Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAR8070.5                            2 END     2           0      100                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012070134 Xt7.1-TTbA008o12.3.5 - 404 ESTs
                                                                       .......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTbA008o12.3.5                                                                              CCGGCTAGAGCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221348                                                                                    AGAGCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                   4    13    15    30    37    45    41    50    56    64    64    74    73    83    78    88    78    90    79    92    81    94    85    96    87    97    88    97    89    98    89    98    90    99    90   101    91   102    90   102    90   103    91   103    91   103    89   103    92   103    92   103    92   104    95   105    97   107    96   106    99   107    97   106    98   108    99   108    99   108    99   108    99   107    98   108   100   108   101   109    93   106   100   108    89   107    87   105    87   105    89   108    91   110    86   112    88   112    88   110    89   111    88   110    88   109    88   107    89   108    87   105    88   107    88   109    90   110    88   110    87   107    87   107    87   106    87   107    82   103    83   104    83   103    81    99    85    99    87   100    88   100    88   101    85    94    85    94    75    84    75    82    74    80    67    72    66    71    63    68    64    68    62    67    60    65    60    66    61    67    61    67    61    69    61    68    62    68    64    68    66    69    66    71    68    72    69    72    69    72    69    73    68    72    67    70    67    70    64    67    64    68    65    69    64    69    66    70    65    69    68    72    68    73    68    73    66    71    64    70    62    69    61    67    61    67    61    68    60    68    60    69    57    68    57    68    57    69    57    67    55    66    56    66    59    68    56    69    58    69    61    69    59    67    44    64    43    62    41    62    43    62    42    60    41    60    37    52    36    52    37    56    35    53    35    52    32    50    32    49    33    49    34    50    36    51    35    50    35    51    35    50    33    49    34    51    33    51    36    55    36    55    38    58    48    71    49    73    56    82    55    90    69    94    82   104    95   119   103   126   113   138   117   142   121   147   125   154   133   161   134   161   141   167   141   169   142   170   145   173   144   174   146   174   148   177   156   184   157   185   163   189   164   188   166   190   169   193   167   193   167   194   170   193   167   192   168   191   169   191   166   193   167   191   171   193   168   193   166   193   168   192   167   192   161   190   164   189   164   187   164   188   162   186   164   185   164   185   163   184   161   184   160   180   162   180   159   180   158   180   161   179   158   179   156   179   154   178   156   176   152   175   148   173   151   172   147   172   151   173   152   173   147   172   147   171   145   169   146   169   142   165   137   160   135   155   125   151    96   117    31    48     8    12
  5   1   2                                           Xt7.1-CABJ7952.3                                                                            CCCGGGGCCCCGGGGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TTbA008o12.3                                                                                        CTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TNeu116f15.3                                                                                         TGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCCACAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCAATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCTTTTTTTTTTATAAGAAAAACAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTTCCATCTTTTTTTTTTATAAGAAAAACAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAA
                                                                   SNP                                                                                                                                                                                                                              -------TT---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                               BLH ATG      93     298                                                                              
                                               BLH MIN      33      51                                                                              
                                               BLH MPR      21      51                                                                              
                                               BLH OVR      93      44                                                                              
                                               EST CLI       2      28                                                                              
                                               ORF LNG      93       3                                                                              
                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 4e-015     NP_001076645.1 X-box Binding Protein homolog family member (xbp-1) [Caenorhabditis elegans] ---------------------=================================================================================================================================================================================================================================
                                                                                                                                                                         PROTEIN --- Dm ---- 2e-015     NP_726032.2 X box binding protein-1 CG9415-PB [Drosophila melanogaster] -----------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                              PROTEIN --- Gg ==== 2e-017     NP_001006192.1 similar to X-box binding protein 1; X-box-binding protein-1 [Gallus gallus] =====================================================================================================================================
                                                                                                                                                                         PROTEIN --- Ci ==== 3e-022     BAE06755.1 transcription factor protein [Ciona intestinalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                         PROTEIN --- Hs ---- 4e-045     NP_001073007.1 X-box binding protein 1 isoform XBP-1S [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                 PROTEIN === ?? ==== 6e-076     NP_001080523.1 X-box binding protein 1 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 5e-131     AAI10724.1 Xbp1 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                 PREDICTED = Xt ==== 6e-142     NP_001001199.1 hypothetical protein MGC76163 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTbA008o12.3.5                                                                                                                                                                           ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------ATG---TGA------------------------------TAA---------------------TAG---------------TAGTAG------------------------------------ATG------TGA------TGA------------------ATG---TAG---------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TAA------------------------------------------------------TGA------------------------------------TAA------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------TGA---------ATG------------------------------------TAA------------------------------TAA------------------------------TAG---------------------------------TGA---------------ATG------------------------------TAA------------------TAA---------------------------------TAA------TAA------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------TAG------------------------------------------------------------------------------------------TGA------TAAATG---------TAA---------------------------TGA---------TGA---TAA---------------------------------------------------------TAA------TAG---TGA---------------------------------------------------------------------------------------TAA------------------ATG---------------------------------TAA------------------------------------ATG
                                                                   ORF                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  3   1   1         - TpA                             TTpA010m11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                caatggcggtaaatggcccccgatggatgccaagtacatcccccttgacgtcaatggggaggggcaataacccaaatgggggttccactgacgtaaatGGGGGGTAGGGGGGCCTAATGGGAGGTCTATATAAACAAAGCTCGTTTAGGGAACCTCCTTTTTGCCTGGGGACGTTCGGAAAATTTCTTGGTTTAGGGGAACaaaaaaaaaaaaaaaaaaaaaataataaaaaaaaaaaaaaaaaattggaatataccccgggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2                                           Xt7.1-CABJ7952.3                                                                            CCCGGGGCCCCGGGGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAA
                                                  Xt7.1-CHK-1008269910                                                                                  GCCCCGGGGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAA
  5   1   2       ext TbA  5g3  in                   TTbA040e06.p1kSP6                                                                            CCCGGGGCCCCGGGGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAG
  5   1   4      seed Ski1 5g3  in                         CABJ7952.5p                                                                                                                   TCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGA
  5   1   2       ext Lun1 5g                              CABD6103.5p                                                                                                                                         ATCGATTCGCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGT
  5   1   3        nb TpA  5x                        TTpA064p01.p1kSP6                                                                                                                                             GCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCATGGGAGCCCCCAGGGTGATCTTTATCCCCGGGAATCAGTGTGAGCTGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCATGCCGAGCAGACCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAATAGACAGAGACTCACCCACCTCTCCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAGCAGAGTAGCAGCACAGACTGCTCGGGACATGAAAAAAGCCAGAATGAGTGAACTTGAGCATCAAGTGGTAGATCTAGAAATGGAGAATGAGAATCTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCGCGATCTTGTTGACTGAGAACCAGAAGCTACGCCAAAGATTATGCCTTAGCACCCTGGAGGTCAAGAAGGAACAAGAATTGCACGAGCTGAATCAGTCCATAAAAGATAAAGTCAGGCCGGACACCGGGTCCGCTGAGTCCGCAGCATGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGGCTGATCTCTTGATGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAG
