g12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCCAGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGC
  5   1   3        nb Liv1      in                         CAAR6109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAACCAAGCCATCAACCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCA
  3   1   0       chi Neu       in                    TNeu051j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGGGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGGGATGTGATGACTTGACTCCCAGGTTGAGGAGGGATGGGTGGCCTCCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTTTTAAATGAGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTTTCGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATTTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGAAGGGCTGTAATGGGGGCAGGGCATGGCCTTCAATACTGGGTAGGACTGGTTAAAAAAAAAAAAAAAA
  5   1   3        nb Gas8                                   st7b12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCTGCATTGCTACACCCGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCC
  5   1   2       add Gas7      in                         XZG38651.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCATGCCAACGTCCTACCCCCCAATAAGCTGTTAAAGCACA
  5   1   2       add Gas1      in                       IMAGE:6990878                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAAGCAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAAAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGCAGCGGGGTGGGTGGACGGNGAACTAGACGN
  5   1   2       add In63                            IMAGE:8958209.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTGTGAAATGAACCAATCTGAACAGATTGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGGTTAGTACGTTCAATCTGTTTTTGCTCGGTGAAAGCCAATGAACGGACGACTGTTGTGAAATGTCATTGTTTTAAAGAAAGTGATTTGCTTTCTTTAACCTCTGCAATTCTCTTGAGTTTTGTTTTTCACAAAGGTGCGGTCTTTGTGGCAAGGCCTAGGCATGACATTCGGAGGACGCAAGGGGATGGAGGACTAGTGAAATGGCTGTCTGCTTCCAGTTGTGTAGAGAGTGAAGCTGAGCATCGTGTGCCAGTATCTTCAAGGCAAAATTAACTTGTACTCCCTTCCCTCATAACTAACTGCATTCCATAAGACATCCCACATTGTGCATGCTTCTAGCTCTGGAATCTGCAACGCATCTGCACTTACTCCTCCAGGTGGCGTTGGAAG
  5   1   2       add In66                            IMAGE:8963227.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGGCAGGAAAGACCAATCTGAACAGATGCACATATCTAGTGCTGGATGAAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCCATCAACCCCTAGCTGCTGCAGCTGGTGAGGACAGAGGACGCTTCAGAGGCAGAGGAGCATGAACGACCGACGTGATCGTTTCTCTTCAGCAGCGGGGTGGGTGTACCGGGCAACTATGATCTGTGGGTTTGCGCAGAGAGACCTTGGCACATTCCCGAATGCTCGCACAATTCCAATGGCTTGGGGCCACAGAATA
  5   1   2       add In62                            IMAGE:8956489.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGACTAACTGTAAGCAGAGAAATCACATTCGATTCGAATTCGTCCCAGCTGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGACGCTTCAGAGGCAGAGGAGCATGACGACGACGTGACGTTTCTCTTCAGCAAGCGGGGTGGGTTGGACGGAAACTATGACCGTGGGTTGCGCAAGAAGAGACTTTGCAACAAATCCCAATGGCTCGCCAACATCCAATGCTTGGGCCAAGATAATGAACTCCTTAACGCTACGACCATTGTTTCGAGTTGGGCTTCCGGCCGA
  5   1   3        nb Tad0      in                     NISC_no01a02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGACCGGATGCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTG
  5   1   3        nb Gas                            TGas013o03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGCTTGACTGGGCTTTGAGCCTCANATCAGAAAGAAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGAT
  5   1   3        nb Egg                            TEgg095m03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTTGACATGGGCTTTGAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGATCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGT
  5   1   3        nb Neu                            TNeu050p18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGCTCAGATCAGAAAGAAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATC
  3   1   0       chi Gas7      in                         XZG62678.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTTGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGTGCATGGCCTTCAATAAAGATCTTTAACTTGGTTAAAAAAAAAAAAAAAGG
  5   1   2       add Gas1      in                       IMAGE:6989538                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTCCGGGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACGTATTCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCATCTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAAAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCNGGGAAACTATGACCGTGGGTTTGCCGCCAGAGAGACTTTGGCACAAATCCTAAATGGCTCGGCAACAATCCAAAATGGCTTGGGGCACGAN
  5   1   2       add Gas7                                 XZG23133.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCCGATCTCCGTCCCTC
  5   1   3        nb Gas7      in                         XZG20859.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGGCAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGT
  5   1   2       add Gas7                                  XZG1465.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCTCAGATCAGAAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAG
  5   1   3        nb Ova1      in                        CABE13185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTTGGCACAAATCCCAAAATGGCTTCGGCAACAAATCC
  5   1   3        nb Tad5                                 XZT11721.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCANAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACA
  5   1   3        nb Gas8                                 st100g19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATAGTGGATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCA
  5   1   3        nb Gas7      in                         XZG53699.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATCAAATTAGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTTGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAAT
  5   1   2       add Tad5      in                         XZT22144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCAAATTCGACCTGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGGTTAGTACGTTCAATCTGTTTTTGCTCGGTGAAAGCCAATGAACGGACGACTGTTGTGAAATGTCATTGTTTTAAAGAAAGTGATTTGCTTTCTTTAACCTCTGCAATTCTCTTGAGTTTTGTTTTTCACAAAGGTGCGGTCTTTGTGGCAAGGCCTAGGCATGACATTCGGAGGACGCAAGGGGATGGAGGACTAGTGGAAATTGGCTGTCTGCTTCCAGTTGTGTAGAGAAGTGGAAAGCTGAGCATCGTGTGCCAGTATCTTCAAAAGGCAAAATTTAACTTGTACCCCCTCCCCCATTACCAAAACTGCAATCCCATAAAGACATCCCACATTTGTTGCATGCTTCTAGCTCTGATACTTGCAACGCATTCTGC
  5   1   2       add In62                            IMAGE:8953125.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGACAGACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGAGGCATGAACGACCGACGTGACCGTTTTCTCTTCAGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGTTTGGCGGCAGAGAGACTTTGGGCAACAAATCCCAAATGCTTCGCAACAATCCAAAATGGCTTTGGGCCCGATACATGGAACTCCTTTAACAGCTACGCACAATGTTCAGAAGTGGGTTCCGGCAGAGACCAGGAAA
  5   1   3        nb Tbd1      in                        CBXT12749.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACAGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCG
  5   1   2       ext Gas7      in                         XZG52490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCCAGAGAGACTTTGGCAACAAATC
  5   1   3        nb Gas7                                 XZG11003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCCAAAATGGCTTTGGGGCACAGAAATACA
  5   1   3        nb Gas7      in                         XZG59726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTC
  5   1   3        nb Tad5                                 XZT62757.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGACGCTGATGTGGAGTGCCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTC
  5   1   3        nb HeRe      in                     EC2CAA12CB07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAACATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTT
  5   1   3        nb Ovi1      in                         CABI7938.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACTTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCCATGTTCAGAGTGGGTTCCGGGCAGG
  5   1   3        nb Egg       in                   TEgg032p21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGGCCCAAAGAAGTCAGGCAACTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGG
  5   1   3        nb Egg                            TEgg139m17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGCTGAAGACTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGGTGGGTGG
  5   1   3        nb Tbd0                               IMAGE:6978917                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGATCTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTCGGCAACAATCCNCAAATGGCTTTGNGGCACAGAATTACATGAAACTCCTTTACAGCTACGGCACAATGTTCAGAGTGGGTCCGGGGCAGACACAGACGGCN
  5   1   3        nb Gas7                                  XZG9175.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACTTCCTCGAGATATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGC
  5   1   3        nb Tad0      in                     NISC_no09b07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTCCTCAGAGATTATGTTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGG
  5   1   3        nb Egg                            TEgg137b07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCATATTAACATTGGTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGGTGGGTGGGACCGGGAAAACTATGACC