  5   1   2       ext TbA                            TTbA073m07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGCCAGAATGAGTGAACTTGAGCAGCTAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGATGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTANGCGTTGAGACCAGCATAGTAGTTAAAAT
  3   1   2       ext TbA  5g3  in                    TTbA040e06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAA
  3   1   4      seed Ski1 5g3  in                         CABJ7952.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAATGCTCATAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  5   1   2  SIG                                    Xt7.1-TTbA008o12.3                                                                                        CTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008269906                                                                                              TTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAAAAAAAAAATAA
  5   1   1           Tbd0 FL                     IMAGE:5335429.FL-MGC                                                                                      AGCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAAAAAAAAA
  3  -1   2       add Gas5                                  XZF2080.3p GGAGTGCAAACACAATGCATCTATTTGAAGTAACATGTTACGCATGAATTCTGCAAAAGAAATGACAGCGACACACTTTATGTTCCTCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAACATTCACTGGAAGCCCCGATG
  5   1   2   10  ext Liv1 5g3  in                         CAAR8651.5p .........................................GAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATG
  5   1   0       chi Brn3 5x3  in                        CAAK10252.5p                                                        CGGACGCGTGGGCCCGGCTAGAGCTGTGCTTCCTCCTCCTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGTGATTATCTTGTCAATTCATTTATCAGTAGCTCATATTTGGTTGCCATGTTATTTAAGATCAGGGTACATTCTTTGGGTTAGGTGCCATTATTTAAACTTCCCATTTTATTCAGATTTAAATATGGAACCCAAAAAAACAGATTTACATGAGTACCATTTTTTTTTTTTTAACTTTTTGGTTAANAAAAAAAAAAAAATACTAAAGTTGCTGAGCTCTACAGGTGGCCATACACAGGCTGATAAAACCTGTCAACTCCATCTGTGGATTGATGCAGTCCTCATCCTAAGAGCCTGTATAGCTGCAATCATGGTCTGATGGTTGGC
  5   1   3        nb 1030 5g                         IMAGE:7092668.5p                                                                AAAGTAATTCCTACCCGGCTAGAGCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAAGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACCTTTCAA
  5   1   2       add AbdN 5g                            IMAGE:7022421                                                                     ACCATAGAACAGTTTCGGTTCAGGTTCGCGGGATCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAAGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAAACTATGTGCCCCTCTGGCAACAGGAGCAGGCCCAGATGTCTCCGAACCTGAACATTGGTCTAACATGGGATTCTGGACAGGCCCTGGACACTTTCAGACTCCGGAGTCCTGAATTCCTCTTGGTTGGGGCCTTTCTGGAAAAGGCCCTTGGACTCCAGAACTTGGTTGGCTTTGCCTAATGAAAGAAAGCATTTCCCTGGGGAAGCCCCAGCATGGAAATAGAATTCCACGGGAAAAAAGAATTCTGGAATTCCATTATTCCTTCCTTCCCCCAATCTTTCACCCGGGGGAGGGAACCCCCATTCAGCTCACAACTGGGGAGGGCCCATTTATATGGAAACTGGAATCCGCAATTTCCGATTGAAGCG
  5   1   2       ext TbA  5g3  in                   TTbA046c09.p1kSP6                                                                     CATGATAAATGCCTGCAAAATTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCT
  5   1   3   10   nb Bone 5g3  in                        CBTC2772.fwd .......................................................................GCGGCTAGAGCTGTGCTTCCTCCTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGG
  5   1   3   21   nb Bone 5g   ?                         CBTC6143.fwd ........................................................................GGCTAGAGCTGTGCTTCCTCCTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAA
  5   1   3        nb Neu  5g                        TNeu125b05.p1cSP6                                                                           CGGGGGGCTAGAGCTGTGCTTCCTCCTCCTCCTCTAAATGTCGCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCGGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCCCAGCACTCAAACTATGTGCCCCTCTGCA
  5   1   2   12  ext Tad5 5g3  in                         XZT27474.5p ............................................................................CCCGGCTAGAGCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAG
  5   1   3        nb Gas1 5g3  in                     NISC_mq01e10.y1                                                                              GGATCTAGAGCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACAT
  5   1   3   23   nb Gas7 5g                              XZG38636.5p ...............................................................................GCTAGAGCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCT
  5   1   2   12  add Gas7 5g3  in                         XZG40138.5p ...............................................................................GGCTAGAGCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGGTGAGACCAGCATAGTAGTTAAAATGGA
  3  -1   2       add HdA       in                   THdA008f06.q1kaT7                                                                                 TTCCTCCTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCGGCTCTCCCATTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCTTTGTGAGCAGCGCCGAGCGACCTTGGGATCCGTGAGTGTCTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACACCGCCTCACCCCGGAGGAGAAAGCGCTCAAAAGAAAACTAAAAAACAGAGTACCAGCACACACTGCTCGGGACAGGAAAAAAGCCTGAATGAGTGAACTTGACCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAG
  5   1   2       add Neu  5x                        TNeu006i20.p1kSP6                                                                                   CTAGAACTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAATGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGC
  5   1   0       chi Gas  5x                        TGas054k20.p1cSP6                                                                                    AGAGCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGGTGCGTCCGCTATGGTTCTGCGATTTAGTGCAGCTTGCGGCTCTGTAGCTACAACCCATTGAGCCCACGGCAGCTGCAGAACCTCAGGTTGTACATTGTGCTGGGTATTGGCTGCTATTGCCTGCTGCCTGCCTGGTCACACTGACTGCCCCCATAGCTGTGCTATTGTTCAGGAACAGGCAGGGTGCTGGGAGTCGTAGTGCAGTTGGAAGCCGTTTGTTGCTCATCACTTATATGTCTATGGAATTTCATTCACCCTAATGTCAC
  5   1   3   14   nb Brn3 5g3  in                         CAAK7305.5p ...................................................................................CTTCCTCCTCCTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCT
  5   1   3   14   nb Te4  5g3  in                         CAAN5693.5p ...................................................................................CTTCCTCCTCCTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCCTCCCATNCTCTCC
  5   1   3        nb Gas  5g                        TGas017p09.p1kSP6                                                                                      AGCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTNGAAAGCCTGGACTCAGACTTGTTGCTTG
  5   1   3        nb Neu  5g                        TNeu128b23.p1cSP6                                                                                       GCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTGGCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTGGGTGAGCAATGAGCTGCCCCCCAGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAGAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAAC
  5   1   3        nb Tbd0 FL   in                    IMAGE:5335429.y1                                                                                       GCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGA
  5   1   3   22   nb Tad5 5g                              XZT50914.5p ......................................................................................GCTGTGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACG
  5   1   3        nb Neu  5g                        TNeu100j05.p1cSP6                                                                                        TTCCTCCTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTGAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATC
  5   1   3        nb Gas1 5g                          NISC_mq21b01.y2                                                                                           TGCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAG
  5   1   3   12   nb Gas7 5g3  in                         XZG36121.5p ...........................................................................................GCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGG
  5   1   3   20   nb Thy1 5g                            CBST11537.fwd ...........................................................................................GCTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCC
  5   1   3        nb Egg  5g                        TEgg031m24.p1kSP6                                                                                             CTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGAAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCACGAGCTACGCCAAAGATTAGGCCTTACCACCCTGGAGGTAAAGA
  5   1   3        nb Gas  5g3  in                   TGas062b05.p1cSP6                                                                                             CTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAAC
  5   1   0       chi Gas1 5x                            IMAGE:6991090                                                                                             CTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCCTCCTCCCCATCTTCTCCTGTGGGGGACCCCATCAGCCCAAGCTGGAGGCCCTTTAATGAACTGATCCGATTCGATCACGTGTACCCCCCAGCCCCCTAAGCCCCGAAGGAAAAACTCCGGACCTAGGGCTTTGGAGACCCGCCCTTAGTAGTTTAAAATGGGAGGGAAGCTTCTTTTCAGCCCCCTACCATGGCCATGAAAGAACCTGACCCTGTGGGGAAAACAGGGAACCCCCCGGAAGGATGAAC
  5   1   0       chi Abd0 5x                            IMAGE:7003204                                                                                             CTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCGAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGGAGACCGGGGTCCGCTGAGTCCGCCACACTCAAACTATGTGCCCCTCTGGCAACAGGAGCAGGCCCAGATGTCTCCCAAACCTGGACAGTGTCTACATGGGATCCCTGACAGCCCCTGGACACGTTGCAAACTCTGGAGTCCGGATCTCCTTGGGTGGGGCCTTCTGGGAAAACCCGGGAACTCAAAACTTTGGGTGCTTTGGCCCTATGGAAAAAAACAATTCCGCTTGGGAAAGCCCCCGGAATTGAAAGAGGATTCCAACGGGGAAAGAAAAAGTTCTGGGAATATCCGTAATCCCCTCCCCTCCCACAGATATGTTCTTCCTGTGGGGGGGGGGACGCCCCCATTCCTGACCCAAAGGCCTTGTGGAGGGGCCCAATTTATATTGGAGAAGCGGGGATTCCCGCGAAATGTCTGGAATGTCCAGCAGGTGG
  5   1   3        nb TpA  5g3  in                   TTpA024c13.p1kSP6                                                                                             TTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGA
  5   1   3        nb Neu  5x                        TNeu001p04.p1kSP6                                                                                              CTTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGNATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAATGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGGAAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTATGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCC
  5   1   3        nb TbA  5g3  in                   TTbA063h13.p1kSP6                                                                                                 CTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCC
  5   1   3        nb Neu  5g3  in                   TNeu112n21.p1cSP6                                                                                                  TCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCATTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGATCCCCCAAAGTGATCTTTATCCCCGGGAATCATTGTGAGCATGCCGACGCCTTGGGATCCGTAATGTTACCCTTAATCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCATGAAGATACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCATAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAA
  5   1   3        nb Gas       in                   TGas068k06.p1cSP6                                                                                                     TCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGC
  5   1   3   12   nb Gas7 5g3  in                         XZG57126.5p ........................................................................................................CCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTTTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTTTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATAT
  5   1   3        nb Gas1 5g                            IMAGE:6988813                                                                                                          CTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAAACTTGTTTGCTTGCCTATGAAAAAGCATTCACTGGAAGCCCAGATGAAGAAATCAACGGAGAAGAGTCTGAGTCCTTATTCTCCTCCCCATCTTCTCTTGTGGGGAACCCCTT
  5   1   2   22  add Gas7 5g                               XZG9086.5p .........................................................................................................CTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGGTGAGCAGATGTCTCTGTATTATTCACATTGTAGGCTCTGGCTCTGCCAAAGACCTTTTGGAGTTGCACACTTAGGGCCCTGTGTTTTAAAATTCACGTTGCGGGGAAAAAATGCAATCGCGAGAAAAAATCCCACTGACAAAACGCACTTGACTTTTNCAGTCTTTTTTTTTTTTCCTCGAGCCGTACCTTATTTAAAAAAAAAAATATATATATTCTCGGGCGCGTTTTTTTGCGTGAAAGAAACAAATAA
  5   1   3   15   nb Brn3 5g3  in                         CAAK1854.5p ...........................................................................................................CCGCTGAGTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGA
  5   1   3        nb Gas1 5g                            IMAGE:6991127                                                                                                                  GTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTG
  5   1   0       chi Fat1 5x3  in                         CABC7905.5p                                                                                                                   TCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATNNTATGACTGATCCGATTCGATCACGTGTACACNCAGCCACTAAGCACAGA
  5   1   3   10   nb Liv1 5g3  in                         CAAR1627.5p ....................................................................................................................TCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGGACTGATCCGATTCGATCACGTGTACACCCAGCCACTAAGCACAGAGAAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAAGGGA
  5   1   3   10   nb Liv1 5g3  in                         CAAR7019.5p ....................................................................................................................TCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCT
  5   1   3   10   nb Lun1 5g3  in                          CABD653.5p .....................................................................................................................CCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTA
  5   1   3        nb Lun1                                 CABD8373.5p                                                                                                                       CCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACNCAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTC
  5   1   2       add Neu0 5g                            IMAGE:6995443                                                                                                                        CTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGNGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCCATTAATGAAACTGATCCCGATTCGGATCAACGTGTAACACCAAGGCCACCTAAAGGCACAGGAGGGAAAAACTTCTGTAGCCC
  5   1   3   14   nb Te4  5g3  in                         CAAN7074.5p .......................................................................................................................CTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGCCCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTG
  5   1   3   10   nb Tail 5g3  in                        CBSW12026.b1 .........................................................................................................................GTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGC
  5   1   2       add Lun1      in                         CABD7859.5p                                                                                                                            CCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGGTGAGCAGATGTCTCTGTATTATTCACATTGTAGGCTCTGGCTCTGCCAAAGACCTTTTGGAGTTGCACACTTAGGGCCCTGTGTTTTAAAATTCACGTTGCGGGGAAAAAATGCAATCGCGAGAAAAAAATCCCACTGACAAAACGCACTTGACTTTTCAAGTCTTTTTTTTTTTTCCTCGAGCCGTACCTTATTTAAAAAAAAAAAAATATATATATTCTCGGGCGCGTTTTTTTGCGTGA
  5   1   3   10   nb Fat1 5g3  in                         CABC1302.5p ............................................................................................................................CCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGTCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGGCATTAATGAACTGATCCGATTCGATCACGTGTA
  5   1   3        nb Fat1 5g3  in                         CABC2090.5p                                                                                                                             CCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGNGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGA
  5   1   3   10   nb Spl1 5g3  in                         CABK6927.5p ............................................................................................................................CCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGAAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGA
  5   1   3   32   nb Gas7 5g                               XZG3284.5p ..............................................................................................................................CCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGAAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTG
  5   1   3   12   nb Gas7 5g3  in                         XZG52306.5p ..............................................................................................................................CCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCGGATTCGATCACGTGTACACCAAGCCCCTAAG
  5   1   3        nb Abd0 5g                            IMAGE:7016036                                                                                                                                CTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAGGAGCATTCACTGGAAG
  5   1   3        nb Fat1      in                         CABC4552.5p                                                                                                                                 TGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAG
  5   1   3   10   nb Spl1 5g3  in                         CABK5870.5p ................................................................................................................................GTCTCCCACGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGA
  5   1   3   10   nb Liv1 5g3  in                         CAAR2854.5p ......................................................................................................................................CCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAG
  5   1   3   11   nb Int1 5g3  in                         CAAP9938.5p .......................................................................................................................................CCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGA
  5   1   3   12   nb Gas7 5g3  in                         XZG41821.5p .......................................................................................................................................CAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTTAAATGGAGGAAGCATC
  3  -1   3        nb Ovi1      in                         CABI8025.3p                                                                                                                                         NGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAG
  5   1   3   10   nb Spl1 5g3  in                        CABK11102.5p ............................................................................................................................................TGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAG
  5   1   3   10   nb Spl1 5g3  in                         CABK8754.5p ............................................................................................................................................TGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGT
  5   1   3   10   nb Liv1 5g3  in                         CAAR1750.5p ..............................................................................................................................................CCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGGAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAG
  5   1   3   10   nb Ski1 5g3  in                         CABJ1951.5p ...............................................................................................................................................CCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGA
  5   1   3   10   nb Lun1 5g3  in                         CABD4888.5p .................................................................................................................................................CACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCC
  5   1   3   12   nb Gas7 5g3  in                         XZG58591.5p .................................................................................................................................................CACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGA
  5   1   3   10   nb Int1 5g3  in                         CAAP8591.5p ...................................................................................................................................................CGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGTCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAG
  5   1   3   30   nb Mus1 5g                              CABH3257.5p ...................................................................................................................................................CGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGNGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCT
  5   1   3   30   nb Spl1 5g                              CABK3674.5p .........................................................................................................................................................CCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCC
  5   1   3   12   nb Tad5 5g3  in                          XZT9590.5p ..........................................................................................................................................................CCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTG
  5   1   3        nb Gas1 5g3  in                     NISC_mq18f03.y1                                                                                                                                                            CTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGA
  5   1   3   10   nb Spl1 5g3  in                         CABK4349.5p ..............................................................................................................................................................CACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGA
  5   1   2       add In54                            IMAGE:8943257.5p                                                                                                                                                                        CCCCCCGTGATCAACACTCCCGCGAGCCTCGATTCGTCCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAATGAAGAAGAATTGCACGAGCTGAATCAGTCCCGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCCGCACTCAGACTATGTGCCCCTCTGAAGCAGGAGCAG
  5   1   3   32   nb Gas7 5g                               XZG4968.5p .........................................................................................................................................................................AATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGT
  5   1   2       add In54                            IMAGE:8942952.5p                                                                                                                                                                                    AAAAAACGAAACAAAAGAAAAAGCGATTCGCATTCGTCCCGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCTCATCAGCCAGCTGGAAGGCCATTATTGACTGATCCGATTCGATCACGTGTACACCAGGCACTAAGCTCAGGAGGAAAACTCTGAGCTAGTCGTTGAAGACCAGCATATATTAAAATGAAAGAGCCATCTTTCGGCCCTACTTGCATGGTATGAACTGGATCCTGTGTGTGATCATGTTATCCACATAAGAATGACCTACTTGCTTGTCCTCCGGAAATGCCATGCTTTTGGGCCTGGTTTTCGGAACACACTCCTTTGTA
  5  -1   2       add Neu                            TNeu048j17.p1kSP6                                                                                                                                                                                          GCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGGTAATTTTCTAATTTCTCATTGTCATCTTAATGTTAAAAAACATACCCAGGTTTTTATTAAACAAGCATGATTATATACCAGTATAggatctgttatctggaaacctgctatccagaaagctctgaattaggaaggctatctcccatagagtccattataacaaataattcaaatgtttaaaaatgatttcctttttntcntgtaataataaaacaatgccttgtacTTTGTTCTAACTGAGATTTAATAAAACCTTATTGAGGCAAAAAAAAAAAAAAAAAAAGCGG
  3   1   2       add Spl1      out                         CABK595.3p                                                                                                                                                                                            TGTTCTTGTTGTTCAGACTGACAGCTTGATCTATTTGAACTCCAGTAAATGAAGAGGCACTGCAGCTCCCCTGCTTCAGAAGTGTCTAAACTTCAACCCCCCCCCCCCCAATGCCCATCTAGTGATTTCAAAAGGAAATTGCTTTAAGGGACATCCAATTTGTGGCCTTGTGGCATCTGAACTACAACTTCTGATATACTGCAGCAGCTCATTGGTTGTATTTCAACTACAGCTCAAAGCCTGTTGTTTTTGCAGTAAAGAGTTGCTTGTTAACCTTTGCATGCCTTGCTTTACCCAATGTAATTTGGGTAATGATACAGTGTATTGCATACGCATGTGTTACTGTACTGGCTTGCACAGCTATGTAACCTGCCTACTTTCTGGATTTTTCTTCCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGGTGAGCAGATGTCTCTGTATTATTCACATTGTAGGCTCTGGCTCTGCCAAAGACCTTTTGGAGTTGCACACTTAGGGCCCTGTGTTTTAAAATTCACGTTGCGGGGAAAAAATGCAATCGCGAGAAAAAAATCCCACTGACAAAACGCACTTGACTTTTCAAGTCTTTTTTTTTTTTTCCTCGAGCCGTACCTTATTT
  5   1   3        nb Tad5      in                         XZT72758.5p                                                                                                                                                                                                    CGGACGCGTGGGCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCT
  5   1   3        nb TbA       in                   TTbA001k21.p1kSP6                                                                                                                                                                                                        CTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCCACTAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGT
  5   1   3        nb Ski1      in                         CABJ5819.5p                                                                                                                                                                                                                 CGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCCACAGAAGATGACCTAGTCCCTG
  5   1   3        nb Ski1      in                         CABJ2311.5p                                                                                                                                                                                                                   GGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGG
  5   1   3        nb Tad5      in                         XZT29826.5p                                                                                                                                                                                                                                           CCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTG
  5   1   3        nb Liv1      in                          CAAR851.5p                                                                                                                                                                                                                                                                     AGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCCACAGAAGATGACCTAGTCCCTGTCCTCGGAAATGCAAGCTTTTTGCCCTGT
  5   1   2       add In63                            IMAGE:8958883.5p                                                                                                                                                                                                                                                                               AGTCCGGAAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAGCACAGAGGAAAACTCTGAGCTAGCGTTGAGACCAGCATAGTAGTTAAATGGAGGAGCATCTTTCAGCCCTACATGCATGAGACTGACCTGTGTGAACAGACCACAGAAGATGACTTAGTCCCTGTCCTCGATGCAAGCTTTTGCCTGTTCGAACCACCTTGAATCTACAACTTGATCAGAAGTGACTCTGGCTACGAGGGTGCTCTCACCCCTTTAGTGACTGTG
  3   1   2       add Brn3 5x3  in                        CAAK10252.3p                                                                                                                                                                                                                                                                                  AAACTTCAACCCCCACCCCCCCCAATGCCCATCTAGTGATTTCAAAAGGAAATTGCTTTAAGGGACATCCAATTTGTGGCCTTGTGGCATCTGAACTACAACTTCTGATATACTGCAGCAGCTCATTGGTTGTATTTCAACTACAGCTCAAAGCCTGTTGTTTTTGCAGTAAAGAGTTGCTTGTTAACCTTTGCATGCCTTGCTTTACCCAATGTAATTTGGGTAATGATACAGTGTATTGCATACGCATGTGTTACTGTACTGGCTTGCACAGCTATGTAACCTGCCTACTTTCTGGATTTTTCTTCCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGGTGAGCAGATGTCTCTGTATTATTCACATTGTAGGCTCTGGCTCTGCCAAAGACCTTTTGGAGTTGCACACTTAGGGCCCTGTGTTTTAAAATTCACGTTGCGGGGAAAAAATGCAATCGCGAGAAAAAAATCCCACTGACAAAACGCACTTGACTTTTCAAGTCTTTTTTTTTTTTCCTCGAGCCGTACCTTATTTAAAAAAAATATATATATATATTCTCGGGCGCGTTTTTTTGCGTGAAAGAAACAAATAATTACATTGTTCCGCTGATTTTCAATGAGGCTGAAAAACTTGCATGTATTAATAAACTG
  5   1   3        nb Neu                           TNeu067f19.p1caSP6                                                                                                                                                                                                                                                                                                   CCGGGGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTGACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAGAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTGAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTC
  5   1   3        nb Tad5      in                         XZT10321.5p                                                                                                                                                                                                                                                                                                                          CAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGGACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCCTG
  5   1   2       add In62                            IMAGE:8955568.5p                                                                                                                                                                                                                                                                                                                                                           ATTTATTTTTAATGTTTTTTCAAAATAAATAAATACCCCGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAAGCAAAGCTTTTTGCCCTGTTCCGAAACAACCTTGAAAATCATCAACATATTGGAAACAGAAGTGACTCTGGCTACGAAGGTGCTCTTCACCTTTATGACTGTCCTCCCCTCTGAACTCTGACGGGTGGGAAGACTCTTTCAGTACTGACTTCCTCAGCTCCTCCTCACAGAACCATTGACAAGTCATTGCCTCACTCCTGTTGATGCGTTCCTCGATCAGTAAGTGACACAGTAATTTAAATCTCTGGCAACCAATTGTGAATGGCTCTCGATATGGCAGGGTAAAGCTC
  5   1   0       chi Gas       in                   TGas132d05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                         CCGGGGGGCTAGAGCTGTGCTTCCTCCTCCTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGCCGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGGCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCG
  5   1   2       add In66                            IMAGE:8962534.5p                                                                                                                                                                                                                                                                                                                                                                                                   GCTACCGGGACAGGAAAAAAGCCAGAATTGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACACAGAGATGACCTAGTCCCTGTCTCGGATGCAAGCTTTTTGCTCTGTTCGAAACACTTGAAAATCATCAAACATATGATACAGAAGTGACTCTGCCTACGAGTTGCTCTCACTACTGACCTGTCTCCATCTGAACTCTGACGATGGGAAGACTCGTCAGTACTGACCT