  5   1   3        nb Gas7      in                         XZG28981.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGCCCTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAACTATGACCGTGGGTCTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTT
  5   1   3        nb Gas                            TGas024n19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGATTTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCNGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTA
  5   1   3        nb Gas                            TGas056b20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCATAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTATGCAAGCGGGGTGGGTGGGACCGGGAAAAC
  5   1   3        nb Gas                            TGas101n23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGAGCTCAGTGCCAACCACAATATCCTTCAATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAACTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAAGGCAGAGGAGGCATGAACGACCGACGTGACCGTT
  5   1   3        nb Gas7      in                         XZG54535.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAGCTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCAC
  5   1   2       add Tbd0                               IMAGE:6978371                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAACTATGACCGTGGGTTGGCGGCAGAGAGACTTTGCACAATCCCAAATGGTTCGGCACAATCCAAAATGCTTGGGCAAGATTACATGGAACTCTTTACACTACGCACATGTCAAGTGGTTCGGCAGACCAGACGCCTACAAATGTACNCGCACGATGTACTGCCTCAGCGAACTG
  5   1   3        nb Gas7      in                         XZG17189.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATATCCTTCAGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCCTGCAGCTGGTGGAGGACAGAGGAC
  5   1   3        nb Neu       in                   TNeu109p13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGATTGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAAGGCAGAGGAGGCATGAACGACCGACGTGACCG
  5   1   3        nb TpA       in                   TTpA066m17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGATGTGTGTATTGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAATATAATCCTACCATGATTGTTTGTTGATACCTAAAGGCGATGTGATGACTTGACTCCCACGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAACAGCCAGCAGGAACGTGACTGGGTCTTACATGAGTTCATACACCGTAAATCGCCTAGTCCTGATTGCCCAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCCCTTATGACTACCCGAACTCCTCATAGGATTATATCCTCCGAATTGGAAGAACTGCCCGCTAGCATCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGATATATTAAGCAAGTTAATGACCTGATCGTCCGTCCTCGCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGC
  5   1   3        nb Ova1      in                        CABE12197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTTGATGTGTGTAATGATGGGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCNACGTCCTACCCC
  5   1   3        nb Gas       in                   TGas120e02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGC
  5   1   3        nb Te5       in                        CAAO11287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGNGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCCACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACCGTCTACCCC
  5   1   3        nb TpA       in                   TTpA016j06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAAGGATGAAAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGGTCATGGGTTACCCCATGCCNACGTCCTACCCCCCATAAGCTGTTAAAGCACAGTCTGGTTTTTATTTCCTGTACTTGCTCTTTGTATCG
  5   1   3        nb Gas7      in                         XZG22723.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGCTTGTTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGNGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCCGCTGGCACTGCTACAGCACCAGCTGTCATGGGTTACCCC
  5   1   3        nb Ova1      in                         CABE7647.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACAT
  5   1   3        nb Te5       in                        CAAO12579.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTA
  5   1   3        nb Gas7                                 XZG20679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAG
  5   1   3        nb Gas7      in                         XZG61499.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATTATGAGTGAAAAAGAAAATAAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATTGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCAT
  5   1   3        nb Gas7                                  XZG7936.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAAGAAATAGACCATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCCTTGTATCG
  5   1   3        nb Gas8                                  st19b13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAGTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCA
  5   1   3        nb Gas7      in                         XZG64528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACA
  5   1   3        nb Gas8                                  st18b13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTTTGTTGAGACCAAGAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTC
  5   1   3        nb HdA       in                  THdA015j04.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTGTTGAGACCATAGGCGATGTGATGACGTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAAGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACATACGTTGCTTCCAGAGGTCTAGATGTGGAATATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCACAGGATTATATCCACCGAATTGGAAAAACTGCCCACAGCAACAAAACTGGAACCGCATACACTTTCTTTAACCCAAGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACATATGACGCTTCGGAGGCACACGATGCATGAACGACCGACGTGACCGTTTCTCTTCATGCAAGCGGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACGAATCACATAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGG
  3   1   0       chi Gas1                               IMAGE:6990898                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGGTATAGAGGAAGGGCTTGTGTCTAAGATGGAGCGTTGAGCGGTATTTGATCTTATAAACGTAATGTTGTAAAATTGTGATTTTAATTTAGGAAGTGTTATGGGAGGGTAACGCGTGATAAATATGGGCTTGTAGAATAGGAATGTATATTTGCCCCGCCAGGAATAATGAAGGAGGGAATTCGCTGGCTAGTGCAGGCCAGGCGATAAAGCGTTGTGTGCCTTGTATTTAGTAACTTTTTTTTTTTACTCCCTCAGGGAAAAGTTTTTTAAGGCTATGTTTTATTGAACCCGGTTTTTCCCGTTCCTTCTGGATGAAGGGCATTTGCCTGGGCCCATTCAATCCCCCCAAAGCTTGGTTGCAGGTTGGTGGGGGGAACAGAGGGACGCTTTCAGAAGGCCAGAGGGAGGCATGAACGACCCGACGGTGAACCGTTTTTTTTCAGGCCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCGACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCATGCAGGATAGTTATTTAATCCCAGCGGATTCTCGGAGGGAGCTGCAGCAGTGCCTGTGGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGACAATCATTCCAGAGGCCGGCGGTGGGGGGGGNGGGGCGGGGGGGGGGTGGTGGGGGGCGGGTGGGGGGGGGGGGGGGGGGTGGGCGGGTGGGGGGCGGGTTGGGCGGGGGTGTG
  5   1   3        nb Neu5      in                         ANHP1500.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCTTGGGGTTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCGACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCG
  5   1   3        nb Gas8      in                          st15n03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTC
  5   1   3        nb Spl2                                CBSS3501.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCCATAAGCTGTTANAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCTTTGTATCGTTTCCA
  5   1   3        nb Egg       in                   TEgg052a17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGATGTGATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTA
  5   1   3        nb Neu                            TNeu045m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGACTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTGTGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACC
  5   1   0       chi Neu                            TNeu140g12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTACAAAGGTGCGGTCTTTGTGGCAAGGCCTAGGCATGACATTCGGAGGACGCAAGGGGATGGAGGACTAGTGGAAATTGGCTGTCTGCTTCCAGTTGTGTAGAGAAGTGGAAAGCTGAGCATCGTGTGCCAGTATCTTCAAAAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGC
  5   1   2       add Gas       in                   TGas057a18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGGCAGCCTAACTTTTGTTTTTCAGCCTTGATTCCTCTCTGCAAATCCCCTATTTGGCTAACTTGTGTTTTTGGTCTGACCCTTGTGGTGTGCAAAACCTTATTTGCCCTCCCTGTTTTGCCACACTGCGACACTCTACAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTGGCAACAAATCCCAAAATGGCTTCGCAACAAATCCCAAAATGGCTTGGGGCACAGAATTACAATGGAAACTCCTTTA
  5   1   3        nb Gas7      in                         XZG41765.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATCCATGGTGATAAGAGCCAGCAGGAACGTGACTGGGTCTTAAATGAGTTCAAACACGGTAAATCGCCTATCCTGATTGCCACAGACGTTGCTTCCAGAGGTCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCGAACTCCTCAGAGGATTATATCCACCGAATTGGAAGAACTGCCCGCAGCAGCAAAACTGGCACCGCATACACTTTCTTTACCCCAGGAAATATTAAGCAAGTTAATGACCTGATCTCCGTCCTCCGAGAAGCAAACCAAGCCATCAACCCCAAGCTGCTGCAGCTGGTGGAGGACAGAGGACGCTTCAGAGGCAGAGGAGGCATGAACGACCGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAACTATGACCGTGGGTTTGGCGGCAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTCGGCAACAAATCCCAAAATGGCTTTGGGGCACAGAATTACAATGGAAACTCCTTTAACAGCTACGGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGCCAGCAGAATGGCTACAGTGCACCTCCAATGCAGAACAGCATGGCCCAACAGGCATACACATACCCAGCTGCCACTGCTACAGCACCAGCTGTCATGGGTTACCCCATGCCAACGTCCTACCCCCAATAAGCTGTTAAAGCACAGTCTGTTTTTATTTTCTGTACTTGCTCCTTTGTATCGTTCCATGCAGG
  5   1   3        nb Gas7                                 XZG46787.5p