  5   1   3        nb Gas       in                   TGas135c04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                 CGGGGATTCCCCGGGGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAG
  5   1   2       add In60                            IMAGE:8947868.5p                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGTAAATAAATAAAGAATTAAAAAATAAAAAATTCGTCCCCTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGGAGGAAGCATCTTTCATCCCTACTGCCATGAAGACCTTGA
  5   1   2       add Tad5      in                         XZT59926.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGACGCGTGGGGTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCNCCTCTGAACTCTGACCGGGT
  5   1   3        nb Ski1      in                          CABJ713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCNCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTTCCCTCAGCTCCTCCTCAGCNACCATATGGACCAGTCCATTTGTCCTTCAT
  5   1   0       chi Gas1                               IMAGE:6990992                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGATCCCTGCCCCCTTGGAATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCGGGAATCAGTGTGAGCAGGTTGACGCCTTGGGATCCGTAATGTTACCCTTAAGCAGCCCGAGCAGTCCGGAGTCGGTCAGCAATGAGCTGCCCCCCAGGAAGAGACAGAGACTCACCCACCTCACCCCGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGGACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGNAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTTGGGAAGACTCCTTCAGTACTGAAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGGACCAGTCCATTTGTCCCTTCATCTCCTGTTGATGCCCTTTTC
  5   1   2       add Gas7      in                         XZG41605.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGAGGAGAAAGCGCTCAGAAGAAAACTAAAAAACAGAGTAGCAGCACAGACTGCTCGGGACAGGAAAAAAGCCAGAATGAGTGAACTTGAGCAGCAAGTGGTAGATCTAGAAATGGAGAATGAGAAACTCTTGCTTGAAAACCAACTTTTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAAC
  5   1   3        nb Te5       in                         CAAO6858.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAAAACCAGGACCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAACGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGAGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGG
  5   1   0       chi Liv1      in                         CAAR2351.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAAGATATCTTGTTCCAAGTAAATTACATTTAGGGTGCCAACCCCAGGATATCGGGTCCTCGGGTTCACATATTAATCATTTATAAAAGCGTGTCCGTATCCCTTTCGCGTTTTCCCTATTTGTTACAGTTTCTGCACAGTATGGCATTCCATGTTGGGTACTACAGCTTTGTTATTTCTTCTTCAAAAGTGTAAATGCCTTTGTGTCTCTTTTACAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGGTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTG
  5   1   2       ext Sto1      in                        CABG10233.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACAT
  3   1   3        nb Gas       in                    TGas135c04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGTAAAGAAGGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCGTGTGCGAAACCCCAATATTGTGTACAAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Ovi1      in                         CABI6838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATCGATTCGAAGAAGAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTT
  5   1   2       add Gas7      in                         XZG31435.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATTGCAGGAGCTGAATCAGTCCAGAAAAGATAAAGTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCCATA
  5   1   2       add Gas                            TGas006k02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGAAATGGAGAATGAGAAACTCTTGCTTGGAAAACCAACTTTNTAAGAGAAAAATCTCACAGCTTGTTGACTGAAAACCAGGAGCTACGCCAAAGATTAGGCCTTAGCACCCTGGAGGTAAAGAAGGAAGAAGAATTGCAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTNTCAGTACTGA
  5   1   4      seed TbA       in                  TTbA008o12.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGTACAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTTGCATGCAGCTTTTCTTTACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGT
  5   1   3        nb Tad5                                 XZT16483.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCG
  5   1   3        nb Gas                            TGas005d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGCCGGAGACCGGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACA
  3   1   3        nb Te5       in                         CAAO6858.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCC
  5   1   3        nb Tad5      in                         XZT27483.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTCCGCTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTTGCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTT
  5   1   2       add In62                            IMAGE:8954276.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCCTCTATTACTTCTACAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACTTCTGTGCGAAACCCAATATTGTGTACATTGCGCCTTTCTTCAGATTGCCAGGTTACAAGCTTTGCATGCAGTTTCTTTACTGAACAGAATCTGCCACTCTATCTTTTTAACGAAAAACTTCCGGAATCAGGGAGCTAGAAA
  5   1   3        nb Gas       in                   TGas079j22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAGTCCGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGAC
  5   1   2       ext Spl1      in                         CABK3729.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCAGCACTCAGACTATGTGCCCCTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTA
  5   1   3        nb Gas7      in                         XZG31575.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTGCAGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGAAAAATCATTCTGTG
  5   1   2       add Neu                            TNeu088g24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGGAGCAGGCCCAGATGTCTCCGAACCTCAGTGTCGGCTGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATGGCGTGGGCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAAC
  5   1   3        nb Neu                            TNeu028d16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTA
  5   1   3        nb Gas7      in                           XZG813.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTCATGGATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCCTTTCTTCAGTATTGCCAGGGTACTAGGGCTTGCCATGCAG
  5   1   3        nb TpA       in                   TTpA016c04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCCTGACAGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCANGGAAGGGTCAGCTAAGAGCNACATACANATCTGATTAAT
  5   1   3        nb TbA       in                   TTbA002h09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGGCCCTGACACTTCAGACTCTGAGTCTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCA
  5   1   3        nb Sto1      in                        CABG10776.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGATCTCTTGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTA
  3  -1   2       add Ovi1      in                         CABI9569.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTTGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTT
  5   1   3        nb Ski1      in                        CABJ12279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGGCCTTCTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACANATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTT
  3   1   3        nb Tad5      in                         XZT10321.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCTTTTGGAAAACCTGGACTCAGACTTGTTGTTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTGTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAAAAAATAAAAAAAAAA
  5   1   3        nb Tad5      in                         XZT24200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAAAGCCTGGACTCAGACTTGTTGCTTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTT
  3   1   3        nb Liv1 5g3  in                         CAAR1750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAG
  3   1   3        nb Lun1 5g3  in                          CABD653.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCTATGAAGAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTGCAAGGTAGTGCTATGTCTTGTTAA
  5   1   3        nb Gas7      in                         XZG59152.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGCATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACANATACAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTA
  5   1   3        nb Mus1      in                         CABH1674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCACTGGAAGCCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGAATAATTGGAAAACT
  5   1   3        nb Sto1      in                         CABG2677.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTA
  5   1   3        nb Gas7      in                         XZG35626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGATGAAGAGATCAACGGAGAAGAGTCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAAACACAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAAATTTATTTATTT
  5   1   2       add Gas7                                 XZG12756.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAGGAGCAGGCCCAGATGTCTCCGAACCTGACAGTGTCTACATGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAANACA
  5   1   3        nb Thy1      in                        CBST7735.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTTAAT
  5   1   2       add Lun1      in                        CABD14108.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATTCCATATCCTCCTCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGGTTACTCGAGNNCATTAAGGCAAAATATTATTTATTTATGTATTTTTGTTTTATAAGTACAACTCGCTCA
  3   1   3        nb Int1 5g3  in                         CAAP8591.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCCATCTTCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTCCCCAAAACACAAGAGGTACATTTTTGCAATCCAATA
  5   1   3        nb Neu       in                   TNeu090p04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTCCTGTGGGGACCCCATCAGCCAAGCTGGAGGCGCTTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAGCCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGGTTGGGAAGACTCTTTCAGTACTGA
  3  -1   3        nb Liv1      in                        CAAR11659.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCA
  3   1   3        nb Fat1 5g3  in                         CABC1302.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTNGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAA
  5   1   3        nb Neu       in                  TNeu067j18.p1caSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGGAATTCCCCGGGGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGAGGAGCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTGCTTCATCTCCTGTGGATGCCGGTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTT
  3   1   2       add Lun1      in                         CABD7859.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTGGGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTAA
  3   1   3        nb Gas  5g3  in                    TGas062b05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGACCCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTATTAAAAAAAA
  3   1   2       add Liv1      in                         CAAR2351.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCATCAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAA
  3   1   3        nb Liv1      in                          CAAR851.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAA
  5   1   3        nb Neu       in                   TNeu079g12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAAGCTGGAGGCCATTAATGAACTGATCCGATTCGATCACGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTGCCATGCAGCTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTT
  5   1   3        nb TpA                            TTpA047d13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCGATTCGATCCGTGTACACCAAGCCACTAAGCACAGAGGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCNTAGAGCANCATACAAATCTGATTAAT
  5   1   2       add Gas7      in                         XZG41435.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAAACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAG
  5   1   3        nb TbA       in                   TTbA061c24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACTCTGAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCAGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTTGCATGCAGCTTTCTTTACTGANACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCANGAANGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATCTTTTTTTTA
  3   1   3        nb Liv1      out                        CAAR8070.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTAGGCGTTGAGACCAGCATAGTAGTTAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTAA
  5   1   3        nb Gas       in                   TGas136m03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTT
  5   1   3        nb HdA       in                  THdA030p14.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTAAATGGAGGAAGCATCTTTCAGCCCTACATGCAATGAAGACCTGACCTGTGTGAAACAGGAACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGGTATTTTTGTTTTTATAAGTACAACTCGCTCANGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTT
  5   1   2       add Gas1                               IMAGE:6988409                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTCCTGAGGATGTCTTACATGCAATGAAGGGCTGACCGGTGTTTCCGGCGAGCCACCAGCAAATGACCAAGTCTCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTATGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCATAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAAGGTAGTGCTATGGTCTTGTTAACTCGAGCCAATTAAAGGCAAATAATTTATTTACCTAAGGTATTTTTTGTATTTAAAAATACCAATTCGCCCAATGGGTTGTTCCCCTTTCCCGTATTTGGGACACAATGTATGCCTAATCCTTGGTCACCGGCTTTTGGTGGTGGCATGATTGGAAGCCCTCTCACCAAACCCTTTATCGTGAGGTTTATTTCTTTTTATTTTCCCGGGGCAGAGTTTTCTCCATCAAAAATCATAGGACTTAAGAGTCATTTTGATTGGCGTGTCCACAAAAGGGTTCCTTCAAAACAGGGGCTCCTGCCTCTGAAAAAAAAATTTTCAATTGGCCCCTACTTTAAACCCTCGCCCCAAAATACACGAAG
  5  -1   2       add Gas5                                   XZF508.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ttnttttttttttttttttttttttttttttttttttttttttttttttttttttNAAATAAATATTTGCCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAAAACAAGAGGTACATTTTTGCAATCCAATATGTTTG
  5   1   3        nb Brn4      in                        CAAL11923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCACAAGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCTTTTTT
  5   1   2       ext Spl1      in                          CABK833.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCATGCTCATTAACCCC
  3   1   2       add Gas7 5g3  in                         XZG40138.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGATGACCTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTTTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGGGAAACCCAATATTGTTGTACATTGCGCCCTTTTTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATTTTATCTTTTTTTAAGGTAAAAATCATTTTGTGATTCAGAAAGGGTCAGCTAAGAGCCCAATACAAATTTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGGGGTACCCCAAAACCCAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATTTTTTTTTT
  5   1   3        nb Gas7      in                         XZG41185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTAGTCCCTGTCCTCGGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTT
  3   1   2       add Gas7      in                         XZG41605.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAAATGCAAAGCTTTTTGCCCTTGTTCCGGAAACCACCCTTGAAAAATCATCAAACATATTGGATCCAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATTTCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTGGTATTCATTTTTTTTTTTAAGGTGGTCCCCCAAAACCCAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATTTTTTTTTT
  5   1   2       ext Mus1      in                         CABH9726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATGAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCTTTTTTTTTATA
  5   1   3        nb Neu                            TNeu027e20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGCTTTTTGCCCTGTNTCCGAAAACAACCTTGNAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTNTGGTGTGCAGTGATG
  3   1   2       ext Tad5 5g3  in                         XZT27474.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGGAAAACAGCACAG
  3   1   3        nb Gas7      in                         XZG58068.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACGCGTCCGCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTT
  5   1   3        nb Gas7      in                         XZG58068.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTAAAAAAAAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas1 5g3  in                     NISC_mq01e10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATTTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAGGGGCAAATATTTATTTAAAAAGAAAAAAAAAGGGCGGCCGC
  5   1   3        nb Gas                            TGas003l19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGAAGTGACTCTGGCTACGAAGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACAC
  5   1   3        nb Gas                            TGas050c19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCACTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCC
  5   1   3        nb Neu       in                   TNeu101j09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTT
  5   1   3        nb Spl1      in                        CABK10150.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACCTGTCCTCCCCTCTGAACTCTGACCGGGTTTGGGAAGACTCTTTCAGTACTGAACTTTTCCCTCAGCTCCTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTT
  5   1   3        nb Neu       in                   TNeu134b18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTCCCTCATTTCCTCCTCAGCACCCATATGGACCACTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGT
  5   1   2       add Gas7      in                         XZG27261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCTCAGCACCCATATGGACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCACTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCTTTTTTTTTTATAAGAAAAACAAATCTAGGTCTAGGTCATTGATGCTGTCACATG
  5   1   3        nb TpA       in                   TTpA044i18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCAGTCCATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAATGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAAATGGAATTAAGTATTTTCAAACATGCAGCTTTTTAAGTTCATAATGTACAATATAGACATATGTTTCTGTGATTACC
  5   1   3        nb Liv1      in                         CAAR6415.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTGTCCTTCATCTCCTGTTGATGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAAACAGTAAAGGGCAAGTATTAATGGAA
  5   1   2       add Gas7      in                         XZG57810.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAATGCAAAGCTTTTTGCCCTGTTCCGAAAACAACCTTGAAAAATCATCAAACATATTGGATACAGGAAGTGACTCTGGCTACGAAGGGTGCTCTTCACCCTTTAGTGACCTGTCCTCCTCCTCTCCCTGTCTCCCTGTCCCCCTGTCTCCCAGTCTGCCCCACGGATCCCCTGCACCCCTTGGACATGGTGGTCGTGGGAGCCCCCAAAGTGATCTTTATCCCCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCACTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCTTTTTTTTTTATAAGAAAAACAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATAAATGGAAATTAAGTATTTTCAAACATGCAGCTT
  5   1   3        nb Bone      in                        CBTC7009.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCCGTTTCTTTCTGGAGTCACAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCAT
  5   1   2       add Gas1                               IMAGE:6990779                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGGATCCAGCTCAGAGTTTGACGACGTACATTTTTAAATACATCTGTGCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAAGTGTCATGGNAATANNCAGTAAGGGCAGTATTATGGAAATNAGTATTTNCACATGCAGCTTTTAAAGTCATATGTACATATGACTATGTTCTTGATACTGAG
  5   1   2       add Gas7      in                         XZG29143.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTAAAAGTACAACTCACTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCC
  5   1   3        nb Tad5      in                         XZT20359.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCGAAACCCAATATTGTTGTACATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCAT
  3  -1   3        nb Spl1      in                         CABK2755.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAAACCCAATATTGTTGTCATTGCGCCCTTTCTTTCAGTATTGCCAGGTTACTAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTC
  5   1   3        nb Neu                            TNeu135b18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTTCTTTCATTTCCATTACTAAGCTTTCCATTCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAACGTAAAAATCATTCTCTGATTCAGGAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAAGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACCTCCTCAGTGGTGGTTCCCTTCCCTTATTGGGCACAGTGTGCCTATCCT
  5   1   3        nb Mus1      in                         CABH3828.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGAGGCTTTGCCATGCAGCTTTCTTTAACTGAAACAGATATCTGCCAGCATCTTATCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAAC
  5   1   3        nb Ski1      in                        CABJ11082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCAATTCGGCACGAGGCTTTTTTTAAGGTAAAAATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCT
  5   1   3        nb Gas                            TGas086j11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCATCTTATCTTTTTTTAAGGTAAATATCATTCTGTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTT
  5   1   2       add AbdN                               IMAGE:7004434                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTTCTTAGCAAAGATGGGTGCTGAAAAGGTAAAAGGGGGAATTTGTAATTTTTTTCCACCACTTTTCTGGCCATCCCCTTTTATTAAAATGCCACAAATGCCTTT
  5   1   3        nb AbdN                               IMAGE:7006617                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGGTGGAACTACAGATCCCAGCATCAATTTTTCTAGCAAAGATGGTTGCTGAAAGGTAAAAGGGGGAATTTGTAGTTTTTTCCAACCATTTTCTTGGCATCCCCCTTTTATAAATTGCAAAA
  5  -1   2       add Ovi1      in                         CABI9569.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGATTCAGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGG
  5   1   3        nb Liv1      in                        CAAR11900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAAGGGTCAGCTAAGAGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAATGCAAAATGCATTGTGT
  5   1   3        nb Neu                            TNeu019f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGGGGCACAATACAAATCTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCT
  3  -1   3        nb Sto1      in                        CABG10835.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGCGAGAGGGGAAAACTGATTTGTATTCATTTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCANAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGNGTACTCACTGCCACGTTTTTTATCCGTTTGATCGAATTAAATGCTTTCCCATTAACTGTCTTTAGATCG
  5   1   3        nb Liv1      in                        CAAR13344.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGATTAATTGGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTT
  5   1   2       add AbdN                               IMAGE:7021560                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAAACTGATTTGTATTCATTTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGGTGCTGAAAAGTAAAGGGGAAATTGTTATTTTTTCCACCATTTTCTGGCCATCCCCTTAATAAATGCAAAAATGCCATTGTGTTTGGGCCTTCCTCCTGGGTTATTCCACTGGCCCCACGTTTTTTT
  3  -1   3        nb TbA       in                    TTbA011p23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCTTTTTTTTTTTATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCAT
  5   1   3        nb Tbd1      in                        CBXT21735.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTTTTTTTAATGTGGTACCCCAAAACACAAGAGGTACATTTTTGCAATCCAATATGTTTGCAAGGTAGTGCTATGTCTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAAATCCAAGCAACTTTTTGACA
  5   1   3        nb Liv1      in                         CAAR1681.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGTTAACTCGAGCAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCANAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTA
  3  -1   3        nb Sto1                                 CABG3122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCCATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAGATTTTTAGTTGTGATCACAAATGTCCTTGTAT
  3  -1   3        nb Ski1      in                         CABJ5121.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAG
  3  -1   3        nb Int1      in                        CAAP10446.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATTAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTANATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTA
  5   1   3        nb HdA       in                  THdA035m17.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAAGGCAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTA
  5   1   3        nb Sto1      in                        CABG12460.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAA
  5   1   3        nb Bone      in                        CBTC9728.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATATTTATTTATTTATGTATTTTTGTTTTTATAAGTACAACTCGCTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTANATGCTTTCCCATTAAACTGTCTTTAGATCGNGTCAGATTACATGACACTGC
  3   1   2       add Tad5      in                         XZT59926.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCGTTTTTAGAGGTACAACTCACTCAGTGGTGGTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTAGGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATCCTTTTTTGTTGTGTGCTGTTTTCCATCTTTTTTTTTTATAAGAAAAACAAATCTAGGTTTAGGTCATTGATGCTGTCACACGGTCTCTACAGGTCTGCATGAAAATTTCAATGACCTAGACCTAGATTTGTTTTTCTTTT
  5   1   3        nb Gas       in                   TGas097g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGACTCTTTCAGTACTGAACTTTTCCCTTCCGTAATTGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGC
  5   1   3        nb Liv1      in                         CAAR2483.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGAGGGCACAGTGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAG
  5   1   3        nb Liv1      in                         CAAR1682.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACAGATGTGCCTATCCTTGTCACTGCTTTGGTGTGCAGTGATGGAAGCCACACACAACCCTTATCTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCACATCTAGGTCTAAGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCTATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACATAATAAACTTGTTTGCCATTCATATCTATAAGAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTATATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGA
  5   1   3        nb Fat1      in                         CABC7586.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAGTTATTCTTTTTTTTCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATG
  3   1   2       ext Sto1      in                        CABG10233.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGTATTCTTTTTTTCTGTGCTGTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCNCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAA
  3   1   3        nb Ski1      in                        CABJ12279.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTGTGCTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCNCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTACCTCTCGCCCTAT
  5  -1   3        nb Liv1      in                        CAAR11659.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATT
  3   1   2       add Lun1      in                        CABD14108.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAG
  3   1   2       ext Spl1      in                          CABK833.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTCCATCAAATCTAGGTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTAATGCTCATTACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   0       chi Neu                             TNeu077h02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAATGGGATGGCTCATTGCCCATTCATATCCGTTCTCACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCACTTGGCAGTACATCAATATCTATTAATAGTAACTTGGCAAGTACATTACTATTGGAAGTACGCCAGGGTACATTGGCAGTACTCCCATTGACGTCAATGGCGGTAAATGGCCCGCGATGGCTGCCAAGTACATCCCCATTGACGTCAATGGGGAGGGGCAATGACGCAAATGGGCGTTccattgacgtaaatgggcggtaggcgtgcctaatgggaggtctatataagcaATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAA
  3   1   3        nb Fat1      in                         CABC4552.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAA
  3   1   2       ext Mus1      in                         CABH9726.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCTAGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCNCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAA
  3   1   3        nb Int1 5g3  in                         CAAP9938.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCNCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTT
  3   1   3        nb Gas                             TGas088n13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATTTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCTTTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAAGATTTAAAACTACTATGCCATTAAA
  3   1   3        nb Gas       in                    TGas097g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTANNCTATGCCCATTAAAG
  3   1   3        nb Neu       in                    TNeu079g12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAA
  3   1   3        nb TbA  5g3  in                    TTbA063h13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCNCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTTTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTTTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCTTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAG
  3   1   3        nb Brn4      in                        CAAL11923.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCAAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Spl1 5g3  in                         CABK5870.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  5  -1   3        nb Liv1      out                       CAAR11343.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTCATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAATTCAATGCTCATAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTAAACGAATCGAT
  5   1   3        nb Fat1      in                         CABC1383.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTC
  3   1   3        nb Gas       in                    TGas136m03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAG
  3   1   3        nb Neu  5g3  in                    TNeu112n21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGATGCTGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGNCCATTAAA
  5   1   3        nb Spl1      in                         CABK8838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCTCGTCACATGGTCTCTACAGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTTATA
  3   1   3        nb Spl1 5g3  in                         CABK6927.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATGCTGTCACATGTCTCTACAGTCTGCATGAAAAATCAATGCTCATTACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Fat1      in                         CABC7586.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCTCTACAGGTCTGCATGAAAAATTCATTGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAA
  3   1   3        nb Tad5      in                         XZT20359.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGGTCTGCATGAAAAATTCAATGCTCATTACCCCCAAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Tad5                                 XZT60855.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACAGGTCTGCATGAAAAATTCAATGCTCATTACCCNCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Spl1      in                         CABK8838.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAGGTCTGCATGAAAAATTCAATGCTCATTACCCNCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAA
  3   1   3        nb Sto1      in                        CABG12460.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGTCTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  5   1   3        nb Gas7      in                         XZG46890.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAG
  3   1   3        nb Sto1      in                         CABG2677.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGC
  3   1   2       add Gas       in                    TGas132d05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCCATTAAA
  3   1   3        nb TpA       in                    TTpA044i18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGT
  3   1   3        nb Gas7      in                         XZG59152.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCATGAAAAATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATCCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCTTTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Ski1      in                        CABJ11082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATGAAAAATCAATGCTCATTACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAG
  5  -1   3        nb TbA       in                   TTbA011p23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAATTCAATGCTCATTAGCCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTTTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGTTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAATAAAAAAAAA
  5   1   2       ext TpA       in                   TTpA057f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATTAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  5  -1   3        nb Ski1      in                         CABJ5121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCAATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGC
  5   1   3        nb Gas7                                  XZG9389.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTCATGCTCATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGNGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTTAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTA
  3   1   3        nb Ski1 5g3  in                         CABJ1951.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAATGCTCATTAACCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Spl1      in                        CABK10150.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTCATAAACCCCCCAAAACAAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Lun1 5g3  in                         CABD4888.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCTCATAACCCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAA
  3   1   3        nb Mus1      in                         CABH1674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATACAACTTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAA
  5  -1   3        nb Spl1      in                         CABK2755.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   4      seed TbA       in                   TTbA008o12.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTAACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAAAG
  3   1   3        nb TpA  5g3  in                    TTpA024c13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCCCCAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTTTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTTTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATTTGCAATGACATATTTTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCCCCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCATTAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Tail      in                         CBSW7930.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCAAAACAAAGGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCCACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCATTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGC
  3   1   3        nb Spl1 5g3  in                         CABK4349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   2       add Fat1 5x3  in                         CABC7905.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACAAAGGTGTCATCCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAA
  3   1   3        nb Spl1 5g3  in                        CABK11102.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Ovi1      in                         CABI6838.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAACAAAGGTGTCATTCCACAGATTAAACTTGTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Spl1 5g3  in                         CABK8754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGC
  3   1   3        nb Fat1      in                         CABC1383.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTNTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAA
  5  -1   3        nb Sto1      in                        CABG10835.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAGGTGTCATTCCACAGATTAAACTTGTNTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAG
  3   1   3        nb Ski1      in                         CABJ5819.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCA
  3   1   2       ext Spl1      in                         CABK3729.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAGGTGTCATCCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAGCCTCTCGCCCTATA
  3   1   3        nb Tad5      in                         XZT72758.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAGGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Liv1      in                         CAAR2483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAA
  3   1   3        nb Liv1      in                         CAAR1681.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAA
  3   1   3        nb Sto1      in                        CABG10776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGC
  3   1   3        nb Liv1      in                        CAAR11900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Liv1      in                        CAAR13344.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATCCCACAGATAAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Liv1 5g3  in                         CAAR1627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Gas7 5g3  in                         XZG36121.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   2       add Gas7      in                         XZG57810.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTTTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCCCCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Gas7 5g3  in                         XZG58591.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb TpA       in                    TTpA016c04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCATTCCACAGATTAACTGTTTGCCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAG
  5  -1   3        nb Ovi1      in                         CABI8025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTCCACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3  -1   3        nb Sto1      in                         CABG3311.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCGAGAGGTTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAG
  3   1   3        nb TbA       in                    TTbA001k21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAA
  3   1   3        nb TbA       in                    TTbA002h09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAA
  3   1   3        nb TbA                             TTbA056m02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTTTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTTTAGCAAAGATGGTGGTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTTTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTGTGATCGAATTAAATGCTTTCCCATTAAACAGTCTTTAGATCGGGTCAGATTACAAGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATTTGCAACGACATATTTTCAGCAAGTTTGCCTTTCTGTTAAGATTCTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACCGTGTAAATGAGAGGACTATATATTTCCACCCTTTTTATTTTAGAGGCTAAGAAATTTGCTTTCTCCATTTAATATTTAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Liv1 5g3  in                         CAAR2854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   2       ext TbA  5g3  in                    TTbA046c09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTTTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAAAAGC
  5  -1   3        nb Int1      in                        CAAP10446.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTC
  3   1   3        nb Mus1      in                         CABH3828.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Tad5      in                         XZT29826.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGATTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  5  -1   3        nb Sto1      in                         CABG3311.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAAACTTGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAG
  3   1   3        nb Fat1 5g3  in                         CABC2090.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Brn3 5g3  in                         CAAK1854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCATGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Ski1      in                         CABJ2311.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGCCATTCATATCTATACAAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Liv1      in                         CAAR1682.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATTCATATCTATACAAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTGTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATGTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAAGATGATTATTATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAGCCTCTCGC
  3   1   3        nb Gas7 5g3  in                         XZG52306.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Te4  5g3  in                         CAAN5693.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTNGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Te4  5g3  in                         CAAN7074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Liv1 5g3  in                         CAAR7019.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTCATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Bone      in                        CBTC9728.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   2       ext Liv1 5g3  in                         CAAR8651.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Ski1      in                          CABJ713.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATATCTATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  3   1   3        nb Gas7 5g3  in                         XZG41821.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAACAACTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAAT
  5   1   3        nb Bone      in                        CBTC3481.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAACTTAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTA
  3   1   3        nb Neu       in                    TNeu090p04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTTTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAAA
  3   1   2       ext TpA       in                    TTpA057f17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Gas7      in                         XZG31435.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGTTTATTTTCACTAATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAATTCTTTGCAAAAAAAAAAAAAAAGG
  5   1   3        nb Gas       out                  TGas069e05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGGTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCTTTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTAC
  3   1   2       add Gas7      in                         XZG27261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTTTATTTTCACTAATAAAATCCAAGCGACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGTTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTGTGATCCACAAATGTCCTTGTATATAAAGTTCTACCAGCAGGGGGTAGGAATGTACAGAACCACAGTATCCTGCAGATCAGACTTTTATTTTAAATTTACTGTGTAAATGAGATGATTATATATTTCCACCATTTTTATTTTAGAGGTTAAGAAATTTGCTTTCTCCATTTAATATTTAAAACTACTATGCCATTAAAGTGCAATAAAAAAAATTCTTTGCAAAAAAAAAAAAAAAGG
  5   1   3        nb Neu                            TNeu027l21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGGATAAAATCCAAGCAACTTTTTGACAGTGCTGTGGGAGGATGATTCTACATATTGCCAAGTGTTCATGGAAATAACAAGTAAAGGGCAAGTATTAATGGAAATTAAGTATTTTCAAACATGCAGCTTTTTAAAGTTCATAATGTACAAATATAGACATATGTTTCTGTGATTACCTGAGGCCAATAAGGCAGACTTTATCATTGCTTCACAACCTACCAGGTGCATGGCAGTCTATCCATGGTGGAACTACAGATCCCAGCATCAATTTTCTAGCAAAGATGGTGCTGAAAGGTAAAGGGGAATTGTAGTTTTTCCACCATTTCTGGCATCCCTTTATAAATGCAAAATGCATTGTGTTGGCCTTCTCTGGTTACTCACTGCCACGTTTTTATTCCGTTTGATCGAATTAAATGCTTTCCCATTAAACTGTCTTTAGATCGGGTCAGATTACATGACACTGCTGCTGATTTTAAGAAGAAGATTTTGTTTGTATCTGCAATGACATATTCTCAGCAAGTTTGCCTTTCTGTTAAGATTTTTAGTTG